|
|
||||||||




*
Immunology Program, Graduate School of Medical Sciences, and Department of Medicine, Weill Medical College, Cornell University Weill, New York, NY 10021;
Institut National de la Santé et de la Recherche Médicale, Unit 463, Institut de Biologie, Nantes, France; and
Veterans Affairs Medical Center, University of Pennsylvania, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In considering potential T cell Ags in RA, recent studies have revived an older literature on herpes viruses, in particular EBV 9 . These studies showed that in the joints of patients with RA, there were large numbers of CD8 T cells that were specific for EBV transactivator gene products, such as BZLF1 and BMLF1 10, 11 .
In Japanese patients infected with HTLV-1, a clinical disease
indistinguishable from idiopathic RA has been described 12 . Exposure
of synoviocytes to the tax protein (HTLV-1 transactivator) resulted in
increased mRNA levels of cytokines, such as IL-1ß, IL-6, and TNF-
13 . A mouse transgenic for the HTLV-1 tax gene developed RA-like
disease 14 . These observations indicate that an intact virus may not
be required to develop arthritis. Expression of a viral transactivator
protein alone may suffice to induce inflammatory cytokines and an
organ-specific autoimmune disease.
By analogy with the HTLV-1 tax model, we postulated that herpes viral transactivators might also play a role in synovial inflammation. The EBV transactivators, BZLF1 and BMLF1, are associated with lytic infection of B lymphocytes. Synovium is not known as a site of lytic EBV infection, but it is at least theoretically possible that transactivators are expressed during abortive viral replication, perhaps in unusual host cells such as synoviocytes 15 . Previous studies had addressed the presence of herpes viral DNA in RA synovia by PCR and were inconclusive 16, 17 . No studies have focused on transcription of herpes viral mRNAs in synovial tissues.
In this work, synovial tissues from patients with RA were examined for the presence of human herpesvirus (HHV) 4 (EBV), HHV5 (CMV), HHV6, HHV7, and HHV8) DNA by sensitive radioactive PCRs. EBV DNA was most prevalent. Synovial tissues were next examined for the presence of viral transcripts that encode potential T cell Ags. Samples of particular interest were from patients with documented synovial T cell clones specific for EBV Ags. We considered two possible outcomes. 1) EBV viral transcripts could be increased in RA compared with controls, indicating that viral Ags might be driving the expansion of synovial T cell clones specific for these Ags. 2) mRNA for the viral Ags might not be increased in RA or even absent, indicating that the corresponding synovial T cell clones were cross-reactive with unidentified self-Ags or that they homed to the synovium independent of synovial Ag expression.
| Materials and Methods |
|---|
|
|
|---|
|
|
|
For infections with HHV6 (strain U1102) and HHV7 (strain JI),
which infect T lymphocytes, PBL (5 x 106) from cord
blood were placed in culture (RPMI 1640, 10% FCS, 0.2 U/ml penicillin,
0.2 mg/ml streptomycin, 2 mg/ml fungizone, and 2 mM
L-glutamine) with PHA (50 µg/ml) for 3 days. The
activated PBL were infected with a multiplicity of infection
1 with
each virus in the presence of Polybrene (2 µg/ml) for 2 h. The
cells were washed three times and cultured for 3 wk with the addition
of IL-2 (40 IU/ml) every 34 days. The cells were harvested in
aliquots of 2 x 106 cells each, and genomic DNA was
prepared as described. As a source of EBV, a transformed B cell line,
BSKS2- (courtesy of E. Cesarman, Weill Medical College, Cornell
University), was used. For CMV, MRC5 fibroblasts were infected
at multiplicity of infection
1 20 and harvested after 7 days. For
HHV8, which infects B cells 21 , a transformed B cell line, BSKS2+
(courtesy of E. Cesarman, Weill Medical College, Cornell University),
containing both EBV and HHV8 was used.
Preparation of DNA and cDNA
Genomic DNA was obtained from samples (
106 PBL or
0.1 mg of synovial tissue) by lysis in 50 µl of 10 mM Tris-HCl, 1
mM EDTA, 0.001% Triton X-100, 0.0001% SDS, and 600 µg/ml proteinase
K, pH 8.0, for 1 h at 56°C, followed by 95°C for 15 min. RNA
was isolated from samples (
106 PBL or
0.1 mg of
synovial tissue) using Ultraspec RNA (Biotecx Laboratories, Houston,
TX) according to the manufacturers instructions. cDNA synthesis was
performed with 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl2; 5 µg RT6 primer (Promega, Madison, WI), 0.3 U/ml
RNase inhibitor (Promega); 5 U of Moloney murine leukemia virus RT
(Life Technologies, Grand Island, NY), and 0.5 mM deoxynucleotide
triphosphates (dNTPs; Pharmacia, Piscataway, NJ) for 1 h at
42°C, followed by 1 min at 95°C.
Genomic PCR and RT-PCR
The genomic PCRs were performed using the following primers (5' to 3') and optimal conditions. In each case, the quantity of primers was 10100 pmol/reaction.
Primers for EBV (strain B95-8) were the following: sense, AACATGCTGTATGCCTCGCAGCG (124,935124,957), and antisense, AATTACTGGCGTGAATTGTGCCCA (125,109125,086). Conditions were as follows: 3 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 58°C for 90 s, and 72°C for 1 min; the product was 175 bp 22 .
Primers for CMV (IE1 gene of strain AD169) were the following: sense, TTCTATGCCGCACCATGTCC (exon 4), and antisense, TGGAGTCCTCTGCCAAGAGA (exon 2). Conditions were as follows: 2.25 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 60°C for 90 s, and 72°C for 2 min; the product was 581 bp 23 .
Primers for HHV6 (strain U1102) were the following: sense, AAGCTTGCACAATGCCAAAAAACAG (17,62717,603), and antisense, CTCGAGTATGCCGAGACCCCTAATC (17,40517,429). Conditions were as follows: 2 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 65°C for 1 min, and 72°C for 2 min; the product was 223 bp 22 .
Primers for HHV7 (strain JI, primers derived from clone 43L3, 171 nucleotides) were the following: sense, CAGAAATGATAGACAGATGTTGG 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 , and antisense, TAGATTTTTTGAAAAAGATTTAATAAC (171154). Conditions were as follows: 1.5 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 55°C for 2 min; the product was 123 bp 24 .
Primers for HHV8 (region homologous to EBV BDLF1 and herpesvirus saimiri ORF26) were the following: sense, AGCCGAAAGGATTCCACCAT (9871006), and antisense, CTGGACGTAGACAACACGGA (12001219). Conditions were as follows: 1.5 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 64°C for 1 min, and 72°C for 90 s; the product was 233 bp 25 .
For the RT-PCRs, the following protocols were used, and the genomic coordinates of each primer are given in parentheses. For the EBNA1 Y3 spliced transcript (265-bp PCR product), the sense primer was 5'-GGCGTGTGTGACGTGGTGTAA (48,39748,416); for the Q spliced transcript (238-bp PCR product), the sense primer was 5'-GTGCGCTACCGGATGGCG (62,44062,457); in both cases, the antisense primer was 5'-CATTTCCAGGTCCTGTACCT (107,986107,967) 26 .
For the BZLF1 spliced transcript (182-bp PCR product), the sense primer was 5'-TTCCACAGCCTGCACCAGTG (102,719102,700), the antisense primer was 5'-GGCAGCAGCCACCTCACGGT (102,330102,341/102,424102,433), and the probe was 5'-CTTAAACTTGGCCCGGCATT 27 .
For the EBER1 unspliced transcript (167-bp PCR product), the sense primer was 5'-AAAACATGCGGACCACCAGC (67766795), and the antisense primer was 5'-AGGACCTACGCTGCCCTAGA (66486629) 27 .
The reaction conditions for each of the above RT-PCRs were as
follows: 40 cycles of 94°C for 30 s, 60°C for 60 s, and
72°C for 1 min; 1.7 mM MgCl2; and 0.2 mM dNTPs containing
[
-32P]dCTP (1 x 105 cpm per
reaction, Amersham, Arlington Heights, IL).
For the BMLF1 unspliced transcript (172-bp PCR product), the sense primer was 5'-TAGTCTCGCGTGTTAGGAAGG (83,09883,118), and the antisense primer was 5'-TGGCCATGCTAGAAGAGACC (83,25083,269). Conditions were 35 PCR cycles at 94°C for 1 min, 59°C for 1 min, and 72°C for 1 min; 4 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.
For the BALF2 unspliced transcript (203-bp PCR product), the sense primer was 5'-CGGCAACAACCAGATATTCC (161,999161,980), and the antisense primer was 5'-CAATCTCATATGTGGTCGCG (161,816161,797). Conditions were 36 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 2 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.
For the BHRF1 unspliced transcript (239-bp PCR product), the sense primer was 5'-TGGCCTATTCAACAAGGGAG (54,37754,396), and the antisense primer was 5'-ATCCACATGTTCGGTGTGTG (54,59654,615). Conditions were 36 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 1.5 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.
For the actin unspliced transcript with primers in exon 4 (281-bp PCR product), the sense primer was 5'-CCTCATGAAGATCCTCACCG, and the antisense primer was 5'-AAGGAAGGCTGGAAGAGTGC. Conditions were 30 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 1.5 mM MgCl2; 12.5 pmol of each primer; 0.1 mM dNTP; and radioactive dCTP.
For the CD19 spliced transcript (170-bp PCR product), the sense primer was 5'-TCAACGTCTCTCAACAGATGG (exon 1), and the antisense primer was 5'-TGAGGACCTGTTCTTCAGGC (exon 2). Conditions were 30 PCR cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min; 3.0 mM MgCl2; 10 pmol of each primer; 0.5 mM dNTP; and radioactive dCTP.
All samples from patients were analyzed by the radioactive PCR
described above, and the products were resolved on an 8%
polyacrylamide gel for
2 h at a constant voltage of 120 V. Each
radioactive gel was exposed to x-ray film (Biomax, Kodak, Rochester,
NY) for variable times, up to a 1-wk exposure. In the case of the
BZLF1, PCR products were resolved on a 1.5% agarose gel and
transferred to a nylon membrane (Hybond-N, Amersham) for standard
Southern blotting. A recent modification was used that accounts for the
properties of a short oligonucleotide probe 28 . The probe was end
labeled by polynucleotide kinase (Boehringer-Mannheim, Indianapolis,
IN) and [
-32P]ATP (Amersham) using the manufacturers
protocol. The labeled probe had a specific activity of
107 cpm/mmol.
CD8 T cell lines for testing reactivity with transfected EBV genes
Synovial lymphocytes were sorted by immunomagnetic sorting using an anti-CD8-specific MAb and CD8+ cells expanded in vitro with IL-2, as described elsewhere 29 . Cell lines were maintained in RPMI 1640 supplemented with 10% human serum, 1 mM L-glutamine, and rIL-2 (150 IU/ml). At least 98% of the cells were CD8+ by flow cytometry in all of the cell lines studied. These T cell lines were used to screen for reactivity against a panel of transfected COS cells. The COS cells were transfected with a combination of an HLA class I allele and an EBV gene as detailed below.
Expression vectors
Expression vectors encoding six lytic EBV proteins (BZLF1, BMLF1, BRLF1, BCRF1, BMRF1, and BHRF1) and all of the latent EBV proteins (EBNA1, -2, -3a, -3b, -3c, LP, LMP1, and LMP2) were used to transfect COS cells as described elsewhere 29 . BMLF1 and BZLF1 cDNAs, cloned into pcDNA3 (Invitrogen, Leek, The Netherlands), were derived from a cDNA library prepared from B lymphoblastoid cells from patient RA1 11 . We also used expression vectors containing DNA or cDNA encoding various HLA class I alleles 29 .
COS transfections and T cell stimulation assay
Transfection into COS cells was performed by the DEAE dextran chloroquine method 30 . In brief, COS cells were cotransfected with an expression vector coding for an EBV protein and an expression vector coding for one of the HLA alleles. Transfected COS cells were tested 48 h after transfection in a CTL stimulation assay. Varying numbers of responder T cells (103, 104, and 105 per well) were added to transfected COS cells, and culture supernatants were tested 6 h later for TNF production by a sensitive bioassay 29, 31 .
| Results |
|---|
|
|
|---|
RT-PCR for EBER1 was the most sensitive assay used. EBER RNAs are
small, nonpolyadenylated viral RNAs that are by far the most abundant
RNAs in latently infected cells 32 . Fig. 2
demonstrates the degree of
reproducibility between two experiments with this PCR showing the same
patterns of band intensities. Samples from normal PBL (NL16), RA PBL,
and RA synovial tissue were analyzed. The results were compared with
RT-PCR using cDNA from the indicated cell number equivalents of an
EBV-transformed cell line. The experimental samples, both PBL and
synovial tissue, which contained on average
105106 cell equivalents per PCR reaction,
yielded bands in the intensity range below 1 EBV-transformed cell. This
indicates that cells transcribing EBER1 are rare and is consistent with
estimates of a low frequency of EBV-infected B cells in latently
infected individuals,
10-510-6 33 .
Fig. 2
further demonstrates the sensitivity of the assay. By analyzing
10-fold dilutions of the cDNA templates, it was shown that most samples
contained EBER1 RNA at 12 logs above the detection limits of the
assay.
A series of similar RT-PCR experiments were next performed to assess
transcription of several EBV genes: the immediate early transactivator,
BZLF1, and the early transactivator, BMLF1 32 , as well as the
latency-associated EBER1, EBNA1 Q, and EBNA1 Y3 (Fig. 3
and data not shown). Each sample
analyzed was also tested for the presence of mRNA of a constitutive
cellular housekeeping gene (actin). In addition, the samples were
tested for the presence of CD19 mRNA as an internal control for the
presence of B cells in the tissue sample. CD19 was chosen because of
the consistent expression of mRNA throughout differentiation of the B
cell lineage 34 . Each experiment included the same set of controls:
dilutions of template cDNA ranging from 1 to 1000 cell equivalents, a
water control, and a control without RT. Exposures of autoradiograms
were varied such that the positive control serial dilutions gave
approximately the same intensities (see Fig. 2
) in each experiment.
Fig. 3
is a composite of these experiments. It should be emphasized
that these PCRs were designed for optimal sensitivity, but not
for quantitation, since they were run to saturation.
Fig. 3
shows that synovial samples from RA patients did not differ from
those of disease controls, which included synovial tissues from OA and
GW patients. All samples appeared negative for BMLF1 transcripts, while
most samples were positive for BZLF1 and EBER1. However, it is
important to recall that EBER1 is expressed at multiple copies per
cell; thus, this PCR assay is much more sensitive. In addition, repeat
analyses of the BMLF1 PCR showed that weak bands were detectable in ex
vivo tissues in only one of six experiments despite consistently
intense bands for the positive controls, as shown in Fig. 3
. Thus,
BMLF1 mRNA levels were just below the limits of detection of this
assay. At any rate, all experiments showed no apparent difference
between RA and control groups. Comparisons between PBL samples from
normal and disease controls and RA patients also showed no differences.
A consistent finding was the variable presence of CD19 mRNA in all of the synovial tissue samples. Separate samples dissected from the same surgical tissue (i.e., samples 20a and 20b) yielded variable intensities of the RT-PCR CD19 bands. This is consistent with previous findings on the focal nature of B cell infiltrates in the synovium 35 . In some cases, a heavy CD19 band appeared to correlate with up-regulation of EBER1 message, as in samples of normal NT PBL cells stimulated with PHA and in a patient with SLE. However, in most synovial tissue samples there was little correlation between the presence of CD19 and EBV gene expression. Some samples contained EBV transcripts but no detectable CD19. There were two possible explanations. The CD19 RT-PCR may have been less sensitive than the EBV PCRs. Alternatively, viral transcripts may have derived from cell types other than B lymphocytes.
Fig. 3
contains two sets of RA samples analyzed in detail in previous
studies. First, samples from patients P and C had been shown to contain
well-characterized clonal T cell expansions 18 . These samples were no
different from other RA samples in the expression of EBV genes (Fig. 3
). Second, patients RA19 and RA1 had previously been shown to contain
CD8 clonal expansions in synovial fluid. These clones were then found
to recognize antigenic peptides derived from the EBV transactivator
proteins BZLF1 and BMLF1 10, 11 . Patient RA3 also had CD8 T cells
derived from the synovial fluid that reacted with BMLF1 and BZLF1
(Table I
). Samples from these three
patients (Fig. 3
, arrowheads) gave RT-PCR bands that were
similar to those of all other patients and controls. Thus, in RA joints
with well-documented infiltration by CD8 T cell clones specific for
BMLF1 and BZLF1, either mRNA for the same viral Ags was not detectable
(BMLF1) or there was no difference in expression compared with disease
control samples (BZLF1).
|
B 43, 44, 45, 46 ,
which could explain the presence of BZLF1 message in the absence of
overt lytic EBV infection in normal PBL 33, 47 .
Because BMLF1 mRNA levels were barely detectable, we selected two EBV
genes that are usually prominently expressed during lytic infection:
BALF2 and BHRF1 32 . There was no transcription of BHRF1 and only
rare, low levels of BALF2 in both RA and control samples (Fig. 4
). These results lend further support to
the idea that lytic infection is abortive in these ex vivo tissues.
|
To assess how commonly EBV-specific T cell responses are found in
synovial samples from RA patients, CD8 T cell lines were generated from
four RA patients and one Reiters syndrome patient (RS2). The cell
lines were then tested against cotransfectants expressing an HLA class
I allele of the patient and one of several candidate EBV proteins 29 .
Reactivity was scored in a sensitive assay by measuring TNF-
release. A summary of these data is given in Table I
. The results show
that patient RA1, e.g., had synovial T cells recognizing seven
different EBV proteins. In the case of BZLF1, three different HLA class
I-presenting alleles (A*02, B*61, and Cw*01) could be used,
indicating that there were probably several different BZLF1 peptides
recognized. In each patient, CD8 T cells reactive with at least two EBV
proteins were detected. BZLF1 and EBNA3A were the most commonly
recognized Ags. The Ags included both EBV lytic proteins and latent
proteins.
Concerning CD8 T cells reactive with EBV Ags, patients with Reiters
syndrome (such as RS2), psoriatic arthritis, and ankylosing spondylitis
gave results similar to those of RA patients (Table I
and 29 .
Therefore, it is unlikely that EBV-specific CD8 T cells in synovial
tissues are unique to RA. In each of the five cases represented in
Table I
, different RT-PCRs failed to show evidence of overexpressed EBV
transcripts in synovial tissues, despite the presence of the EBV Ag
recognizing T cells (Fig. 3
and Table I
). Thus, the presence of these
CD8 T cells in synovial tissues of various patients with arthritis is
not due to the production of viral Ags in the synovium.
| Discussion |
|---|
|
|
|---|
There is a long history of studies on the role of EBV in RA. The original excitement about EBV was due to the description, in sera from RA and Sjögrens syndrome patients, of Abs that were reactive with EBV-transformed B cell lines 48 . Later studies gave conflicting results in support of a role of EBV in RA pathogenesis 49, 50 , but it is still thought that RA patients have higher numbers of EBV-infected B cells than controls. Most normal adults have a controlled, latent infection by EBV. The estimate for the frequency of EBV-infected cells among total B cells during latent infection is 10-5 to 10-6, and in acute infectious mononucleosis it may be as high as 10-1 33 . Compared with latently infected controls, RA patients may have higher titers of Abs against EBV Ags 51 , and at least a 10-fold higher frequency of EBV-infected B cells in the peripheral blood 52, 53 . IgG anti-viral capsid Ag titers to EBV were reported to correlate with high titers of IgM RF in RA 54 . Serum Abs to lytic-phase proteins BMRF1 and BHRF1 were also described in some patients 55 .
Lytic-phase EBV proteins are expressed by productively infected cells. Indeed, RA patients may have higher levels of EBV and HHV6 shedding in the oropharynx 53, 56, 57 . Whether the greater degree of productive EBV infection in RA extends to other tissues is still an unsettled question. In the joint, the most obvious source of EBV is B lymphocytes resident in the synovium. However, it is not yet clear that EBV+ B cells are enriched in the synovium or that they are productively, rather than latently, infected.
Other synovial cell types might also be infected with EBV. Koide et al. have recently established an RA synovium-derived fibroblastoid cell line (with features of the synoviocyte type I), which expresses the latency genes EBNA1, EBNA2, and LMP1 and also expresses early Ag and viral capsid Ag in a small percentage of cells 15 . However, it is not yet clear whether fresh ex vivo synoviocytes are infected with EBV. EBV can also infect endothelial cells in vitro 58 , follicular dendritic cell lines in vitro 59 , T cells in hemophagocytic syndrome 60 , and smooth muscle tumor cells in immunosuppressed hosts in vivo 61, 62 . These cell types are clearly present in inflamed synovial tissue. Samples from the GW patients contained very little CD19 mRNA, and yet EBV transcripts were demonstrated in both the GW and in the RA patients. This result might mean that cells other than B cells are transcribing EBV genes in these samples.
With all of the prior suggestive results, it is perhaps conspicuous that PCR studies measuring genomic DNA of EBV within synovial tissues, or in blood, have been quite inconclusive. For example, the percentage of positive samples for EBV DNA in RA synovial fluids was 19%, vs 33% for reactive arthritis 16 . The percentage of samples containing detectable EBV genomic DNA in the peripheral blood was similar among several patient groups: RA (39%), reactive arthritis (39%), other arthropathies (27%), and normal controls (31%). In one study, EBV DNA was found in synovial tissue of 23% of RA patients and in no OA synovial tissues as measured by in situ hybridization 17 , but yet another study using the same technique with BHLF1 and EBER probes failed to detect EBV DNA in RA synovial tissue 63 .
By analyzing RNA for EBV genes by RT-PCR, our data extend previous work
on the presence of EBV genes. The results, however, provided no
evidence for EBV Ag expression in joint tissues that was any different
in RA vs controls or in joint vs blood. The most striking finding was
that joints, heavily infiltrated with EBV-specific CD8 T cells, lacked
evidence of abnormal expression of the relevant EBV Ag. For instance,
in fresh ex vivo synovial fluid of patient RA1, Vß2 CD8 T cells were
expanded to 15%, vs 6.9% in the PBL 10 . The majority of these cells
expressed a TCR Vß2 with a CDRIII region of eight amino acids in
length with predominant usage of a Jß1.2 segment. Among these cells,
the most common TCRß CDRIII sequence was RDRIGNGY, representing an
estimated 22% of the Vß2 CD8 cells or 3.3% of all CD8 cells. A CD8
T cell clone derived in vitro from the synovial fluid T cells (A2.10)
and expressing the same TCRß-chain 10 was then used to clone the Ag
recognized by this TCR 11 . This was a 9-mer peptide of BMLF1
(GLCTLVAML) presented by HLA-A*0201. Yet, the data in Fig. 3
of this
paper clearly show that BMLF1 mRNA was below the limits of detection in
the same synovial tissue from patient RA1. The same arguments can be
made for BMLF1-specific T cells in RA3 and BZLF1-specific T cells in
RA1, RA19, and RA3 (Table I
), in that the T cells appear to be enriched
in the synovium in the absence of abnormal expression of these EBV
genes.
The lack of detectable EBV lytic-phase Ag expression could simply be
due to efficient removal of the productively infected cells by
cytotoxic T cells. However, patients RA1 and RA3 had increased synovial
CD8 T cells specific for BZLF1 (Table I
), and these T cells were
apparently unable to remove all of the cells producing BZLF1, since
this transcript was detectable in the same synovial samples (Fig. 3
, arrowheads). Moreover, productively infected cells in the
oropharynx can generate viral transcripts and proteins despite the
presence of specific CTL. Thus, we do not favor this possibility.
Overall, the results suggest several possibilities, as detailed below.
1) Expression of EBV viral Ags may not be quantitatively increased as assessed by RT-PCR, but instead there may be qualitative changes. For instance, viral proteins may be differently processed in the setting of synovial inflammation. Perhaps the APCs are unusual, i.e., dendritic cells, endothelial cells, or infected synoviocytes 15, 58, 59 , rather than EBV-infected B cells. Perhaps protein/protein interactions, such as those reported with BZLF1 43, 44, 45, 46 , influence Ag processing. In this way, Ag processing was altered when tetanus toxoid was bound to specific Ab 64 or when CD4 was bound to HIV-1 gp120 65 . This can lead to presentation of cryptic neoepitopes, a possible source of autoimmunity 66 .
2) An alternative possibility, which does not require qualitative changes in Ag presentation in the synovium, is that dendritic cells take up EBV Ag at a distant site. This might be a mucosal epithelium at which productively EBV-infected epthelial cells are taken up and Ags processed for "cross-presentation." Dendritic cells would then migrate to inflamed synovial tissues, possibly just because they contain organized secondary lymphoid aggregates indistinguishable from lymph nodes. These dendritic cells might be preferentially loaded with EBV peptides, since herpesvirus shedding in the oropharynx is increased in RA 53, 56, 57 .
3) T cell clones in RA synovial tissues may be cross-reactive with unidentified synovial Ags. It is well recognized that CTL specific for an EBV-encoded Ag can be cross-reactive with other Ags 67 . One example is the response of CD8 T cells to the immunodominant peptide of EBNA3A (FLRGRAYGL) presented by HLA-B*0801, which generates CTL using highly similar TCRs 68 that were also cross-reactive with an unknown endogenous peptide presented by HLA-B*4402 69 . A cross-reactive peptide derived from a joint-specific protein would be less likely to induce complete deletion of potentially autoreactive T cells, because there are many examples of peripheral autoantigens that do not delete specific T cells. In animal models, T cells with autoreactive potential can be induced to initiate autoimmunity, e.g., in the setting of viral infection 70 . Therefore, EBV-specific CD8 T cells may be infiltrating synovia in RA due to a cross-reaction with unidentified joint-specific self-Ags.
4) T cell clones expanded in RA joints may have preferentially homed to
the synovium independent of any antigen. For instance, very late
Ag-1 (
1ß1), which binds collagen
and laminin, is expressed by RA synovial T cells and by T cells
associated with respiratory mucosa 71 . Synovial T cells in RA also
express very late Ag-4 (
4ß1), which
mediates T cell adhesion to VCAM-1 (or to fibronectin) expressed by
synovial endothelial cells. Another integrin of interest is lymphocyte
Peyers patch adhesion molecule (LPAM-1)
(
4ß7). In patients with RA, 25% of
synovial fluid T cells express
4ß7
compared with only 7% of blood T cells 72 . This adhesion molecule
also binds to VCAM-1 but has additional specificity for the high
endothelial venules in Peyers patches and thus mediates homing to
gut-associated lymphoid tissue in mice 73 . Finally, the integrin
Eß7, specifically expressed on
gut-associated T lymphocytes, is increased in synovial T cells and the
ligand for
Eß7, E-cadherin, is abundantly
expressed in the synovium 74 . Therefore, there are apparent
similarities between the adhesion molecules expressed by T cells of the
gut/respiratory mucosa and synovial T cells.
In human RA, we speculate that synovial T cells could have been activated in the gut (or respiratory) mucosal tissue before finding their way to the synovium. It is well appreciated that intermittent productive EBV infection occurs in epithelial cells of the oropharyngeal mucosa. Perhaps productive EBV infection also occurs in epithelial cells at other levels of the gastrointestinal or respiratory tract. It is known that in Sjögrens syndrome, productive EBV infection occurs in the epithelial cells of the salivary glands 75 . Often, these patients also have arthritic symptoms similar to those of patients with RA. Perhaps EBV-specific T cells from the salivary glands home to synovia in Sjögrens syndrome, also.
There is an interesting precedent of RA-like disease in a transgenic mouse in which the apparent autoantigen is not joint specific, as described by Kouskoff et al. 76 . These mice have a transgenic TCR reactive with an autoantigen presented by MHC class II I-Ag7. The autoantigen is expressed in the thymus and in the spleen of these animals. The autoreactive T cells are omnipresent, including in the synovial fluid, but for some unknown reason the clinical manifestation of autoimmunity is an RA-like disease.
Because of the genetic linkage with HLA-DR4 alleles, many investigators favor a pathogenic role for CD4 T cells in RA, especially early in the disease. The abundance of clonal EBV-reactive CD8 T cells in RA, particularly in the synovial fluid compartment, is suggestive that these T cells may also play a role 2 . Perhaps they serve primarily to perpetuate long term chronic inflammation, long after the initial insult is cleared, rather than in initiation of the disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Drs. James W. Edinger or D. N. Posnett, Weill Medical College, Cornell University Weill, 1300 York Avenue, Box 56, New York, NY 10021. ![]()
3 Abbreviations used in this paper: RA, rheumatoid arthritis; GW, Gulf War syndrome; SLE, systemic lupus erythematosus; HHV, human herpesvirus; NT, PBL depleted of T cells by rosetting with SRBC; dNTP, deoxynucleotide triphosphate; CDR, complementarity-determining region. ![]()
Received for publication June 10, 1998. Accepted for publication December 11, 1998.
| References |
|---|
|
|
|---|
12.1 T cell expansions in the peripheral blood of rheumatoid arthritis patients. J. Exp. Med. 177:1623.
B. Mol. Cell. Biol. 14:1939.
gene by Epstein-Barr virus and activation of macrophages in Epstein-Barr virus-infected T cells in the pathogenesis of hemophagocytic syndrome. J. Clin. Invest. 100:1969.[Medline]
Eß7 and its ligand E-cadherin in the synovium of patients with rheumatoid arthritis. Scand. J. Immunol. 44:293.[Medline]
This article has been cited by other articles:
![]() |
R Goldbach-Mansky, S Suson, R Wesley, C E Hack, H S El-Gabalawy, and P P Tak Raised granzyme B levels are associated with erosions in patients with early rheumatoid factor positive rheumatoid arthritis Ann Rheum Dis, May 1, 2005; 64(5): 715 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Curran, O. M. FitzGerald, P. J. Costello, J. M. Selby, D. J. Kane, B. Bresnihan, and R. Winchester Nucleotide Sequencing of Psoriatic Arthritis Tissue before and during Methotrexate Administration Reveals a Complex Inflammatory T Cell Infiltrate with Very Few Clones Exhibiting Features That Suggest They Drive the Inflammatory Process by Recognizing Autoantigens J. Immunol., February 1, 2004; 172(3): 1935 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. I. Sakkas, G. Koussidis, E. Avgerinos, J. Gaughan, and C. D. Platsoucas Decreased Expression of the CD3{zeta} Chain in T Cells Infiltrating the Synovial Membrane of Patients with Osteoarthritis Clin. Vaccine Immunol., January 1, 2004; 11(1): 195 - 202. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Kang, X. Zhang, U. G. Wagner, H. Yang, R. D. Beckenbaugh, P. J. Kurtin, J. J. Goronzy, and C. M. Weyand CD8 T Cells Are Required for the Formation of Ectopic Germinal Centers in Rheumatoid Synovitis J. Exp. Med., May 20, 2002; 195(10): 1325 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takemura, P. A. Klimiuk, A. Braun, J. J. Goronzy, and C. M. Weyand T Cell Activation in Rheumatoid Synovium Is B Cell Dependent J. Immunol., October 15, 2001; 167(8): 4710 - 4718. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takei, T. Ishiwata, K. Mitamura, S. Fujiwara, K. Sasaki, T. Nishi, T. Kuga, T. Ookubo, T. Horie, J. Ryu, et al. Decreased expression of signaling lymphocytic-activation molecule-associated protein (SAP) transcripts in T cells from patients with rheumatoid arthritis Int. Immunol., April 1, 2001; 13(4): 559 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lim, L. Trautmann, M.-A. Peyrat, C. Couedel, F. Davodeau, F. Romagne, P. Kourilsky, and M. Bonneville Frequent Contribution of T Cell Clonotypes with Public TCR Features to the Chronic Response Against a Dominant EBV-Derived Epitope: Application to Direct Detection of Their Molecular Imprint on the Human Peripheral T Cell Repertoire J. Immunol., August 15, 2000; 165(4): 2001 - 2011. [Abstract] [Full Text] [PDF] |
||||
![]() |
W OLLIER Rheumatoid arthritis and Epstein-Barr virus: a case of living with the enemy? Ann Rheum Dis, July 1, 2000; 59(7): 497 - 499. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |