|
|
||||||||


*
Edward Mallinckrodt Department of Pediatrics, Washington University School of Medicine, St. Louis, MO 63110;
Blood Transfusion Service, Finnish Red Cross, Helsinki, Finland;
Division of Clinical Immunology and Rheumatology, University of Alabama, Birmingham, AL 35294;
§
Raahe District Hospital, Raahe, Finland; and
¶
Childrens Hospital Research Foundation, Department of Pediatrics, Ohio State Biochemistry Program, and Department of Medical Microbiology and Immunology, Ohio State University, Columbus, OH 43205
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The genetics of human complement C4 are complex. There is a frequent
variation in the number and size of the C4 genes present in an
individual (reviewed in 7 . The majority of the population has two
C4 loci coding for C4A and C4B proteins, respectively. The C4 genes are
either 21 or 14.6 kb in size due to the presence of an endogenous
retrovirus HERV-K(C4) in intron 9 of the long C4 gene 8, 9, 10, 11 . Deletion
or duplication of the C4 genes is always accompanied by
neighboring genes RP at the 5' region, steroid hydroxylase
gene CYP21, and extracellular matrix protein gene tenascin
TNX at the 3' region. Along with C4, these genes make up a
genetic module known as the
RCCX4, 12, 13, 14 . There can be
one, two, or three RCCX (RP-C4-CYP21-TNX) modules on one copy of
chromosome 6 in the HLA class III region. Variation in RCCX module
numbers between chromosomes may favor unequal cross-over events
resulting in deletions and homoduplications of C4 and its neighboring
genes. Indeed, such haplotypes have been recognized with a reasonably
high frequency 15, 16 , accounting for a major fraction (
60%) of
the known C4 null (Q0) alleles, although other molecular mechanisms
that can generate C4A or C4B null alleles have been identified 17 .
Approximately 35% of individuals among all races surveyed 18 have either a C4AQ0 or a C4BQ0 allele; about 810% do not express two of the four C4 alleles, and about 1% express only a single C4 allele. C4A and C4B null alleles have been associated with systemic lupus erythematosus (SLE), insulin-dependent diabetes mellitus, IgA nephropathy, Henoch-Schönlein purpura, subacute sclerosing panencephalitis, autoimmune chronic active hepatitis, membranoproliferative glomerulonephritis, rapid progression of HIV infection, and several other disorders 19, 20, 21, 22 . These associations may be due to linkage with other MHC genes, the C4 deficiency (C4D) itself, or both. Total deficiency of C4B (homozygous C4BQ0) is a risk factor for bacterial meningitis 23 . Homozygous deficiency of C4A occurs in the general population at a frequency of about 2%, but 1015% of whites with SLE are homozygous C4AQ0, and >50% of whites with SLE are heterozygous for C4AQ0. Studies of other racial groups 24 suggest that the C4A null alleles are important variables, independent of or in addition to the closely linked MHC class II genes in the disease expression of SLE.
The apparent importance of C4D in the pathophysiology of SLE and perhaps some of the other associated diseases together with relatively few studies that have explored the molecular mechanisms of complete C4D prompted this study of a C4-deficient Finnish woman with SLE. The molecular basis of her complete C4D was elucidated by investigating the biosynthesis of C4 protein, transcription of C4 mRNA, detection of C4A and C4B genes, and nucleotide sequencing to pinpoint the mutations leading to nonexpression of C4A and C4B proteins from both chromosomes.
| Materials and Methods |
|---|
|
|
|---|
HLA-A, -B, -C, and -DR Ags were assigned by the standard microlymphocytotoxicity test 25 . HLA class II typings DRB1, DRB3, DRB5, and DQB1 were also performed by the PCR-based chemiluminescent reverse dot blot method 26 . Complement factor B and C4 allotypes were determined electrophoretically as described by Marcus and Alper 27 . Standard methods were used for radial immunodiffusion 28 and total hemolytic complement in gels (Quantiiplate, Kallestad, Beaumont, TX).
Cells
Skin fibroblast cell lines were established from the C4-deficient patient, her HLA-identical brother, and a normal individual according to published methods 29, 30 . Cells were maintained at 37°C in 5% CO2 in DMEM supplemented with 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin.
EBV-infected B cell lines were established from the father and the mother of the C4D patient and maintained at 37°C in 5% CO2 in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) supplemented with 10% bovine calf serum, 5 mM sodium pyruvate, 2 mM glutamine, 10 U/ml penicillin, 10 µg/ml streptomycin, and 1 mM nonessential amino acids. Anticoagulated peripheral blood samples from all the family members were obtained for DNA extraction.
Biosynthetic labeling
Biosynthetic labeling experiments were performed using C4D
and normal fibroblasts grown to confluence in 24-multiwell tissue
culture plates (Corning, Corning, NY) in DMEM containing 10% FCS.
Before each experiment the cells were washed twice with warm HBSS (Life
Technologies) and incubated for 2 h in DMEM containing
[35S]methionine at 250 µg/ml (ICN Radiochemical,
Irvine, CA; sp. act., 1100 Ci/mmol). DMEM without serum but with 1
mg/ml BSA was used for the labeling period. In some experiments cells
were incubated before labeling with mediators (IFN-
(1000 U/ml;
Amgen, Thousand Oaks, CA) and TNF-
(30 ng/ml; Genentech, South San
Francisco, CA)) for 24 h to maximize C4 expression. At the end of
the pulse period, the extracellular medium was recovered. The cells
were washed twice with warm PBS and lysed by one freeze-thaw cycle in
PBS containing 0.5% sodium deoxycholate (Fisher Scientific, Fairlawn,
NJ), 1% (w/v) Triton X-100 (Sigma), 10 mM EDTA (Sigma), 2 mM PMSF
(Sigma), and 100 µg/ml leupeptin (Boehringer Diagnostics, Somerville,
NJ). The lysed cells and extracellular media were clarified by
centrifugation, and total protein synthesis was measured by TCA (Sigma)
precipitation of 5-µl aliquots of the cell lysate or extracellular
medium 31 .
Immunoprecipitation and SDS-PAGE
The samples were precleared with Staphylococcus aureus protein A (Immunoprecipitin, Life Technologies) and then incubated in the presence of goat polyclonal Abs (IgG fraction) to C4, to C3, and to C1INH (Incstar, Scarborough, ME) overnight at 4°C with excess Ab 32 . After incubation, excess Staphylococcus protein A was added to capture Ag-Ab complexes. Immunoprecipitates were washed once with PBS containing 0.5% SDS, 1% (w/v) Triton X-100, 0.5% sodium deoxycholate, and 0.5% BSA (ICN Immunologicals, Costa Mesa, CA) and three times with the same buffer without BSA. The immunoprecipitates were subjected to SDS-PAGE under reducing conditions (5% 2-ME) according to the method of Laemmli 33 . The m.w. markers were analyzed in parallel lanes and visualized by Coomassie Brilliant Blue R-250 staining. The gels were fixed in a solution of 46% methanol and 8% acetic acid in water for 30 min, rinsed in water, treated with Fluoro-Hance (RPI, Mount Prospect, IL) for 30 min, dried, and exposed with an intensifier screen at -70°C to Kodak XAR-5 film (Eastman Kodak, Rochester, NY).
RNA isolation and Northern blot analysis
C4D and normal fibroblasts were grown to confluence in
100-mm culture dishes and stimulated with 500 U/ml of IFN-
and with
30 ng/ml of TNF-
for 24 h before RNA harvest. Cells were lysed
with guanidium isothiocyanate; total cellular RNA was purified by CsCl
density gradient ultracentrifugation and quantified by absorbance at
260 nm 34 . RNA samples (20 and 40 µg) were denatured, subjected to
electrophoresis in 1% agarose/formaldehyde gel, transferred to a nylon
membrane (Amersham, Arlington Heights, IL), washed twice for 5 min each
time in 2x SSC (1x SSC = 0.015 M sodium citrate and 0.15 M NaCl,
pH 7.0), air-dried, and UV cross-linked before prehybridization at
65°C for 4 h in the following buffer: 50 mM PIPES, 100 mM NaCl,
50 mM sodium phosphate, and 1 mM EDTA 35 . The C4, factor B, and actin
cDNA probes were radiolabeled with 100 µCi of
[
-32P]dCTP (ICN, Irvine, CA) using the Random Prime
DNA labeling kit (Promega, Madison, WI) according to the
manufacturers protocol. After hybridization overnight at 65°C, the
filters were washed at room temperature for 30 min, then three times at
65°C for 15 min for C4, and twice for factor B in 5x SSC/1% SDS and
autoradiographed.
DNA isolation and Southern blot analysis
Genomic DNA was extracted from fibroblasts or
EBV-transformed lymphoblasts by proteinase K digestion followed by
phenol-chloroform extraction and ethanol precipitation 36 . Buffy
coats of peripheral white blood cells were digested with proteinase K.
After digestion, cellular proteins were salted out by dehydration and
precipitated with a saturated NaCl solution 37 . Individual DNA
samples of 10 or 15 µg were digested with the appropriate restriction
enzymes. The DNA fragments were separated by electrophoresis in an
0.8% agarose gel (ultrapure agarose, Life Technologies) and
transferred to a nylon membrane (Hybond-N+, Amersham,
Arlington Heights, IL). Prehybridization and hybridization were
conducted at 65°C in 5x SSC/0.2% SDS. For hybridization, 60 ng of
purified DNA insert was labeled with [
-32P]dCTP (ICN,
Irvine, CA) by the random priming method (Promega, Madison, WI).
Hybridization was performed overnight followed by two subsequent washes
of 20 min each in 0.2x SSC/1% SDS at 65°C, and the blots were
visualized by autoradiography.
DNA probes
The full-length C4 cDNA clone pAT-A and its 476-bp
BamHI/KpnI fragment specific for the 5' ends
of both C4 genes were used for C4 probing 15, 38 . The CYP21-specific
probe was a 500-bp SstI/PstI fragment from
the 3' end of the 2.4-kb genomic C4.5 CYP21 clone, provided by Dr.
David Chaplin (Washington University School of Medicine, St. Louis,
MO). The RP probe was a 1.1-kb fragment corresponding to nucleotides
522-1620 of the RP1 cDNA 13 . The TNX probe is a 500-bp fragment
corresponding to exons 3537 of the human TNXA gene 12 . The factor B
cDNA probe was a 1761-bp PstI fragment isolated from
the previously characterized pBfA-28 clone 16 . The
-actin probe
was an 800-bp PstI-BamHI fragment of a
cDNA isolated from chick skeletal muscle 39 .
Oligonucleotide synthesis and DNA sequence analysis
All primers used for RT, DNA amplification, and sequencing were synthesized using an automated DNA synthesizer PCR-Mate (model 391, Applied Biosystems, Foster City, CA) and are shown below. Genomic sequencing was performed using double-stranded templates and a model 373A automated DNA sequencer from Applied Biosystems according to the standard protocol of the taqDyeDeoxy Terminator Cycle Sequencing Kit. Before direct sequencing, all PCR-amplified DNA products were purified on a 1% agarose gel using Whatman DE81 paper (Clifton, NJ) and ethanol precipitation. The region covering genomic DNA from exons 1929 except for three gaps was sequenced in the father, mother, and proposita as well as in an unrelated control. Genomic DNA from two other siblings was also used for sequencing some parts of this region. All oligonucleotides were identical with the published C4 genomic sequence 40 , except for substitutions that were introduced (oligonucleotides 9 and 13) to generate restriction sites to facilitate cloning. Numbering of nucleotides in the C4 sequence is given in Ref. 40.
Oligonucleotides
The following oligonucleotides were used: 1) 5'-GACACTGTGGCTCCCCGACTCTCTG-3', 2) 5'-CGAGGGTCCTTCGAATTCCCTGTGG-3', 3) 5'-GGGGTGCTCCATTCACCTCAATCTG-3', 4) 5'-GACAAGGCCCCCTCAGAGCCTAAAG-3', 5) 5'-TGCGGATCCAGCAGTTTCGGAAG-3', 6) 5'-CCTGCTCCTGGGCCAAACTCAG-3', 7) 5'-TCAGTGGCGTTTCTGCCCTCTG-3', 8) 5'-ACCCTCCTCCCGTTTTCTTCCAG-3', 9) 5'-GTGCTGGGATCCTGGGTGCCCACGCAG-3', 10) 5'-GAGCCCAGCAGGGGGTGGCTAAG-3', 11) 5'-CTCAGGATCCTAAGTCCCCTGGGCCT-3', 12) 5'-CGCAGCCTGGTCTGCCATCTCTG-3', 13) 5'-GTTGTTAAGCTTCAGCGCGTGGGACTTG-3', and 14) 5'-CCCACCTTCACATTGATCTTG-3'.
Amplification of cDNA and genomic DNA
Ten micrograms of total RNA isolated from fibroblasts of C4D and normal individuals was incubated with 10 U of reverse transcriptase at 42°C for 1 h using the buffers and dNTPs supplied in a cDNA synthesis kit (Invitrogen, San Diego, CA). Oligonucleotide 14, antisense to the normal C4 cDNA sequence, was used as a primer in the first-strand synthesis. The cDNA was subsequently amplified by PCR using the first strand as template and oligonucleotide pairs of 9 and 13. These primers were constructed with restriction sites near the 5' ends, but the PCR product was purified as described above and used for direct sequencing. The first-strand cDNA was initially denatured at 93°C for 1 min with 1 µg of each oligonucleotide in a 100-µl solution containing 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.1% gelatin, 20 mM dNTPs, and 0.5 U of KlenTaq 1 DNA polymerase 41 . Following initial denaturation, the cDNA was amplified by melting at 93°C for 1 min, annealing at 66°C for 1 min, and polymerization at 72°C for 2 min. Forty cycles of amplification were performed using a programmable Hybaid OmniGene thermal cycler (Labnet, Middlesex, U.K.) followed by a final elongation at 72°C for 5 min. The C4 cDNA was purified and sequenced as outlined above.
Genomic DNA was amplified using 400 ng of DNA and 200 ng of each primer in a primer pair with the other reagents as described above in a "touchdown" protocol 42 . The first six cycles were conducted at decreasing annealing temperatures in 2°C steps for two cycles each from 72 to 64°C, followed by 30 cycles using the following conditions: 10 s at 98°C, 1.5 min at 64°C, and 5 min at 72°C. The amplified genomic DNA was purified and sequenced as outlined above.
Cloning and sequencing of the entire C4d genomic regions for the C4B genes
DNA fragments corresponding to the C4d region were amplified with synthetic PCR primers C4E 22.5 and C4E 31.3 using the High Fidelity PCR system (Boehringer Mannheim, Indianapolis, IN). PCR conditions were one cycle at 94°C for 2 min; 10 cycles at 94°C for 15 s, 65°C for 30 s, and 72°C for 1 min; 20 cycles at 94°C for 15 s, 56°C for 30 s, and 72°C for 1 min plus 20-s time extensions; one cycle at 72°C for 7 min; followed by a 4°C dwell cycle. The PCR product was purified (Qiagen, Chatsworth, CA) and cloned into TA cloning vector (Invitrogen). The C4d insert of the clones was amplified again via PCR, and the purified PCR product was restriction digested with NlaIV to determine the presence of either C4A or C4B. A 467-bp fragment represents C4B, while two fragments (276 and 191 bp) represent C4A 15 . Clones representing C4B from both the propositas mother and father were sequenced (ABI Prism). Comparison of DNA sequences with national databases was performed by the GCG FASTA program from the Pittsburgh Supercomputing Center. DNA alignments were performed with the SeqManII program (DNASTAR). Synthetic DNA primers for PCR and for cycle sequencing were synthesized by Life Technologies (Grand Island, NY). Details of the primer sequences are as follows. For amplification of the C4d region of the C4 gene the primer sequences were: C4E 22.5, GAAGGGGCCATCCATAGAGA; and C4E 31.3, CTTCAGGGTTCCTTTGCTGT. For sequencing of the C4d region of the C4B gene the primer sequences were: C4E 25.3, CAGGTGCTGCTGTCCCGTGA; C4E 26.5, GCTCACAGCCTTTGTGTTGAA; C4E 27.3, CACTCTCTGCTTCAATGGCT; C4E 28.5, GAAGCCTCCATCTCAAAGGC; and C4E 29.3, TTGGGTACTGCGGAATCCCC.
| Results |
|---|
|
|
|---|
The patient was a 30-yr-old Finnish woman who developed
photosensitivity, a malar rash, polyarthritis, leukopenia, and positive
anti-nuclear Ab (1/320), anti-Sm Ab (1/1280), and a weakly
positive rheumatoid factor coincident with her first pregnancy and
shortly after delivery. In her serum, complement protein C4 was
undetectable, and C3 was modestly reduced or at the lower limit of
normal (74111 mg/100 ml). A skin biopsy revealed vasculitis
with deposition of IgM and C3. Five years later she developed aphthous
ulcers and increased joint symptoms, for which she was treated with
prednisone. An exacerbation of mucositis 1 yr later led to an increase
in prednisone therapy and subsequent treatment with azathioprine and
methotrexate. An ectopic pregnancy and a pregnancy with her second
child each precipitated exacerbations of her symptoms. She has had no
renal or cardiac disease, no increased susceptibility to infection,
hypersensitivity to medications, or central nervous system disease.
Family history revealed a younger male sibling (HLA identical) who
suffers from photosensitivity. Her children, her parents, and her MHC
nonidentical brother are alive and well. Laboratory studies showed
undetectable total hemolytic complement (CH100) and no C4 protein by
radial immunodiffusion in the patient or her HLA identical brother.
Quantitation of C4 and CH100 in the immediate family members and their
HLA typing is shown in Fig. 1
. In brief,
the proposita inherited the HLA A2 B39 Cw7 DRB1*1501 DRB5*0101
DQB1*0602, BF-S, C4AQ0 BQ0 from the paternal chromosome, and HLA A2 B40
Cw3 DRB1*1501, DRB5*0101 DQB1*0602, BF-S, C4AQ0 BQ0 from the maternal
chromosome. The C4 haplotypes for the patients father are C4AQO
BQO/C4AQ0 B2. The C4 haplotypes for the patients mother are C4AQ0
BQ0/C4A3 B3.
|
To determine whether a defect in regulation of C4 gene expression,
C4 synthesis, or secretion accounted for the low to absent C4 protein
in sera of the homozygous deficient patient, primary fibroblast cell
cultures were established. SDS-PAGE of immunoprecipitates of cell
lysates and culture media from [35S]methionine
pulse-labeled normal and propositas C4 deficient (C4D) fibroblast
cultures is shown in Fig. 2
. Fibroblasts
were incubated with IFN-
(500 U/ml) and TNF-
(30 ng/ml) to yield
maximum C4 expression 24 . A polypeptide of approximately 185 kDa,
corresponding in size to pro-C4, was detected in lysates, and native C4
subunits (
,
93 kDa; ß,
78 kDa;
,
33 kDa) plus the
approximately 125-kDa processing intermediate
-
fragment were
recovered from the culture media in normal fibroblast cultures. Neither
pro-C4 nor native C4 protein was detected in IFN-
- and
TNF-
-stimulated C4D fibroblast cultures even after prolonged
exposure (10 days) of the autoradiograph. In contrast, both C4D and
normal fibroblasts synthesized and secreted comparable amounts of C1
inhibitor, a highly IFN-
-responsive complement protein, and C3, a
protein similar to C4 in size and postsynthetic processing (Fig. 3
, A and B). C3
synthesis and secretion were more variable among separate replicate
experiments, but the mean C3 expression in C4D cells was not
significantly different from normal.
|
|
The size and amount of C4 mRNA in normal and C4D IFN-
- and
TNF-
-stimulated fibroblasts were estimated by Northern blot
analysis. C4-specific mRNA (5.5 kb) in cytokine-stimulated cells was of
similar size in normal and C4D fibroblasts, but the amount of C4 mRNA
was markedly reduced in the C4D fibroblasts (Fig. 4
). Scanning of replicate Northern blots
for C4, factor B, and actin confirmed a selective decrease in C4 mRNA
(<3% of normal) in the deficient cells, with only a minor difference
(1.5:1) in Bf mRNA compared with normal cells.
|
The presence of C4 and its neighboring genes for the RCCX modules
in the HLA were investigated to determine the molecular basis of the
C4D. Genomic DNAs from the patient and her parents were digested with
restriction enzyme TaqI and hybridized to RP, C4, CYP21, and
TNX probes. As shown in Fig. 5
, the
father (lane 3) has the 7.0- and 5.4-kb
restriction fragments corresponding to RP1-C4(L) and RP2-C4(S),
respectively; the 3.7- and 3.2-kb fragments corresponding to CYP21B and
CYP21A, respectively; and the 2.5- and 2.4-kb fragments corresponding
to TNXB and TNXA genes, respectively. The band intensities for these
fragments are similar; therefore, he is homozygous for
RP1-C4(L)-CYP21A-TNXA-RP2-C4(S)-CYP21B-TNXB. The C4 allotyping results
suggested that he has C4AQ0 C4BQ0 and C4AQ0 C4B2. Therefore, the father
has RCCX bimodular (L-S) haplotypes in both chromosomes. Both C4A and
C4B genes are present in the C4AQ0 BQ0 chromosome, but these genes are
not producing C4 protein. Similarly, the C4AQ0 C4B2 chromosome with the
RCCX bimodular (L-S) haplotype is likely to have a C4A pseudogene.
|
For the patient, the 7.0-kb TaqI fragment for RP1-C4(L) is more intense than the 5.4-kb fragment for RP2-C4(S) (lane 4). In addition, the 3.7-kb fragment for CYP21B is more intense than the 3.2-kb CYP21A fragment. She is heterozygous for a RCCX bimodular chromosome RP1-C4(L)-CYP21A-TNXA-RP2-C4(S)-CYP21B-TNXB and one monomodular RCCX chromosome RP1-C4(L)-CYP21B-TNXB. She has two long C4 genes and one short C4 gene. None of these three C4 genes expresses detectable C4 protein. Lane 1 shows the result of a control DNA (T cell line MOLT4) with bimodular RCCX (L-S) haplotypes.
C4 typing by restriction mapping and sequence analysis
To define and type the C4 genes inherited in this family, a 934-bp
genomic fragment spanning from exon 25 to the 5' end of intron 28 that
permits differentiating among specific C4 allotypes 8 was amplified
from genomic DNA using primers 5 and 11, subjected to digestion with
NlaIV and EcoO109, and sequenced. The digests and
the patterns characteristic for specific C4 isotypes at each of the C4
genes and sequence analysis are shown in Table I
.
|
|
This 2-bp insertion in exon 29 of C4A was previously reported 43 , and
the stop codon in the next exon was predicted on the assumption that
normal splicing (excision at the normal splice sites) of intron 29
would occur. To directly test this presumption, RNA from the patients
and normal fibroblasts (stimulated with IFN-
and TNF-
) was
amplified by RT-PCR (primer 14 to generate cDNA and primers 9 and 13
for PCR amplification) and then subjected to sequence analysis. These
results revealed an exonic sequence identical with that obtained from
genomic sequencing and normal splicing between exons 2830 (data not
shown).
| Discussion |
|---|
|
|
|---|
Analysis of the nuclear family established that the patient inherited a nonexpressed long C4A gene from her mother, a nonexpressed long C4A gene, and a nonexpressed short C4B gene from her father. Her maternally derived haplotype, A2; B40; Cw3; DR2 (DRB1*1501, DRB5*0101, DQB1*0602), also contains a deleted C4B gene. C4B deletions have been recognized in association with B40 46, 47 , while the linkage between B40 and DR2 is unusual. Her paternally derived haplotype, A2;B39;Cw7;DR2 (DRB1*1501, DRB5*0101, DQB1*0602), is identical at the DR/DQ loci and differs at the class I loci. A detailed analysis of the basis for lack of expression of the patients nondeleted C4 genes was undertaken. This revealed an identical 2-bp insertion in her three nonexpressed C4 genes, which include two C4A genes and one C4B gene. This 2-bp insertion in exon 29 was previously observed by Schneider and colleagues 43 in several C4A null alleles; the majority of them were associated with HLA-B60 and DR6. In their study, based entirely on sequence analysis of genomic DNA (PCR amplified), they predicted that this frameshift mutation would generate a stop codon in the next exon of the C4 transcript derived from this gene. Generation of the stop codon would occur only if splicing of intron 29 was executed at the normal splice sites. Examples of splicing abnormalities, particularly in the context of mutations (including frame shifts) have been reported 48, 49, 50, 51, 52 . Because C4 is expressed in a readily available tissue (skin fibroblasts), we were able to establish that splicing at the exon 2930 junction was normal and that a truncated C4 translation product would be generated. This truncated C4 polypeptide was not detected in cell culture, probably because the shortened pro-C4 may be unstable.
Nonsense mutations have been associated with marked decreases in steady
state levels of specific mRNA in other instances, such as ß-globin
53 ,
1-antitrypsin 54 , surfactant protein B 55 ,
cystic fibrosis transmembrane regulator 56 , and others 56, 57 .
Although the basis for this observation is not completely understood
52 , a similar mechanism could account for the decreased levels of C4
mRNA observed in this patient (see Fig. 4
). Nonetheless, sufficient C4
mRNA was present in cytokine-stimulated fibroblasts to allow nucleotide
sequence analysis of RT-PCR products from the homozygous deficient
fibroblasts. In contrast to the earlier study that identified this
mutation only in C4AQ0, the 2-bp (TC) insertion was surprisingly also
present in the patients C4BQ0 nonexpressed genes, giving the first
evidence of the molecular basis for C4B pseudogenes. This 2-bp
insertion in exon 29 of the nonexpressed C4BQ0 gene could have been
acquired from the C4AQ0 gene of the HLA B40-positive haplotype by
unequal cross-over or gene conversion-like events. It has been noticed
that some of the C4BQ0 phenotypes in the population are attributed to
the deletion of the C4B gene (as shown here for the HLA B40 DR2
haplotype) or to the expression of C4A proteins from the two tandem C4
loci as documented in the HLA B44 DR6 haplotype 15 . This report shows
that the third cause of a C4BQ0 phenotype is due to a 2-bp insertion at
codon 1213 of the C4B gene that causes a frameshift mutation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 This work was supported by grants from the National Institutes of Health (AI24739 and HD17461 to H.R.C.; AR43969 to C.Y.Y.) and the Pittsburgh Supercomputing Center through the National Institutes of Health Center for Research Resources Cooperative Agreement (1P41RR06009 to C.Y.Y.). ![]()
3 Address correspondence and reprint requests to Dr. Harvey R. Colten, Northwestern University Medical School, 303 East Chicago Ave., Morton Building 4-656, Chicago, IL 60611. E-mail address: ![]()
4 Abbreviations used in this paper: RCCX, RP, C4, CYP21, and TNX; SLE, systemic lupus erythematosus; C4D, C4 deficiency. ![]()
Received for publication October 2, 1998. Accepted for publication December 10, 1998.
| References |
|---|
|
|
|---|
-actin messenger ribonucleic acid. Biochemistry 19:5883.[Medline]
1-antitrypsin in serum and the homozygous inheritance [corrected] of a stop codon in an
1-antitrypsin-coding exon. Am. J. Hum. Genet. 42:77.[Medline]
This article has been cited by other articles:
![]() |
S. Puah, L. Lian, C. Chew, K. Chua, and S. Tan A study of association of the complement C4 mutations with systemic lupus erythematosus in the Malaysian population Lupus, September 1, 2007; 16(9): 750 - 754. [Abstract] [PDF] |
||||
![]() |
K Lhotta, R Wurzner, A R Rosenkranz, R Beer, A Rudisch, F Neumair, and G Mayer Cerebral vasculitis in a patient with hereditary complete C4 deficiency and systemic lupus erythematosus Lupus, February 1, 2004; 13(2): 139 - 141. [Abstract] [PDF] |
||||
![]() |
T. Jaatinen, M. Lahti, O. Ruuskanen, R. Kinos, L. Truedsson, R. Lahesmaa, and M.-L. Lokki Total C4B Deficiency Due to Gene Deletion and Gene Conversion in a Patient with Severe Infections Clin. Vaccine Immunol., March 1, 2003; 10(2): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Rupert, J. M. Moulds, Y. Yang, F. C. Arnett, R. W. Warren, J. D. Reveille, B. L. Myones, C. A. Blanchong, and C. Y. Yu The Molecular Basis of Complete Complement C4A and C4B Deficiencies in a Systemic Lupus Erythematosus Patient with Homozygous C4A and C4B Mutant Genes J. Immunol., August 1, 2002; 169(3): 1570 - 1578. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jaatinen, M. Eholuoto, T. Laitinen, and M.-L. Lokki Characterization of a De Novo Conversion in Human Complement C4 Gene Producing a C4B5-Like Protein J. Immunol., June 1, 2002; 168(11): 5652 - 5658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Blanchong, B. Zhou, K. L. Rupert, E. K. Chung, K. N. Jones, J. F. Sotos, W. B. Zipf, R. M. Rennebohm, and C. Y. Yu Deficiencies of Human Complement Component C4A and C4B and Heterozygosity in Length Variants of RP-C4-CYP21-TNX (RCCX) Modules in Caucasians: The Load of RCCX Genetic Diversity on Major Histocompatibility Complex-associated Disease J. Exp. Med., June 19, 2000; 191(12): 2183 - 2196. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, A. R. Mendoza, T. R. Welch, W. B. Zipf, and C. Y. Yu Modular Variations of the Human Major Histocompatibility Complex Class III Genes for Serine/Threonine Kinase RP, Complement Component C4, Steroid 21-Hydroxylase CYP21, and Tenascin TNX (the RCCX Module). A MECHANISM FOR GENE DELETIONS AND DISEASE ASSOCIATIONS J. Biol. Chem., April 23, 1999; 274(17): 12147 - 12156. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |