The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Edinger, J. W.
Right arrow Articles by Posnett, D. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Edinger, J. W.
Right arrow Articles by Posnett, D. N.
The Journal of Immunology, 1999, 162: 3694-3701.
Copyright © 1999 by The American Association of Immunologists

EBV Gene Expression Not Altered in Rheumatoid Synovia Despite the Presence of EBV Antigen-Specific T Cell Clones1

James W. Edinger2,*, Marc Bonneville{dagger}, Emmanuel Scotet{dagger}, Elisabeth Houssaint{ddagger}, H. Ralph Schumacher{ddagger} and David N. Posnett2,*

* Immunology Program, Graduate School of Medical Sciences, and Department of Medicine, Weill Medical College, Cornell University Weill, New York, NY 10021; {dagger} Institut National de la Santé et de la Recherche Médicale, Unit 463, Institut de Biologie, Nantes, France; and {ddagger} Veterans Affairs Medical Center, University of Pennsylvania, Philadelphia, PA 19104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T cells infiltrating the rheumatoid arthritis (RA) joint are oligoclonal, implicating an Ag-driven process, but the putative joint-specific Ags remain elusive. Here we examine expression of selected EBV genes in RA synovia and find no abnormal expression in RA. DNA of CMV and EBV was detectable by PCR in the synovial tissue of RA. RNA of several latent and lytic EBV genes was also detectable. However, there were no differences in EBV gene expression in synovial tissues or peripheral blood when comparing RA with osteoarthritis, Gulf War syndrome, and other disease controls. RA synovia with highly expanded CD8 T cell clones reactive with defined EBV peptide Ags presented by HLA class I alleles lacked evidence of abnormal mRNA expression for the relevant EBV Ag (BZLF1) or lacked amplifiable mRNA (BMLF1). Thus, local production of EBV Ags in synovial tissues may not be the cause of the accumulation of T cell clones specific for these Ags. Instead, APCs loaded with processed EBV peptides may migrate to the synovium. Alternatively, EBV-specific T cell clones may be generated in other tissues and then migrate to synovia, perhaps due to cross-reactive joint-specific Ags or because of expression of homing receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is likely that T cells play a role in the immunopathogenesis of rheumatoid arthritis (RA)3 1 . There is abundant evidence from TCR repertoire studies that T cells in the inflammatory joint of RA contain expanded clones indicative of an Ag-driven process 2, 3 . These observations apply to both CD4 and CD8 T cells and to T cells in synovial fluid or synovial biopsy tissues. There are two possible explanations for these findings. First, there may be expression of synovial Ags in RA resulting in local expansion of T cell clones. Second, there may be systemic activation of T cell clones due to expression of Ags in other tissue compartments. These activated T cells might then home to synovial tissues either because of cross-reactivity with joint tissue Ags or because of expression of the correct set of adhesion and homing molecules without a requirement for Ag expression in the joint. Most TCR repertoire studies describe joint-specific accumulation of T cell clones 2, 3 , but some reports describe T cell clonal expansions that are more prominent in the peripheral blood 4, 5, 6, 7, 8 , indicating perhaps that there are extrasynovial Ags driving T cell clonal expansions that do not migrate to synovial tissues.

In considering potential T cell Ags in RA, recent studies have revived an older literature on herpes viruses, in particular EBV 9 . These studies showed that in the joints of patients with RA, there were large numbers of CD8 T cells that were specific for EBV transactivator gene products, such as BZLF1 and BMLF1 10, 11 .

In Japanese patients infected with HTLV-1, a clinical disease indistinguishable from idiopathic RA has been described 12 . Exposure of synoviocytes to the tax protein (HTLV-1 transactivator) resulted in increased mRNA levels of cytokines, such as IL-1ß, IL-6, and TNF-{alpha} 13 . A mouse transgenic for the HTLV-1 tax gene developed RA-like disease 14 . These observations indicate that an intact virus may not be required to develop arthritis. Expression of a viral transactivator protein alone may suffice to induce inflammatory cytokines and an organ-specific autoimmune disease.

By analogy with the HTLV-1 tax model, we postulated that herpes viral transactivators might also play a role in synovial inflammation. The EBV transactivators, BZLF1 and BMLF1, are associated with lytic infection of B lymphocytes. Synovium is not known as a site of lytic EBV infection, but it is at least theoretically possible that transactivators are expressed during abortive viral replication, perhaps in unusual host cells such as synoviocytes 15 . Previous studies had addressed the presence of herpes viral DNA in RA synovia by PCR and were inconclusive 16, 17 . No studies have focused on transcription of herpes viral mRNAs in synovial tissues.

In this work, synovial tissues from patients with RA were examined for the presence of human herpesvirus (HHV) 4 (EBV), HHV5 (CMV), HHV6, HHV7, and HHV8) DNA by sensitive radioactive PCRs. EBV DNA was most prevalent. Synovial tissues were next examined for the presence of viral transcripts that encode potential T cell Ags. Samples of particular interest were from patients with documented synovial T cell clones specific for EBV Ags. We considered two possible outcomes. 1) EBV viral transcripts could be increased in RA compared with controls, indicating that viral Ags might be driving the expansion of synovial T cell clones specific for these Ags. 2) mRNA for the viral Ags might not be increased in RA or even absent, indicating that the corresponding synovial T cell clones were cross-reactive with unidentified self-Ags or that they homed to the synovium independent of synovial Ag expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The synovial tissue samples used were from four sources: Rheumatoid Arthritis Registry, The Hospital for Special Surgery (New York, NY); H. R. Schumacher, Rheumatology Clinic, Veterans Affairs Medical Center (Philadelphia, PA); A. Alam, Toulouse, France (frozen samples) (previously used; 18 ; and Nantes, France (frozen samples) (previously used; Refs. 10 and 11). All human samples were obtained in the context of studies approved by institutional review boards. Samples were either synovial tissues obtained at surgery and sometimes by blind needle biopsy or synovial fluids obtained by needle aspiration. RA patients fulfilled at least five of seven ACR criteria as proposed by Arnett et al. 19 , except for patient 11, who fulfilled four of seven of the criteria. The diagnosis of RA had been made 5–39 years before study. Patients with Gulf War syndrome (GW) complained of arthralgias and myalgias but had no arthritis on examination or by radiographic criteria. Other patients included a group with osteoarthritis (OA) and a single patient with systemic lupus erythematosus (SLE). Synovial tissue DNA samples from RA patients (see Fig. 1Go) were all from the Veterans Affairs Medical Center (Philadelphia, PA), as were RNA samples from GW patients. OA, SLE, normal controls, RA synovial tissue samples 5–26, and the sample from patient JCM (see Fig. 3Go) were from New York. RA samples P and C were from Toulouse, France. RA1, RA3, RA4, RA19, and RS2 were from Nantes, France. For the samples from Toulouse, T1 and T2 refer to different time points of sampling, while A and B refer to simultaneous samples from different joints. In some cases (6a, 6b, 6c, 20a, 20b, 27a, 27b, GW7a, GW7b, GW11a, GW11b, and GW11c), surgically obtained tissue was divided into 1-mm3 samples (designated a, b, or c) and assessed in parallel. Normal samples were either PBL (see Fig. 2Go), PBL depleted of T cells by rosetting with sheep red blood cells (NT), or NT treated with PHA (see Fig. 3Go).



View larger version (70K):
[in this window]
[in a new window]
 
FIGURE 1. DNA PCR results for herpes viruses HHV4 (EBV), HHV5 (CMV), HHV6, HHV7, and HHV8 (Kaposi’s sarcoma-associated virus). Specific bands of the correct size were observed for EBV and CMV. The band observed in sample 7 with the HHV8 PCR migrated more slowly than the controls and was considered a contaminant band.

 


View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 3. PBL and synovial tissue samples from RA and controls, tested by RT-PCR for EBV gene transcription. The indicated RT-PCR reactions were conducted with RNA from control samples; titered B lymphoblastoid BSKS2- cells (cell equivalents indicated); normal PBL (see Fig. 2Go), non-T cells in normal PBL (nt), or PHA-treated non-T cells from normal PBL (pha); PBL from a patient with systemic lupus erythematosus (SLE) or from patients with GW; and synovial tissues (st) from disease controls with GW syndrome or with OA. The controls were compared with synovial tissues (st), synovial fluid (sf), or PBL from RA patients. Patients 6 (a through c) and 7 had juvenile RA (JRA). An additional control was RNA from PBL of patient JCM with (+rt) or without (-rt) RT added during cDNA synthesis. Samples from patients P and C (18) and patients RA1 and RA19 (10) have been used in previous publications. Arrowheads indicate that T cells specific for the EBV Ag were present in the same tissue samples (see Table IGo). Asterisks denote samples of cDNA that were diluted 1/10 before analysis by PCR. All PCRs were repeated three times, and results were generally reproducible within the limits shown in Fig. 2Go.

 


View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2. Reproducibility of RT-PCR for EBER1. In two sequential RT-PCRs (numbers 1 and 2), RNA samples from normal PBL (NL1–6), RA PBL, and RA synovial tissue (st) were analyzed and compared with RNA from the indicated cell number equivalents of an EBV-transformed cell line (BSKS2-). The experimental samples contained on average 105–106 cell equivalents per PCR. H2O indicates negative controls with water instead of cDNA template. -RT indicates that RT was not included during synthesis of cDNA. The dilutions of the RA samples refer to dilutions of cDNA used for the PCR.

 
Viral infections to obtain PCR control cDNAs

For infections with HHV6 (strain U1102) and HHV7 (strain JI), which infect T lymphocytes, PBL (5 x 106) from cord blood were placed in culture (RPMI 1640, 10% FCS, 0.2 U/ml penicillin, 0.2 mg/ml streptomycin, 2 mg/ml fungizone, and 2 mM L-glutamine) with PHA (50 µg/ml) for 3 days. The activated PBL were infected with a multiplicity of infection ~1 with each virus in the presence of Polybrene (2 µg/ml) for 2 h. The cells were washed three times and cultured for 3 wk with the addition of IL-2 (40 IU/ml) every 3–4 days. The cells were harvested in aliquots of 2 x 106 cells each, and genomic DNA was prepared as described. As a source of EBV, a transformed B cell line, BSKS2- (courtesy of E. Cesarman, Weill Medical College, Cornell University), was used. For CMV, MRC5 fibroblasts were infected at multiplicity of infection ~1 20 and harvested after 7 days. For HHV8, which infects B cells 21 , a transformed B cell line, BSKS2+ (courtesy of E. Cesarman, Weill Medical College, Cornell University), containing both EBV and HHV8 was used.

Preparation of DNA and cDNA

Genomic DNA was obtained from samples (~106 PBL or ~0.1 mg of synovial tissue) by lysis in 50 µl of 10 mM Tris-HCl, 1 mM EDTA, 0.001% Triton X-100, 0.0001% SDS, and 600 µg/ml proteinase K, pH 8.0, for 1 h at 56°C, followed by 95°C for 15 min. RNA was isolated from samples (~106 PBL or ~0.1 mg of synovial tissue) using Ultraspec RNA (Biotecx Laboratories, Houston, TX) according to the manufacturer’s instructions. cDNA synthesis was performed with 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2; 5 µg RT6 primer (Promega, Madison, WI), 0.3 U/ml RNase inhibitor (Promega); 5 U of Moloney murine leukemia virus RT (Life Technologies, Grand Island, NY), and 0.5 mM deoxynucleotide triphosphates (dNTPs; Pharmacia, Piscataway, NJ) for 1 h at 42°C, followed by 1 min at 95°C.

Genomic PCR and RT-PCR

The genomic PCRs were performed using the following primers (5' to 3') and optimal conditions. In each case, the quantity of primers was 10–100 pmol/reaction.

Primers for EBV (strain B95-8) were the following: sense, AACATGCTGTATGCCTCGCAGCG (124,935–124,957), and antisense, AATTACTGGCGTGAATTGTGCCCA (125,109–125,086). Conditions were as follows: 3 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 58°C for 90 s, and 72°C for 1 min; the product was 175 bp 22 .

Primers for CMV (IE1 gene of strain AD169) were the following: sense, TTCTATGCCGCACCATGTCC (exon 4), and antisense, TGGAGTCCTCTGCCAAGAGA (exon 2). Conditions were as follows: 2.25 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 60°C for 90 s, and 72°C for 2 min; the product was 581 bp 23 .

Primers for HHV6 (strain U1102) were the following: sense, AAGCTTGCACAATGCCAAAAAACAG (17,627–17,603), and antisense, CTCGAGTATGCCGAGACCCCTAATC (17,405–17,429). Conditions were as follows: 2 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 65°C for 1 min, and 72°C for 2 min; the product was 223 bp 22 .

Primers for HHV7 (strain JI, primers derived from clone 43L3, 171 nucleotides) were the following: sense, CAGAAATGATAGACAGATGTTGG 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 , and antisense, TAGATTTTTTGAAAAAGATTTAATAAC (171–154). Conditions were as follows: 1.5 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 55°C for 2 min; the product was 123 bp 24 .

Primers for HHV8 (region homologous to EBV BDLF1 and herpesvirus saimiri ORF26) were the following: sense, AGCCGAAAGGATTCCACCAT (987–1006), and antisense, CTGGACGTAGACAACACGGA (1200–1219). Conditions were as follows: 1.5 mM MgCl2; 35 PCR cycles at 94°C for 1 min, 64°C for 1 min, and 72°C for 90 s; the product was 233 bp 25 .

For the RT-PCRs, the following protocols were used, and the genomic coordinates of each primer are given in parentheses. For the EBNA1 Y3 spliced transcript (265-bp PCR product), the sense primer was 5'-GGCGTGTGTGACGTGGTGTAA (48,397–48,416); for the Q spliced transcript (238-bp PCR product), the sense primer was 5'-GTGCGCTACCGGATGGCG (62,440–62,457); in both cases, the antisense primer was 5'-CATTTCCAGGTCCTGTACCT (107,986–107,967) 26 .

For the BZLF1 spliced transcript (182-bp PCR product), the sense primer was 5'-TTCCACAGCCTGCACCAGTG (102,719–102,700), the antisense primer was 5'-GGCAGCAGCCACCTCACGGT (102,330–102,341/102,424–102,433), and the probe was 5'-CTTAAACTTGGCCCGGCATT 27 .

For the EBER1 unspliced transcript (167-bp PCR product), the sense primer was 5'-AAAACATGCGGACCACCAGC (6776–6795), and the antisense primer was 5'-AGGACCTACGCTGCCCTAGA (6648–6629) 27 .

The reaction conditions for each of the above RT-PCRs were as follows: 40 cycles of 94°C for 30 s, 60°C for 60 s, and 72°C for 1 min; 1.7 mM MgCl2; and 0.2 mM dNTPs containing [{alpha}-32P]dCTP (1 x 105 cpm per reaction, Amersham, Arlington Heights, IL).

For the BMLF1 unspliced transcript (172-bp PCR product), the sense primer was 5'-TAGTCTCGCGTGTTAGGAAGG (83,098–83,118), and the antisense primer was 5'-TGGCCATGCTAGAAGAGACC (83,250–83,269). Conditions were 35 PCR cycles at 94°C for 1 min, 59°C for 1 min, and 72°C for 1 min; 4 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.

For the BALF2 unspliced transcript (203-bp PCR product), the sense primer was 5'-CGGCAACAACCAGATATTCC (161,999–161,980), and the antisense primer was 5'-CAATCTCATATGTGGTCGCG (161,816–161,797). Conditions were 36 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 2 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.

For the BHRF1 unspliced transcript (239-bp PCR product), the sense primer was 5'-TGGCCTATTCAACAAGGGAG (54,377–54,396), and the antisense primer was 5'-ATCCACATGTTCGGTGTGTG (54,596–54,615). Conditions were 36 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 1.5 mM MgCl2; and 10 pmol of each primer, with radioactive dCTP.

For the actin unspliced transcript with primers in exon 4 (281-bp PCR product), the sense primer was 5'-CCTCATGAAGATCCTCACCG, and the antisense primer was 5'-AAGGAAGGCTGGAAGAGTGC. Conditions were 30 PCR cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 1.5 mM MgCl2; 12.5 pmol of each primer; 0.1 mM dNTP; and radioactive dCTP.

For the CD19 spliced transcript (170-bp PCR product), the sense primer was 5'-TCAACGTCTCTCAACAGATGG (exon 1), and the antisense primer was 5'-TGAGGACCTGTTCTTCAGGC (exon 2). Conditions were 30 PCR cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min; 3.0 mM MgCl2; 10 pmol of each primer; 0.5 mM dNTP; and radioactive dCTP.

All samples from patients were analyzed by the radioactive PCR described above, and the products were resolved on an 8% polyacrylamide gel for ~2 h at a constant voltage of 120 V. Each radioactive gel was exposed to x-ray film (Biomax, Kodak, Rochester, NY) for variable times, up to a 1-wk exposure. In the case of the BZLF1, PCR products were resolved on a 1.5% agarose gel and transferred to a nylon membrane (Hybond-N, Amersham) for standard Southern blotting. A recent modification was used that accounts for the properties of a short oligonucleotide probe 28 . The probe was end labeled by polynucleotide kinase (Boehringer-Mannheim, Indianapolis, IN) and [{gamma}-32P]ATP (Amersham) using the manufacturer’s protocol. The labeled probe had a specific activity of ~107 cpm/mmol.

CD8 T cell lines for testing reactivity with transfected EBV genes

Synovial lymphocytes were sorted by immunomagnetic sorting using an anti-CD8-specific MAb and CD8+ cells expanded in vitro with IL-2, as described elsewhere 29 . Cell lines were maintained in RPMI 1640 supplemented with 10% human serum, 1 mM L-glutamine, and rIL-2 (150 IU/ml). At least 98% of the cells were CD8+ by flow cytometry in all of the cell lines studied. These T cell lines were used to screen for reactivity against a panel of transfected COS cells. The COS cells were transfected with a combination of an HLA class I allele and an EBV gene as detailed below.

Expression vectors

Expression vectors encoding six lytic EBV proteins (BZLF1, BMLF1, BRLF1, BCRF1, BMRF1, and BHRF1) and all of the latent EBV proteins (EBNA1, -2, -3a, -3b, -3c, LP, LMP1, and LMP2) were used to transfect COS cells as described elsewhere 29 . BMLF1 and BZLF1 cDNAs, cloned into pcDNA3 (Invitrogen, Leek, The Netherlands), were derived from a cDNA library prepared from B lymphoblastoid cells from patient RA1 11 . We also used expression vectors containing DNA or cDNA encoding various HLA class I alleles 29 .

COS transfections and T cell stimulation assay

Transfection into COS cells was performed by the DEAE dextran chloroquine method 30 . In brief, COS cells were cotransfected with an expression vector coding for an EBV protein and an expression vector coding for one of the HLA alleles. Transfected COS cells were tested 48 h after transfection in a CTL stimulation assay. Varying numbers of responder T cells (103, 104, and 105 per well) were added to transfected COS cells, and culture supernatants were tested 6 h later for TNF production by a sensitive bioassay 29, 31 .


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In view of prior reports on both EBV and CMV in RA synovial tissues, initial studies were performed to screen DNA from 11 RA synovial tissue biopsies for viral sequences using sensitive DNA PCRs. Data on HHV6, HHV7, and HHV8 DNA in RA synovial tissues have not yet been reported. As shown in Fig. 1Go, specific bands were not observed with primers for HHV6, HHV7, and HHV8. Thus, these viruses are not present in RA synovia at the detection limits of the PCR assays used. However, 10 of 11 samples contained EBV DNA, and in most samples weak bands corresponding to CMV DNA were also observed. Because of the prominence and frequency of the EBV PCR bands, we next examined transcriptional activity of selected EBV genes.

RT-PCR for EBER1 was the most sensitive assay used. EBER RNAs are small, nonpolyadenylated viral RNAs that are by far the most abundant RNAs in latently infected cells 32 . Fig. 2Go demonstrates the degree of reproducibility between two experiments with this PCR showing the same patterns of band intensities. Samples from normal PBL (NL1–6), RA PBL, and RA synovial tissue were analyzed. The results were compared with RT-PCR using cDNA from the indicated cell number equivalents of an EBV-transformed cell line. The experimental samples, both PBL and synovial tissue, which contained on average 105–106 cell equivalents per PCR reaction, yielded bands in the intensity range below 1 EBV-transformed cell. This indicates that cells transcribing EBER1 are rare and is consistent with estimates of a low frequency of EBV-infected B cells in latently infected individuals, ~10-5–10-6 33 . Fig. 2Go further demonstrates the sensitivity of the assay. By analyzing 10-fold dilutions of the cDNA templates, it was shown that most samples contained EBER1 RNA at 1–2 logs above the detection limits of the assay.

A series of similar RT-PCR experiments were next performed to assess transcription of several EBV genes: the immediate early transactivator, BZLF1, and the early transactivator, BMLF1 32 , as well as the latency-associated EBER1, EBNA1 Q, and EBNA1 Y3 (Fig. 3Go and data not shown). Each sample analyzed was also tested for the presence of mRNA of a constitutive cellular housekeeping gene (actin). In addition, the samples were tested for the presence of CD19 mRNA as an internal control for the presence of B cells in the tissue sample. CD19 was chosen because of the consistent expression of mRNA throughout differentiation of the B cell lineage 34 . Each experiment included the same set of controls: dilutions of template cDNA ranging from 1 to 1000 cell equivalents, a water control, and a control without RT. Exposures of autoradiograms were varied such that the positive control serial dilutions gave approximately the same intensities (see Fig. 2Go) in each experiment. Fig. 3Go is a composite of these experiments. It should be emphasized that these PCRs were designed for optimal sensitivity, but not for quantitation, since they were run to saturation.

Fig. 3Go shows that synovial samples from RA patients did not differ from those of disease controls, which included synovial tissues from OA and GW patients. All samples appeared negative for BMLF1 transcripts, while most samples were positive for BZLF1 and EBER1. However, it is important to recall that EBER1 is expressed at multiple copies per cell; thus, this PCR assay is much more sensitive. In addition, repeat analyses of the BMLF1 PCR showed that weak bands were detectable in ex vivo tissues in only one of six experiments despite consistently intense bands for the positive controls, as shown in Fig. 3Go. Thus, BMLF1 mRNA levels were just below the limits of detection of this assay. At any rate, all experiments showed no apparent difference between RA and control groups. Comparisons between PBL samples from normal and disease controls and RA patients also showed no differences.

A consistent finding was the variable presence of CD19 mRNA in all of the synovial tissue samples. Separate samples dissected from the same surgical tissue (i.e., samples 20a and 20b) yielded variable intensities of the RT-PCR CD19 bands. This is consistent with previous findings on the focal nature of B cell infiltrates in the synovium 35 . In some cases, a heavy CD19 band appeared to correlate with up-regulation of EBER1 message, as in samples of normal NT PBL cells stimulated with PHA and in a patient with SLE. However, in most synovial tissue samples there was little correlation between the presence of CD19 and EBV gene expression. Some samples contained EBV transcripts but no detectable CD19. There were two possible explanations. The CD19 RT-PCR may have been less sensitive than the EBV PCRs. Alternatively, viral transcripts may have derived from cell types other than B lymphocytes.

Fig. 3Go contains two sets of RA samples analyzed in detail in previous studies. First, samples from patients P and C had been shown to contain well-characterized clonal T cell expansions 18 . These samples were no different from other RA samples in the expression of EBV genes (Fig. 3Go). Second, patients RA19 and RA1 had previously been shown to contain CD8 clonal expansions in synovial fluid. These clones were then found to recognize antigenic peptides derived from the EBV transactivator proteins BZLF1 and BMLF1 10, 11 . Patient RA3 also had CD8 T cells derived from the synovial fluid that reacted with BMLF1 and BZLF1 (Table IGo). Samples from these three patients (Fig. 3Go, arrowheads) gave RT-PCR bands that were similar to those of all other patients and controls. Thus, in RA joints with well-documented infiltration by CD8 T cell clones specific for BMLF1 and BZLF1, either mRNA for the same viral Ags was not detectable (BMLF1) or there was no difference in expression compared with disease control samples (BZLF1).


View this table:
[in this window]
[in a new window]
 
Table I. Summary of synovial EBV responses1

 
A striking finding was the presence of detectable BZLF1 transcripts in 47 of 56 samples, while BMLF1 was below the detection limit in all samples (Fig. 3Go), even though titrations of positive controls indicated that the BMLF1 PCR was the more sensitive PCR. The primer pairs selected for BZLF1 straddle two introns between exons 1 and 3 27 . A detectable 182-bp PCR product is dependent on a correctly spliced BZLF1, including exon 2, which encodes the DNA binding domain of BZLF1 36 , and which is detected by the primer probe in a Southern blot of the PCR product (see Materials and Methods). A PCR artifact is therefore unlikely. The BZLF1 transcript was originally reported to be undetectable in PBL of normal donors 27 , but a more sensitive PCR protocol detected transcripts in 72% of normal PBL 37 . BZLF1 is thought to be the key transcriptional regulator that triggers lytic EBV infection by transactivating early genes that share BZLF1 response elements in their promoters, including BMLF1 38, 39 . The presence of low levels of BZLF1 transcripts without BMLF1 is compatible with an aborted lytic infection. Indeed, it has been suggested that critical concentrations of BZLF1 protein are required for target gene transcription 40, 41 . Moreover, the BZLF1 protein may be inactivated by serine phosphorylation 42 and by interactions with both viral and cellular proteins such as p53 and the p65 subunit of NF-{kappa}B 43, 44, 45, 46 , which could explain the presence of BZLF1 message in the absence of overt lytic EBV infection in normal PBL 33, 47 .

Because BMLF1 mRNA levels were barely detectable, we selected two EBV genes that are usually prominently expressed during lytic infection: BALF2 and BHRF1 32 . There was no transcription of BHRF1 and only rare, low levels of BALF2 in both RA and control samples (Fig. 4Go). These results lend further support to the idea that lytic infection is abortive in these ex vivo tissues.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of the EBV lytic genes BALF2 and BHRF1 in selected control and RA samples. The BALF2 PCR yields a 203-bp product, and the BHRF1 PCR a 239-bp product. Titered B lymphoblastoid BSKS2- cells (cell equivalents indicated) demonstrate the sensitivity of the PCRs. Right lanes contain the alternative PCR products as size markers: the 239-bp BHRF1 product (top) and the 203-bp BALF2 product (bottom).

 
PCRs for EBER1 (Fig. 3Go), EBNA1 Y3, and EBNA1 Q transcripts (not shown) also failed to demonstrate any differences between RA and control samples. EBNA1 Q transcripts were faintly detectable in 5 of 14 and EBNA1 Y3 in 6 of 14 samples. Thus, by the most sensitive of RT-PCRs, we found no evidence of RA-specific EBV gene transcription in synovial samples.

To assess how commonly EBV-specific T cell responses are found in synovial samples from RA patients, CD8 T cell lines were generated from four RA patients and one Reiter’s syndrome patient (RS2). The cell lines were then tested against cotransfectants expressing an HLA class I allele of the patient and one of several candidate EBV proteins 29 . Reactivity was scored in a sensitive assay by measuring TNF-{alpha} release. A summary of these data is given in Table IGo. The results show that patient RA1, e.g., had synovial T cells recognizing seven different EBV proteins. In the case of BZLF1, three different HLA class I-presenting alleles (A*02, B*61, and Cw*01) could be used, indicating that there were probably several different BZLF1 peptides recognized. In each patient, CD8 T cells reactive with at least two EBV proteins were detected. BZLF1 and EBNA3A were the most commonly recognized Ags. The Ags included both EBV lytic proteins and latent proteins.

Concerning CD8 T cells reactive with EBV Ags, patients with Reiter’s syndrome (such as RS2), psoriatic arthritis, and ankylosing spondylitis gave results similar to those of RA patients (Table IGo and 29 . Therefore, it is unlikely that EBV-specific CD8 T cells in synovial tissues are unique to RA. In each of the five cases represented in Table IGo, different RT-PCRs failed to show evidence of overexpressed EBV transcripts in synovial tissues, despite the presence of the EBV Ag recognizing T cells (Fig. 3Go and Table IGo). Thus, the presence of these CD8 T cells in synovial tissues of various patients with arthritis is not due to the production of viral Ags in the synovium.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In addressing the role of EBV in RA, we first showed that EBV DNA can be detected in RA synovial tissues. Compared with other nonneurotropic herpes viruses, EBV and CMV DNA were most readily and frequently detected. However, no differences were observed for mRNA transcripts of seven different EBV genes in RA vs control synovial tissues. Even in well-characterized samples known to contain expanded CD8 T cell clones with specificity for EBV gene products, such as BZLF1 and BMLF1, either the corresponding mRNA for the viral protein Ag was scarce or the bands were comparable in RA patients and disease controls, e.g., patients with OA or GW.

There is a long history of studies on the role of EBV in RA. The original excitement about EBV was due to the description, in sera from RA and Sjögren’s syndrome patients, of Abs that were reactive with EBV-transformed B cell lines 48 . Later studies gave conflicting results in support of a role of EBV in RA pathogenesis 49, 50 , but it is still thought that RA patients have higher numbers of EBV-infected B cells than controls. Most normal adults have a controlled, latent infection by EBV. The estimate for the frequency of EBV-infected cells among total B cells during latent infection is 10-5 to 10-6, and in acute infectious mononucleosis it may be as high as 10-1 33 . Compared with latently infected controls, RA patients may have higher titers of Abs against EBV Ags 51 , and at least a 10-fold higher frequency of EBV-infected B cells in the peripheral blood 52, 53 . IgG anti-viral capsid Ag titers to EBV were reported to correlate with high titers of IgM RF in RA 54 . Serum Abs to lytic-phase proteins BMRF1 and BHRF1 were also described in some patients 55 .

Lytic-phase EBV proteins are expressed by productively infected cells. Indeed, RA patients may have higher levels of EBV and HHV6 shedding in the oropharynx 53, 56, 57 . Whether the greater degree of productive EBV infection in RA extends to other tissues is still an unsettled question. In the joint, the most obvious source of EBV is B lymphocytes resident in the synovium. However, it is not yet clear that EBV+ B cells are enriched in the synovium or that they are productively, rather than latently, infected.

Other synovial cell types might also be infected with EBV. Koide et al. have recently established an RA synovium-derived fibroblastoid cell line (with features of the synoviocyte type I), which expresses the latency genes EBNA1, EBNA2, and LMP1 and also expresses early Ag and viral capsid Ag in a small percentage of cells 15 . However, it is not yet clear whether fresh ex vivo synoviocytes are infected with EBV. EBV can also infect endothelial cells in vitro 58 , follicular dendritic cell lines in vitro 59 , T cells in hemophagocytic syndrome 60 , and smooth muscle tumor cells in immunosuppressed hosts in vivo 61, 62 . These cell types are clearly present in inflamed synovial tissue. Samples from the GW patients contained very little CD19 mRNA, and yet EBV transcripts were demonstrated in both the GW and in the RA patients. This result might mean that cells other than B cells are transcribing EBV genes in these samples.

With all of the prior suggestive results, it is perhaps conspicuous that PCR studies measuring genomic DNA of EBV within synovial tissues, or in blood, have been quite inconclusive. For example, the percentage of positive samples for EBV DNA in RA synovial fluids was 19%, vs 33% for reactive arthritis 16 . The percentage of samples containing detectable EBV genomic DNA in the peripheral blood was similar among several patient groups: RA (39%), reactive arthritis (39%), other arthropathies (27%), and normal controls (31%). In one study, EBV DNA was found in synovial tissue of 23% of RA patients and in no OA synovial tissues as measured by in situ hybridization 17 , but yet another study using the same technique with BHLF1 and EBER probes failed to detect EBV DNA in RA synovial tissue 63 .

By analyzing RNA for EBV genes by RT-PCR, our data extend previous work on the presence of EBV genes. The results, however, provided no evidence for EBV Ag expression in joint tissues that was any different in RA vs controls or in joint vs blood. The most striking finding was that joints, heavily infiltrated with EBV-specific CD8 T cells, lacked evidence of abnormal expression of the relevant EBV Ag. For instance, in fresh ex vivo synovial fluid of patient RA1, Vß2 CD8 T cells were expanded to 15%, vs 6.9% in the PBL 10 . The majority of these cells expressed a TCR Vß2 with a CDRIII region of eight amino acids in length with predominant usage of a Jß1.2 segment. Among these cells, the most common TCRß CDRIII sequence was RDRIGNGY, representing an estimated 22% of the Vß2 CD8 cells or 3.3% of all CD8 cells. A CD8 T cell clone derived in vitro from the synovial fluid T cells (A2.10) and expressing the same TCRß-chain 10 was then used to clone the Ag recognized by this TCR 11 . This was a 9-mer peptide of BMLF1 (GLCTLVAML) presented by HLA-A*0201. Yet, the data in Fig. 3Go of this paper clearly show that BMLF1 mRNA was below the limits of detection in the same synovial tissue from patient RA1. The same arguments can be made for BMLF1-specific T cells in RA3 and BZLF1-specific T cells in RA1, RA19, and RA3 (Table IGo), in that the T cells appear to be enriched in the synovium in the absence of abnormal expression of these EBV genes.

The lack of detectable EBV lytic-phase Ag expression could simply be due to efficient removal of the productively infected cells by cytotoxic T cells. However, patients RA1 and RA3 had increased synovial CD8 T cells specific for BZLF1 (Table IGo), and these T cells were apparently unable to remove all of the cells producing BZLF1, since this transcript was detectable in the same synovial samples (Fig. 3Go, arrowheads). Moreover, productively infected cells in the oropharynx can generate viral transcripts and proteins despite the presence of specific CTL. Thus, we do not favor this possibility.

Overall, the results suggest several possibilities, as detailed below.

1) Expression of EBV viral Ags may not be quantitatively increased as assessed by RT-PCR, but instead there may be qualitative changes. For instance, viral proteins may be differently processed in the setting of synovial inflammation. Perhaps the APCs are unusual, i.e., dendritic cells, endothelial cells, or infected synoviocytes 15, 58, 59 , rather than EBV-infected B cells. Perhaps protein/protein interactions, such as those reported with BZLF1 43, 44, 45, 46 , influence Ag processing. In this way, Ag processing was altered when tetanus toxoid was bound to specific Ab 64 or when CD4 was bound to HIV-1 gp120 65 . This can lead to presentation of cryptic neoepitopes, a possible source of autoimmunity 66 .

2) An alternative possibility, which does not require qualitative changes in Ag presentation in the synovium, is that dendritic cells take up EBV Ag at a distant site. This might be a mucosal epithelium at which productively EBV-infected epthelial cells are taken up and Ags processed for "cross-presentation." Dendritic cells would then migrate to inflamed synovial tissues, possibly just because they contain organized secondary lymphoid aggregates indistinguishable from lymph nodes. These dendritic cells might be preferentially loaded with EBV peptides, since herpesvirus shedding in the oropharynx is increased in RA 53, 56, 57 .

3) T cell clones in RA synovial tissues may be cross-reactive with unidentified synovial Ags. It is well recognized that CTL specific for an EBV-encoded Ag can be cross-reactive with other Ags 67 . One example is the response of CD8 T cells to the immunodominant peptide of EBNA3A (FLRGRAYGL) presented by HLA-B*0801, which generates CTL using highly similar TCRs 68 that were also cross-reactive with an unknown endogenous peptide presented by HLA-B*4402 69 . A cross-reactive peptide derived from a joint-specific protein would be less likely to induce complete deletion of potentially autoreactive T cells, because there are many examples of peripheral autoantigens that do not delete specific T cells. In animal models, T cells with autoreactive potential can be induced to initiate autoimmunity, e.g., in the setting of viral infection 70 . Therefore, EBV-specific CD8 T cells may be infiltrating synovia in RA due to a cross-reaction with unidentified joint-specific self-Ags.

4) T cell clones expanded in RA joints may have preferentially homed to the synovium independent of any antigen. For instance, very late Ag-1 ({alpha}1ß1), which binds collagen and laminin, is expressed by RA synovial T cells and by T cells associated with respiratory mucosa 71 . Synovial T cells in RA also express very late Ag-4 ({alpha}4ß1), which mediates T cell adhesion to VCAM-1 (or to fibronectin) expressed by synovial endothelial cells. Another integrin of interest is lymphocyte Peyers patch adhesion molecule (LPAM-1) ({alpha}4ß7). In patients with RA, 25% of synovial fluid T cells express {alpha}4ß7 compared with only 7% of blood T cells 72 . This adhesion molecule also binds to VCAM-1 but has additional specificity for the high endothelial venules in Peyer’s patches and thus mediates homing to gut-associated lymphoid tissue in mice 73 . Finally, the integrin {alpha}Eß7, specifically expressed on gut-associated T lymphocytes, is increased in synovial T cells and the ligand for {alpha}Eß7, E-cadherin, is abundantly expressed in the synovium 74 . Therefore, there are apparent similarities between the adhesion molecules expressed by T cells of the gut/respiratory mucosa and synovial T cells.

In human RA, we speculate that synovial T cells could have been activated in the gut (or respiratory) mucosal tissue before finding their way to the synovium. It is well appreciated that intermittent productive EBV infection occurs in epithelial cells of the oropharyngeal mucosa. Perhaps productive EBV infection also occurs in epithelial cells at other levels of the gastrointestinal or respiratory tract. It is known that in Sjögren’s syndrome, productive EBV infection occurs in the epithelial cells of the salivary glands 75 . Often, these patients also have arthritic symptoms similar to those of patients with RA. Perhaps EBV-specific T cells from the salivary glands home to synovia in Sjögren’s syndrome, also.

There is an interesting precedent of RA-like disease in a transgenic mouse in which the apparent autoantigen is not joint specific, as described by Kouskoff et al. 76 . These mice have a transgenic TCR reactive with an autoantigen presented by MHC class II I-Ag7. The autoantigen is expressed in the thymus and in the spleen of these animals. The autoreactive T cells are omnipresent, including in the synovial fluid, but for some unknown reason the clinical manifestation of autoimmunity is an RA-like disease.

Because of the genetic linkage with HLA-DR4 alleles, many investigators favor a pathogenic role for CD4 T cells in RA, especially early in the disease. The abundance of clonal EBV-reactive CD8 T cells in RA, particularly in the synovial fluid compartment, is suggestive that these T cells may also play a role 2 . Perhaps they serve primarily to perpetuate long term chronic inflammation, long after the initial insult is cleared, rather than in initiation of the disease.


    Acknowledgments
 
We thank Drs. M. Crow and A. Asch for critical reading of the manuscript and Dr. Antione Alam for providing RA patient samples.


    Footnotes
 
1 This work was supported in part by U.S. Public Health Service Grants RO-1 AI22333 and RO-131140 (to D.N.P.), a grant from the Association pour la Recherche sur la Polyarthrite (to M.B.), and institutional grants from the Institut National de la Santé et de la Recherche Médicale. Back

2 Address correspondence and reprint requests to Drs. James W. Edinger or D. N. Posnett, Weill Medical College, Cornell University Weill, 1300 York Avenue, Box 56, New York, NY 10021. Back

3 Abbreviations used in this paper: RA, rheumatoid arthritis; GW, Gulf War syndrome; SLE, systemic lupus erythematosus; HHV, human herpesvirus; NT, PBL depleted of T cells by rosetting with SRBC; dNTP, deoxynucleotide triphosphate; CDR, complementarity-determining region. Back

Received for publication June 10, 1998. Accepted for publication December 11, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fox, D. A.. 1997. The role of T cells in the immunopathogenesis of rheumatoid arthritis: new perspectives. Arthritis Rheum. 40:598.[Medline]
  2. Edinger, J. W., and D. N. Posnett. 1999. T cell antigen receptor repertoire in rheumatoid arthritis. In Pathogenic Autoimmune Reactions. S. Paul, ed. The Humana Press Inc., Totowa, NJ. p. 113.
  3. Struyk, L., G. E. Hawes, M. K. Chatila, F. C. Breedveld, J. T. Kurnick, P. J. van den Elsen. 1995. T cell receptors in rheumatoid arthritis. Arthritis Rheum. 38:577.[Medline]
  4. DerSimonian, H., M. Sugita, D. N. Glass, A. L. Maier, M. E. Weinblatt, T. Reme, M. B. Brenner. 1993. Clonal V{alpha}12.1 T cell expansions in the peripheral blood of rheumatoid arthritis patients. J. Exp. Med. 177:1623.[Abstract/Free Full Text]
  5. Goronzy, J. J., P. Bartz-Bazzanella, W. Hu, M. C. Jendro, D. R. Walser-Kuntz, C. M. Weyand. 1994. Dominant clonotypes in the repertoire of peripheral CD4+ T cells in rheumatoid arthritis. J. Clin. Invest. 94:2068.
  6. Fitzgerald, J. E., N. S. Ricalton, A. C. Meyer, S. G. West, H. Kaplan, C. Behrendt, B. L. Kotzin. 1995. Analysis of clonal CD8+ T cell expansions in normal individuals and patients with rheumatoid arthritis. J. Immunol. 154:3538.[Abstract]
  7. Monteiro, J., R. Hingorani, I. H. Choi, R. Pergolizzi, J. Silver, P. K. Gregersen. 1995. Variability in CD8+ T-cell oligoclonality patterns in monozygotic twins. Ann. NY Acad. Sci. 756:96.[Medline]
  8. Gonzalez-Quintial, R., R. Baccala, R. M. Pope, A. N. Theofilopoulos. 1996. Identification of clonally expanded T cells in rheumatoid arthritis using a sequence enrichment nuclease assay. J. Clin. Invest. 97:1335.[Medline]
  9. Posnett, D. N., J. Edinger. 1997. When do microbes stimulate rheumatoid factor? [Commentary]. J. Exp. Med. 185:1721.[Free Full Text]
  10. David-Ameline, J., A. Lim, F. Davodeau, M. A. Peyrat, J. M. Berthelot, G. Semama, C. Pannetier, J. Gaschet, H. Yie, J. Even, M. Bonneville. 1996. Selection of T cells reactive against autologous B lymphoblastoid cells during chronic rheumatoid arthritis. J. Immunol. 157:4697.[Abstract]
  11. Scotet, E., J. David-Ameline, M-A. Peyrat, A. Moreau-Aubry, D. Pinczon, A. Lim, J. Even, G. Semana, J-M. Berthelot, R. Reathnach, M. Bonneville, E. Houssaint. 1996. T cell response to Epstein-Barr virus transactivators in chronic rheumatoid arthritis. J. Exp. Med. 184:1791.[Abstract/Free Full Text]
  12. Hasunuma, T., T. Sumida, and K. Nishioka. 1999. Human T cell leukemia virus type-1 and rheumatoid arthritis. Int. Rev. Immunol. In press.
  13. Nakajima, T., H. Aono, T. Hasunuma, K. Yamamoto, I. Maruyama, T. Nosaka, M. Hatanaka, K. Nishioka. 1993. Overgrowth of human synovial cells driven by the human T cell leukemia virus type I tax gene. J. Clin. Invest. 92:186.
  14. Iwakura, Y., M. Tosu, E. Yoshida, M. Takiguchi, K. Sato, I. Kitajima, K. Nishioka, K. Yamamoto, T. Takeda, M. Hatanaka, H. Yamamoto, T. Sekiguchi. 1991. Induction of inflammatory arthropathy resembling rheumatoid arthritis in mice transgenic for HTLV-I. Science 253:1026.[Abstract/Free Full Text]
  15. Koide, J., K. Takada, M. Sugiura, H. Sekine, T. Ito, K. Saito, S. Mori, T. Takeuchi, S. Uchida, T. Abe. 1997. Spontaneous establishment of an Epstein-Barr virus-infected fibroblast line from the synovial tissue of a rheumatoid arthritis patient. J. Virol. 71:2478.[Abstract]
  16. Zhang, L., S. Nikkari, M. Skurnik, T. Ziegler, R. Luukkainen, T. Mottonen, P. Toivanen. 1993. Detection of herpesviruses by polymerase chain reaction in lymphocytes from patients with rheumatoid arthritis. Arthritis Rheum. 36:1080.[Medline]
  17. Takei, M., K. Mitamura, S. Fujiwara, T. Horie, J. Ryu, S. Osaka, S. Yoshino, S. Sawada. 1997. Detection of Epstein-Barr virus-encoded small RNA 1 and latent membrane protein 1 in synovial lining cells from rheumatoid arthritis patients. Intern. Immunol. 9:739.[Abstract/Free Full Text]
  18. Alam, A., N. Lambert, J. Lule, H. Coppin, B. Mazieres, C. De Preval, A. Cantagrel. 1996. Persistence of dominant T cell clones in synovial tissues during rheumatoid arthritis. J. Immunol. 156:3480.[Abstract]
  19. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries, N. S. Cooper, L. A. Healey, S. R. Kaplan, M. H. Liang, H. S. Luthra, et al 1988. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31:315.[Medline]
  20. Dobrescu, D., B. Ursea, M. Pope, A. S. Asch, D. N. Posnett. 1995. Enhanced HIV-1 replication in Vß12 T cells due to human cytomegalovirus in monocytes: evidence for a putative herpesvirus superantigen. Cell 82:753.[Medline]
  21. Mesri, E. A., E. Cesarman, L. Arvanitkais, S. Rafii, M. A. S. Moore, D. N. Posnett, D. M. Knowles, A. S. Asch. 1996. Human herpesvirus-8/Kaposi’s sarcoma-associated herpes virus (HHV8/KSHV) is a new transmissible virus that infects B-cells. J. Exp. Med. 183:2385.[Abstract/Free Full Text]
  22. Gopal, M. R., B. J. Thomson, J. Fox, R. S. Tedder, R. W. Honess. 1990. Detection by PCR of HHV-6 and EBV DNA in blood and oropharynx of healthy adults and HIV-seropositives. Lancet 335:1598.[Medline]
  23. Gerna, G., D. Zipeto, E. Percivalle, M. Parea, M. G. Revello, R. Maccario, G. Peri, G. Milanesi. 1992. Human cytomegalovirus infection of the major leukocyte subpopulations and evidence for initial viral replication in polymorphonuclear leukocytes from viremic patients. J. Infect. Dis. 166:1236.[Medline]
  24. Berneman, Z. N., D. V. Ablashi, G. Li, M. Eger-Fletcher, M. S. J. Reitz, C-L. Hung, I. Brus, A. L. Komaroff, R. C. Gallo. 1992. Human herpesvirus 7 is a T-lymphotropic virus and is related to, but significantly different from, human herpesvirus 6 and human cytomegalovirus. Proc. Natl. Acad. Sci. USA 89:10552.[Abstract/Free Full Text]
  25. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 266:1865.[Abstract/Free Full Text]
  26. Brooks, L., Q. Y. Yao, A. B. Rickinson, L. S. Young. 1992. Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts. J. Virol. 66:2689.[Abstract/Free Full Text]
  27. Tierney, R. J., N. Steven, L. S. Young, A. B. Rickinson. 1994. Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. J. Virol. 68:7374.[Abstract/Free Full Text]
  28. Robinson, M. A.. 1989. Allelic sequence variations in the hypervariable region of a TCR ß chain: correlation with restriction length polymorphism in human families and populations. Proc. Natl. Acad. Sci. USA 86:9422.[Abstract/Free Full Text]
  29. Scotet, E., M.-A. Peyrat, X. Saulquin, C. Retiere, N. Dulphy, A. Toubert, J-D. Bignon, A. Lim, H. Vie, M.-M. Hallet, J.-M. Berthelot, E. Houssaint, and M. Bonneville. 1999. Selective recruitment of Epstein-Barr virus and cytomegalovirus-reactive T cells in inflamed joints of arthritis patients: a model for analyzing the specificity and diversity of human primary memory T cell responses against common pathogens. Eur. J. Immunol. In press.
  30. Brichard, V., A. Van Pel, T. Wolfel, C. Wolfel, E. De Plaen, B. Lethe, P. Coulie, T. Boon. 1993. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J. Exp. Med. 178:489.[Abstract/Free Full Text]
  31. Espevik, T., J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164 clone 13, for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J. Immunol. Methods 95:99.[Medline]
  32. Kieff, E.. 1996. Epstein-Barr virus and its replication. B. N. Fields, and D. M. Knipe, and P. M. Howley, eds. Files Virology 3rd Ed.2343. Lippincott-Raven, Philadelphia.
  33. Decker, L. L., L. D. Klaman, D. A. Thorley-Lawson. 1996. Detection of the latent form of Epstein-Barr virus DNA in the peripheral blood of healthy individuals. J. Virol. 70:3286.[Abstract]
  34. Mahmoud, M. S., N. Huang, M. Nobuyoshi, I. A. Lisukov, H. Tanaka, M. M. Kawano. 1996. Altered expression of Pax-5 gene in human myeloma cells. Blood 87:4311.[Abstract/Free Full Text]
  35. Ziff, M.. 1974. Relation of cellular infiltration of rheumatoid synovial membrane to its immune response. Arthritis Rheum. 17:313.[Medline]
  36. Miller, G.. 1990. The switch between latency and replication of Epstein-Barr virus. J. Infect. Dis. 161:833.[Medline]
  37. Prang, N. S., M. W. Hornef, M. Jager, H. J. Wagner, H. Wolf, F. M. Schwarzmann. 1997. Lytic replication of Epstein-Barr virus in the peripheral blood: analysis of viral gene expression in B lymphocytes during infectious mononucleosis and in the normal carrier state. Blood 89:1665.[Abstract/Free Full Text]
  38. Kenney, S., J. Kamine, E. Holley-Guthrie, J. C. Lin, E. C. Mar, J. Pagano. 1989. The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J. Virol. 63:1729.[Abstract/Free Full Text]
  39. Rooney, C. M., D. T. Rowe, T. Ragot, P. J. Farrell. 1989. The spliced BZLF1 gene of Epstein-Barr virus (EBV) transactivates an early EBV promoter and induces the virus productive cycle. J. Virol. 63:3109.[Abstract/Free Full Text]
  40. Flemington, E., S. H. Speck. 1990. Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1. J. Virol. 64:1227.[Abstract/Free Full Text]
  41. Chi, T., M. Carey. 1993. The ZEBRA activation domain: modular organization and mechanism of action. Mol. Cell. Biol. 13:7045.[Abstract/Free Full Text]
  42. Daibata, M., R. E. Humphreys, T. Sairenji. 1992. Phosphorylation of the Epstein-Barr virus BZLF1 immediate-early gene product ZEBRA. Virology 188:916.[Medline]
  43. Zhang, Q., Y. Hong, D. Dorsky, E. Holley-Guthrie, S. Zalani, N. A. Elshiekh, A. Kiehl, T. Le, S. Kenney. 1996. Functional and physical interactions between the Epstein-Barr virus (EBV) proteins BZLF1 and BMRF1: effects on EBV transcription and lytic replication. J. Virol. 70:5131.[Abstract/Free Full Text]
  44. Furnari, F. B., V. Zacny, E. B. Quinlivan, S. Kenney, J. S. Pagano. 1994. RAZ, an Epstein-Barr virus transdominant repressor that modulates the viral reactivation mechanism. J. Virol. 68:1827.[Abstract/Free Full Text]
  45. Gutsch, D. E., E. A. Holley-Guthrie, Q. Zhang, B. Stein, M. A. Blanar, A. S. Baldwin, S. C. Kenney. 1994. The bZIP transactivator of Epstein-Barr virus, BZLF1, functionally and physically interacts with the p65 subunit of NF-{kappa}B. Mol. Cell. Biol. 14:1939.[Abstract/Free Full Text]
  46. Zhang, Q., D. Gutsch, S. Kenney. 1994. Functional and physical interaction between p53 and BZLF1: implications for Epstein-Barr virus latency. Mol. Cell Biol. 14:1929.[Abstract/Free Full Text]
  47. Miyashita, E. M., B. Yang, K. M. Lam, D. H. Crawford, D. A. Thorley-Lawson. 1995. A novel form of Epstein-Barr virus latency in normal B cells in vivo. Cell 80:593.[Medline]
  48. Alspaugh, M. A., E. M. Tan. 1975. Antibodies to cellular antigens in Sjögren’s syndrome. J. Clin. Invest. 55:1067.
  49. Depper, J. M., N. J. Zvaifler. 1981. Epstein-Barr virus: its relationship to the pathogenesis of rheumatoid arthritis. Arthritis Rheum. 24:755.[Medline]
  50. Silverman, S. L., H. R. Schumacher. 1998. Antibodies to Epstein-Barr viral antigens in early rheumatoid arthritis. Arthritis Rheum. 24:1465.
  51. Inoue, N., S. Harada, N. Miyasaka, A. Oya, K. Yanagi. 1991. Analysis of antibody titers to Epstein-Barr virus nuclear antigens in sera of patients with Sjögren’s syndrome and with rheumatoid arthritis. J. Infect. Dis. 164:22.[Medline]
  52. Tosato, G., A. D. Steinberg, R. Yarchoan, C. A. Heilman, S. E. Pike, V. De Seau, R. M. Blaese. 1984. Abnormally elevated frequency of Epstein-Barr virus-infected B cells in the blood of patients with rheumatoid arthritis. J. Clin. Invest. 73:1789.
  53. Yao, Q. Y., A. B. Rickinson, J. S. Gaston, M. A. Epstein. 1986. Disturbance of the Epstein-Barr virus-host balance in rheumatoid arthritis patients: a quantitative study. Clin. Exp. Immunol. 64:302.[Medline]
  54. Henle, G., E. T. Lennette, M. A. Alspaugh, W. Henle. 1979. Rheumatoid factor as a cause of positive reactions in tests for Epstein-Barr virus-specific IgM antibodies. Clin. Exp. Immunol. 36:415.[Medline]
  55. Newkirk, M. M., J. B. Shiroky, N. Johnson, D. Danoff, D. A. Isenberg, C. Shustik, G. R. Pearson. 1996. Rheumatic disease patients, prone to Sjögren’s syndrome and/or lymphoma, mount an antibody response to BHRF1, the Epstein-Barr viral homologue of BCL-2. Br. J. Rheumatol. 35:1075.[Abstract/Free Full Text]
  56. Newkirk, M. M., K. N. Watanabe Duffy, J. Leclerc, N. Lambert, J. B. Shiroky. 1994. Detection of cytomegalovirus, Epstein-Barr virus and herpes virus-6 in patients with rheumatoid arthritis with or without Sjögren’s syndrome. Br. J. Rheumatol. 33:317.[Abstract/Free Full Text]
  57. Newkirk, M. M., K. N. Duffy, A. Paleckova, E. Ivaskova, A. Galianova, J. Seeman, K. Vojtechovsky, C. Dostal. 1995. Herpes viruses in multicase families with rheumatoid arthritis. J. Rheumatol. 22:2055.[Medline]
  58. Jones, K., C. Rivera, C. Sgadari, J. Franklin, E. E. Max, K. Bhatia, G. Tosato. 1995. Infection of human endothelial cells with Epstein-Barr virus. J. Exp. Med. 182:1213.[Abstract/Free Full Text]
  59. Lindhout, E., A. Lakeman, M. L. Mevissen, C. de Groot. 1994. Functionally active Epstein-Barr virus-transformed follicular dendritic cell-like cell lines. J. Exp. Med. 179:1173.[Abstract/Free Full Text]
  60. Lay, J. D., C. J. Tsao, J. Y. Chen, M. E. Kadin, I. J. Su. 1997. Upregulation of tumor necrosis factor-{alpha} gene by Epstein-Barr virus and activation of macrophages in Epstein-Barr virus-infected T cells in the pathogenesis of hemophagocytic syndrome. J. Clin. Invest. 100:1969.[Medline]
  61. McClain, K. L., C. T. Leach, H. B. Jenson, V. V. Joshi, B. H. Pollock, R. T. Parmley, F. J. Di Carlo, E. G. Chadwick, S. B. Murphy. 1995. Association of Epstein-Barr virus with leiomyosarcomas in children with AIDS. N. Engl. J. Med. 332:12.[Abstract/Free Full Text]
  62. Lee, E. S., J. Locker, M. Nalesnik, J. Reyes, R. Jaffe, M. Alashari, B. Nour, A. Tzakis, P. S. Dickman. 1995. The association of Epstein-Barr virus with smooth-muscle tumors occurring after organ transplantation. N. Engl. J. Med. 332:19.[Abstract/Free Full Text]
  63. Brousset, P., M. Caulier, A. Cantagrel, C. Dromer, B. Mazieres, G. Delsol. 1993. Absence of Epstein-Barr virus carrying cells in synovial membranes and subcutaneous nodules of patients with rheumatoid arthritis. Ann. Rheum. Dis. 52:608.[Abstract/Free Full Text]
  64. Simitsek, P. D., D. G. Campbell, A. Lanzavecchia, N. Fairweather, C. Watts. 1995. Modulation of antigen processing by bound antibodies can boost or suppress class II major histocompatibility complex presentation of different T cell determinants. J. Exp. Med. 181:1957.[Abstract/Free Full Text]
  65. Salemi, S., A. P. Caporossi, L. Boffa, M. G. Longobardi, V. Barnaba. 1995. HIVgp120 activates autoreactive CD4-specific T cell responses by unveiling of hidden CD4 peptides during processing. J. Exp. Med. 181:2253.[Abstract/Free Full Text]
  66. Lanzavecchia, A.. 1995. How can cryptic epitopes trigger autoimmunity? [Commentary]. J. Exp. Med. 181:1945.[Free Full Text]
  67. Gaston, J. S., A. B. Rickinson, M. A. Epstein. 1983. Cross-reactivity of self-HLA-restricted Epstein-Barr virus-specific cytotoxic T lymphocytes for allo-HLA determinants. J. Exp. Med. 158:1804.[Abstract/Free Full Text]
  68. Argaet, V. P., C. W. Schmidt, S. R. Burrows, S. L. Silins, M. G. Kurilla, D. L. Doolan, A. Suhrbier, D. J. Moss, E. Kieff, T. B. Suclley, et al 1994. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 180:2335.[Abstract/Free Full Text]
  69. Burrows, S. R., S. L. Silins, D. J. Moss, R. Khanna, I. S. Misko, V. P. Argaet. 1995. T cell receptor repertoire for a viral epitope in humans is diversified by tolerance to a background major histocompatibility complex antigen. J. Exp. Med. 182:1703.[Abstract/Free Full Text]
  70. Ohashi, P. S., S. Oehen, K. Buerki, H. Pircher, C. T. Ohashi, B. Odermatt, B. Malissen, R. M. Zinkernagel, H. Hengartner. 1991. Ablation of "tolerance" and induction of diabetes by virus infection in viral antigen transgenic mice. Cell 65:305.[Medline]
  71. Hemler, M. E., D. Glass, J. S. Coblyn, J. G. Jacobson. 1986. Very late activation antigens on rheumatoid synovial fluid T lymphocytes: association with stages of T cell activation. J. Clin. Invest. 78:696.
  72. Jorgensen, C., A. Travaglio-Encinoza, C. Bologna, A. D. d’Angeac, T. Reme, J. Sany. 1994. Human mucosyl lymphocyte marker expression in synovial fluid lymphocytes of patient with rheumatoid arthritis. J. Rheumatol. 21:1602.[Medline]
  73. Hu, M. C., D. T. Crowe, I. L. Weissman, B. Holzmann. 1992. Cloning and expression of mouse integrin ß p(ß7): a functional role in Peyer’s patch-specific lymphocyte homing. Proc. Natl. Acad. Sci. USA 89:8254.[Abstract/Free Full Text]
  74. Trollmo, C., I. M. Nilsson, C. Sollerman, A. Tarkowski. 1996. Expression of the mucosal lymphocyte integrin {alpha}Eß7 and its ligand E-cadherin in the synovium of patients with rheumatoid arthritis. Scand. J. Immunol. 44:293.[Medline]
  75. Saito, I., B. Servenius, T. Compton, R. I. Fox. 1989. Detection of Epstein-Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjögren’s syndrome. J. Exp. Med. 169:2191.[Abstract/Free Full Text]
  76. Kouskoff, V., A. S. Korganow, V. Duchatelle, C. Degott, C. Benoist, D. Mathis. 1996. Organ-specific disease provoked by systemic autoimmunity. Cell 87:811.[Medline]



This article has been cited by other articles:


Home page
Ann. N. Y. Acad. Sci.Home page
S. SAWADA, M. TAKEI, T. ISHIWATA, H. SHIRAIWA, H. INOMATA, and T. NOZAKI
SLAM-Associated Protein Solves a Mystery of Autoimmunity
Ann. N.Y. Acad. Sci., August 1, 2007; 1109(1): 19 - 30.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
R Goldbach-Mansky, S Suson, R Wesley, C E Hack, H S El-Gabalawy, and P P Tak
Raised granzyme B levels are associated with erosions in patients with early rheumatoid factor positive rheumatoid arthritis
Ann Rheum Dis, May 1, 2005; 64(5): 715 - 721.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Curran, O. M. FitzGerald, P. J. Costello, J. M. Selby, D. J. Kane, B. Bresnihan, and R. Winchester
Nucleotide Sequencing of Psoriatic Arthritis Tissue before and during Methotrexate Administration Reveals a Complex Inflammatory T Cell Infiltrate with Very Few Clones Exhibiting Features That Suggest They Drive the Inflammatory Process by Recognizing Autoantigens
J. Immunol., February 1, 2004; 172(3): 1935 - 1944.
[Abstract] [Full Text] [PDF]


Home page