| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
in Endotoxin-Tolerant Mice: Deficiencies in Both IL-12 Heterodimer Production and IL-12 Responsiveness1
*
Cleveland Citywide Pediatric Infectious Diseases Program, Case Western Reserve University School of Medicine, Cleveland, OH, 44106; and
Division of Geographic Medicine, Case Western Reserve University School of Medicine and Medical Research Services, Veterans Affairs Medical Center, Cleveland OH 44106
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production is markedly impaired in endotoxin-tolerant mice and
additionally found 2- to 6-fold decreases in serum IFN-
in these
animals following endotoxin challenge. The IFN- deficiency of
endotoxin tolerance correlated with 8-fold decreases in the bioactive
p40/p35 heterodimeric form of IL-12. In contrast, total circulating
IL-12 p40 was reduced by only 30–50%. Endotoxin-tolerant mice were
less responsive to IL-12 than control mice, as evidenced by 3-fold
lower levels of IFN- inducible in vivo when rIL-12 was administered
at the time of endotoxin challenge. Similarly, spleen cell cultures of
endotoxin-tolerant mice produced 3-fold less IFN- in the presence of
optimal concentrations of both IL-12 and IL-18. Finally, levels of
IL-12R ß2 subunit mRNA and the percent composition of NK lymphocytes
in the spleen were both decreased in endotoxin-tolerant mice relative
to controls. We conclude that endotoxin-tolerant mice are profoundly
impaired in their ability to produce IFN- in response to endotoxin
and that this is associated with acquired defects in both the
production of circulating IL-12 heterodimer response and the response
to IL-12 by NK cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1ß, and
IL-6 3, 4, 5 . The model of endotoxin tolerance assumes broader
importance through its similarity to other forms of injury-induced
immune paralysis, including the immunologic sequelae of thermal injury
and major surgery 6, 7 .
IFN- deficiency may play a central role in the pathophysiology of
immune paralysis. Thermally injured mice underproduce IFN- 7 , and
we hypothesized that similar perturbations in IFN- synthesis may
occur in endotoxin tolerance. The production and biologic significance
of IFN- in the response to acute endotoxemia have been previously
characterized. Circulating IFN- appears at 
6 h after endotoxin
challenge, and this proinflammatory cytokine contributes significantly
to endotoxic mortality 8, 9 . Pretreatment with anti-IFN- Ab
significantly decreases mortality from endotoxic shock in mice,
suggesting that decreased IFN- production would protect against
LPS-induced death in endotoxin-tolerant hosts as well.
Endotoxin-induced IFN- is largely produced by NK lymphocytes in
response to TNF-, IL-12, and IL-18 present in the serum several
hours earlier in the course of endotoxemia 10, 11, 12 .
Of these IFN- stimulatory cytokines, IL-12 was of particular
interest in our studies, due to its crucial regulatory function in the
synthesis of IFN- during endotoxemia. The bioactivity of IL-12 is
mediated by a disulfide-linked heterodimer of p35 and p40 subunits that
are products of different genes located on separate chromosomes 13 .
Both subunits must be produced within the same cell to form IL-12
heterodimer. Heterodimeric IL-12 migrates with an apparent m.w. of 70
kDa on SDS-PAGE and is referred to as IL-12 p70. Unassociated IL-12 p40
is also produced during endotoxemia in 100-fold excess over
heterodimer and consists of monomers that are inactive and a smaller
population of p40 homodimers that antagonize IL-12 bioactivity by
competing for receptor binding 14 . The different regulation of the
synthesis of IL-12 heterodimer and free p40 is not fully understood.
Experimental evidence favors both control through expression of p40
15 , in which case IL-12 p70 and p40 production change in parallel, or
through controlled induction of the p35 gene by IFN- 16 . Once
produced, IL-12 bioactivity is mediated by the binding of IL-12 p70 to
high-affinity IL-12R that are themselves heterodimers of ß1 and ß2
subunits and that are expressed on NK cells or activated T cells 17 .
In this study, we used the mouse model of endotoxin tolerance to
confirm that IFN- production is decreased in the tolerized state and
to test the hypothesis that this reflects specific defects in the
production of IL-12. Unexpectedly, we also identified a decreased
response to IL-12, both in vivo and in vitro, that could not be
restored by provision of the costimulatory cytokine IL-18 and that
might be linked to reduced numbers of NK cells in endotoxin-tolerant
mice. These studies provide new insights into how molecular and
cellular defects within the IL-12/IFN- cascade contribute to the
heightened resistance of endotoxin-tolerant mice to LPS-induced
pathology. Because similar defects in clinically related forms of
immune paralysis may paradoxically enhance susceptibility to infectious
diseases, these studies may be useful in the rational design of
anti-infective immunotherapy tailored to postsepsis or traumatized
hosts.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Four- to six-wk-old female C3H/HeOuJ and C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and housed in Case Western University animal center under specific pathogen-free conditions.
Cytokine reagents and Abs
Mouse rIL-12 (sp. act., 2.1 x 108 Roche U/mg;
endotoxin-free) provided by Hoffmann-LaRoche (Nutley, N.J.) was used
for in vitro studies. For in vivo use, rIL-12 (sp. act., 1.1 x
108 Roche U/mg) was produced by serum-free culture of IL-12
p35/p40-transfected Chinese hamster ovary (CHO) cells (Genetics
Institute, Cambridge, MA) and purified by sequential MonoQ (Pharmacia,
Piscataway, NJ) and heparin affinity chromatography as described
18 . Endotoxin-free rIL-18 (sp. act., 8.3 x 104
U/mg) was purchased from Antigenix (Franklin Square, NY).
Salmonella enteritidis LPS (Sigma, St. Louis, MO) was
dissolved in calcium/magnesium-free HBSS, sonicated for 1 min, filter
sterilized, and stored at -20°C. Endotoxin-free rTNF- (sp. act.,
1 x 107 U/mg) was purchased from Genzyme (Cambridge,
MA).
Induction of endotoxin tolerance
Mice were injected i.p. daily for 2 days with 50 µg of
S. enteritidis LPS in 300 µl of sterile HBSS. Forty-eight
hours after the last dose, control and tolerized mice were injected
i.p. with a challenge dose of 300 µg of LPS in 300 µl of HBSS. Sera
were obtained after endotoxin challenge at times corresponding to peak
levels of TNF- (1 h), IL-12 p40 and p70 (4 h), and IFN- (6 h).
ELISA for murine cytokines
Serum TNF-, IL-12 p40, IL-12 p70, and IFN- were measured
by ELISA as described 14 . Mouse IL-18 was measured by a polyclonal Ab
sandwich ELISA using for capture Ab goat IgG specific for C-terminal
sequences of mouse IL-18 (L-19; Santa Cruz Biotechnology, Santa Cruz,
CA). The detection Ab was biotinylated IgG generated from rabbits
(Rockland, Gilbertsville, PA) immunized with full-length mouse IL-18
produced from recombinant Escherichia coli. This ELISA
detected the mature IL-18 polypeptide (rIL-18; Antigenix) in a linear
fashion from 20 to 0.3 ng/ml.
IFN- production by cultured splenocytes in response to rIL-12,
rIL-18, and TNF-
Spleen cells were obtained from control and LPS-tolerant mice,
lysed with ACK lysis buffer (0.15 M NH4Cl, 1.0 mM
KHCO3, 0.1 mM EDTA (pH 7.4)) and washed three times with
calcium/magnesium-free HBSS-1% FBS. Cells were resuspended in TCM
(DMEM/RPMI 1640, 0.1 mM nonessential amino acids, 60 µg/ml
arginine hydrochloride, 10 mM HEPES, 2 mM glutamine,
penicillin/streptomycin)-1% Nutridoma NS (Boehringer-Mannheim,
Indianapolis, IN) and cultured at a density of one million cells per
0.1 ml in medium containing rIL-12 and rIL-18 at doses ranging from 0
to 1 ng/ml and 0 to 10 ng/ml, respectively. In a separate set of
experiments, cells from control and tolerized animals were preincubated
with TNF- at a concentration of 0.5 ng/ml, and IL-12 and/or IL-18
were then added to the cells as previously described. Supernatants were
harvested at 48 h and assayed for IFN- by specific ELISA.
RT-PCR and Northern blot analysis of splenic mRNA
Spleens were harvested at designated times, and RNA was isolated using STAT-60 (TelTest, Friendswood, TX). Northern blot analyses were performed using 32P-labeled anti-sense RNA probes to hybridize with specific messages as described 10 . For RT-PCR analysis, cDNA was obtained by reverse transcription of oligo(dT)-primed RNA and semiquantitative PCR performed using oligonucleotide primers as previously described 10 . For detection of IL-12R ß2 subunit mRNA, the following 5' to 3' sequence of sense and antisense primers were used respectively: GCACAGACTGTTAGAGAATGC and CCTTCCTGGACACATGATATG.
FACScan analysis of NK cells
Spleen cell suspensions from control and tolerized mice were
harvested as described above. PBMC were harvested by density
centrifugation of 1 ml of heparinized blood through 2 ml of
Lympholyte-M (Accurate Chemical, Westbury, NY) at 1500 x
g for 30 min. After washing three times in
Ca/Mg++-free HBSS and resuspension in HBSS/1% FBS, cells
were incubated 30 min with 2.4G2 anti-FcR MAb at 4°C followed by
a 1 h incubation with FITC-labeled -CD3 and -B220 (Caltag
Laboratories, South San Francisco, CA), combined with
phycoerythrin-labeled anti-NK Ab (DX5; PharMingen, San Diego, CA)
at 4°C. Cells were washed three times with HBSS/1% FBS and
fixed in 1% formalin before analysis by FACScan (Becton Dickinson
Immunocytometry Systems, Mountain View, CA). Fluorescence data was
obtained on 5 x 103 cells using FL1 and FL2
channels and logarithmic amplification.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IFN- production are decreased in response to LPS in
endotoxin-tolerant mice
We confirmed that two daily injections of 50 µg of LPS were
sufficient to reproduce a classic endotoxin tolerance phenotype defined
by 3- to 6-fold reductions in peak serum TNF- levels at 1 h
after a 300-µg challenge dose of LPS delivered on day 4 of the
protocol. Central to the hypothesis of this study, we also observed 5-
to 6-fold decreases in serum IFN- at 6 h after endotoxin
challenge (Table I
). Decreased IFN-
levels, ranging from 2- to 6-fold, were reproduced in seven separate
experiments using either C3H/HeOuJ or C57BL/6 mice. Decreased serum
levels of TNF- and IFN- following endotoxin challenge in tolerant
mice were accompanied by marked decreases in steady state levels of
splenic mRNA encoding TNF-, IFN-, and IL-1ß, consistent with
pretranslational inactivation as the mechanism for underproduction
(Fig. 1). It is unlikely that decreased
IFN- levels reflected altered kinetics of synthesis, as RT-PCR
analysis of spleen RNA at either 4 or 6 h after LPS challenge
showed a similar lack of IFN- message (data not shown).
|
|
The role of IL-12 as a stimulatory signal for IFN-
production by NK cells in the mouse model of acute endotoxemia has been
well described. Therefore, we measured levels of circulating bioactive
IL-12 heterodimer at 4 h after LPS challenge in control and
endotoxin-tolerant mice. Endotoxin-tolerant C3H/HeOuJ and C57BL/6 mice
generated 5- to 8-fold less IL-12 p70 4 h after a challenge dose
compared with control mice (Table II). We
also measured serum levels of total IL-12 p40, which are normally in
100-fold excess over that of IL-12 p70 during endotoxemia and which
change in parallel with heterodimer concentrations. Unexpectedly, IL-12
p40 levels in endotoxin-tolerant C3H/HeOuJ and C57BL/6 mice were
reduced by only 38% and 32%, respectively, compared with endotoxemic
controls (Table II). In three other studies, p40 was reduced by
30–50%. These observations indicate that endotoxin tolerance uniquely
dissociates the in vivo production of IL-12 p70 and IL-12 p40 in
response to a systemic inflammatory challenge. Splenic expression of
IL-12 p35, which is constitutive following endotoxemia 10 , was
comparable in control and endotoxin-tolerant mice in a preliminary
experiment. We were consequently unable to ascertain a role for
decreased p35 production in the deficient heterodimer response (data
not shown). Minor differences in IL-12 p35 expression might have been
obscured by constitutive transcription of this mRNA by splenic B cells,
as previously described 19, 20
|
To test whether the lack of IL-12 bioactivity was the sole defect
leading to the diminished IFN- response of endotoxin tolerance, we
attempted to restore IFN- production by treatment with rIL-12 at the
time of the LPS challenge. Mice were tolerized as before and injected
on day 4 with 300 µg of LPS alone or in combination with 5 µg of
rIL-12 by i.p. injection. In pilot studies, this dose of rIL-12
produced circulating levels of IL-12 p70 at 4 h after injection
that were up to 100-fold greater than that generated endogenously in
response to endotoxemia (56 ng/ml compared with 0.5–1.0 ng/ml). In
these experiments, rIL-12 injections approximately doubled the serum
levels of IFN- in endotoxemic control and tolerized mice compared
with mice receiving endotoxin only (p < 0.05).
However, the maximal IFN- response of rIL-12-treated
endotoxin-tolerant mice remained significantly decreased (3-fold;
p < 0.05) relative to the control group (Fig. 2). These findings indicated that
endotoxin tolerance, in addition to disabling IL-12 heterodimer
release, also results in decreased responsiveness in vivo to saturating
quantities of IL-12.
|
or neutralizing
anti-IL-10 Ab
Previous studies have shown an important costimulatory role for
IL-18 in the IL-12-dependent induction of IFN- during acute
endotoxemia 12 . Hypothesizing that a lack of IL-18 in endotoxin
tolerance would adversely affect the in vivo induction of IFN-, we
studied the IFN- response of spleen cells cultured with optimal
concentrations of rIL-12 and rIL-18. Using endotoxin-free conditions,
splenocytes from control mice showed increasing production of IFN-
in the presence of combined rIL-12 and rIL-18 (Fig. 3). As previously described, IL-18 did
not induce IFN- in the absence of IL-12. However, the spleens of
endotoxin-tolerant mice demonstrated a plateau in IFN- production
that was nearly 3-fold reduced (p < 0.05)
compared with that generated by control splenocytes in response to the
same concentrations of rIL-12 and rIL-18. TNF-, which is a necessary
costimulus for IFN- production in other experimental models 21 ,
did not significantly augment IFN- synthesis when used with optimal
concentrations of IL-12 and IL-18 (1 and 3 ng/ml, respectively).
Endotoxin-tolerant spleen cultures produced IFN- that peaked at 195
and 120 ng/ml in the absence and presence of 200 U/ml of rTNF-,
respectively. These levels were again 2-fold reduced compared with
control splenocytes that peaked at 338 and 329 ng/ml of IFN- in the
absence and presence of added rTNF-.
|
by control and tolerized splenocytes cultured with IL-12 (1
ng/ml) and IL-18 (3 ng/ml) was unaffected by the addition of
anti-IL-10 mAb (10 µg/ml). Control spleen cells produced
IFN- levels of 148.1 vs 155.5 ng/ml in the absence and presence of
anti-IL-10 mAb, respectively; whereas, endotoxin-tolerant cells
produced 60 and 44.3 ng/ml of IFN- for the same stimulatory
conditions. However, it is likely that spleen cells were exposed to
IL-10 during the tolerization protocol, and these studies do not
exclude prior effects of IL-10 leading to the observed tolerance
phenotype. Decreased expression of IL-12R ß2 subunit mRNA in endotoxin-tolerant spleen
Since IL-12 heterodimer mediates bioactivity by binding to
functional IL-12R that are heterodimers of ß1 and ß2 subunits, we
compared expression of IL-12R subunit mRNA in control and tolerized
spleen. IL-12 ß1 was constitutively expressed (data not shown), a
finding consistent with the ubiquitous expression of this subunit
without relation to IFN- synthesis 13, 17 . In contrast, expression
of the ß2 subunit is highly restricted to NK cells and activated T
cells and the subunit most involved in signal transduction events
necessary for IFN- synthesis in these cells 19, 20 . When analyzed
by RT-PCR IL-12R ß2 mRNA was reduced 5-fold in the spleens of
tolerized mice compared with controls (Fig. 4). Consistent with a general lack of
IL-12 responsiveness by endotoxin-tolerant mice, LPS-induced IFN-
mRNA levels present in the spleen at 6 h after endotoxemia were
11-fold lower than in control mice and failed to normalize after
treatment with 5 µg of rIL-12.
|
NK cells produce 90% of IL-12-dependent IFN- produced by the
spleen during inflammation 23 and are strongly IL-12R ß2 mRNA
positive in normal spleen. Therefore, we examined whether the decreases
in both IL-12 responsiveness and IL-12R expression noted in
endotoxin-tolerant spleen might be due to reductions in the size of the
NK cell population. Consistent with this, two-color flow cytometry of
control and tolerized spleen cells showed 3-fold decreases in the
percent of CD3-, B220- spleen cells
expressing the pan-NK marker recognized by DX5 mAb 24 . NK cells
constituted 7.3% and 2.2% of control and endotoxin-tolerant
splenocytes, respectively, in C3H/HeOuJ mice (Fig. 5) and 4.6% and 1.3% in control and
tolerized spleens of C57BL/6 mice. Furthermore, NK cells were found to
be underrepresented in the peripheral blood of endotoxin-tolerant
C57BL/6 mice, accounting for 10.6% of total PBMC compared with 26.2%
in the peripheral blood of control mice. Significant reductions in the
numbers of NK cells per spleen remained after accounting for the nearly
50% increase in total spleen cell numbers in endotoxin-tolerant mice.
Endotoxin-tolerance related reductions in NK cells per spleen were
calculated as 1.96- and 1.98-fold for C57BL/6 and C3H/HeOuJ mice,
respectively.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a cytokine with well-characterized
proinflammatory effects and normally an important mediator of endotoxic
pathology in a model of endotoxin tolerance. We further identify
specific deficiencies in circulating IL-12 heterodimer, representing
the loss of an important stimulatory signal for IFN- production by
NK cells that, by itself, might be sufficient to mediate the observed
IFN- synthetic defect. However, we provide evidence supporting
additional defects in IL-12 responsiveness manifested by the NK cell
population responsible for endotoxin-induced IFN- production.
Specifically, the 3-fold reduction in the maximal IFN- response of
endotoxin-tolerant splenocytes was not corrected by synergistic
combinations of IL-12, IL-18, and TNF-, arguing against IL-18 or
TNF- deficiencies as major factors in this specific
endotoxin-tolerant phenotype. Instead, reduced splenic IL-12R
expression and NK cell numbers were observed in endotoxin-tolerant
animals that were proportional to the decreases in IFN-
synthetic capacity. These novel findings describe a multiply
dysfunctional IL-12/IFN- cascade in the setting of endotoxin
tolerance. This disruption of the innate cellular immune response
likely contributes to the protective effects of endotoxin
tolerance against lethal endotoxemia.
In these studies, we used a murine model of endotoxin tolerance that
has been previously characterized for diminished mortality following
injection with normally fatal doses of endotoxin and associated with
marked reductions in TNF- synthesis, as well as other monokines,
including IL-1 and IL-6 2, 5 . We confirmed that injection with 50
µg of LPS on two successive days reproduced the TNF- synthetic
defect. We also demonstrate for the first time 2- to 6-fold decreases
in circulating IFN- following endotoxin challenge of tolerant mice.
Furthermore, diminished serum IFN- levels were associated with
decreased levels of IFN- mRNA consistent either with a
pretranslational block or, as determined in these studies, a relative
lack of cells capable of transcribing IFN- message. Because
decreased IFN- mRNA was observed in endotoxin-tolerant spleen
harvested at 4 and 6 h after endotoxin challenge, the measured
differences in circulating IFN- are unlikely to reflect altered
kinetics of synthesis. In preliminary studies, defective IFN-
synthesis did not extend to responses induced by T cell polyclonal
activators, such as anti-CD3 or Staphylococcal enterotoxin B (data
not shown). This suggested that the defect was limited to the IL-12/NK
cell/IFN- cascade central to the "innate" cellular immune
response.
In this regard, the 5-fold or greater decrease in circulating IL-12
heterodimer following LPS challenge in endotoxin-tolerant mice provided
at least one lesion in this cascade that could lead to suboptimal
stimulation of IFN- synthesis by NK cells. Deficient IL-12 p70 was
observed in two separate mouse strains, including the C3H/HeOuJ strain
that produced larger amounts of LPS-induced IL-12 and IFN- compared
with the C57BL/6 mice also used in these studies. The greater IL-12
response to endotoxin of C3H/HeOuJ mice has been previously described
10 . An unexpected finding was that circulating IL-12 p40 induced by
endotoxin challenge was only reduced by 30–50%, compared with control
mice, in the setting of endotoxin tolerance. This may provide a novel
in vivo model in which the synthesis of IL-12 p70 is apparently limited
by the availability of p35 protein in the synthesizing cell and not by
regulated induction of the p40 gene.
The basis for this dissociated production of different forms of IL-12 could be molecular or cellular. The former might represent specific down-regulation of p35 gene expression in the macrophage or dendritic cell populations that are the normal source of IL-12 in endotoxemia. Unfortunately, preliminary analysis of IL-12 p35 mRNA expression in whole spleen was complicated by the constitutive expression of this gene in normal splenic B-lymphocytes. Alternative approaches will need to be explored that permit the in vivo analysis of p35 expression by specific accessory cell subsets. Alternatively, the cellular source of IL-12 production may be shifted in endotoxin tolerance to a cell type less capable of producing IL-12 p70. For instance, LPS exposure reportedly depletes dendritic cells in numerous tissues over a 48-h period 3 . However, a preliminary FACS analysis of splenic accessory cells 72 h after endotoxin priming failed to show decreased numbers of dendritic cells, which we defined by expression of a CD11chigh and CD11bint immunofluorescent phenotype 25 . Further studies are needed to distinguish which of these molecular and cellular mechanisms are involved in the selective IL-12 heterodimer deficiency of endotoxin tolerance.
We next addressed whether IL-12 deficiency alone was sufficient to
explain the defective IFN- response in endotoxin tolerance.
Treatment with rIL-12 at the time of LPS challenge, in doses designed
to exceed endogenous IL-12 levels by at least 100-fold, induced levels
of IFN- that were 3-fold decreased from that of control mice
similarly challenged with LPS and rIL-12. The lack of IL-12
responsiveness was similar when analyzed by IFN- mRNA expression in
the spleens of these animals at 6 h after LPS and rIL-12
injections. These findings were reproduced in a spleen culture system
in which IFN- synthesis remained deficient even in the presence of
optimally synergistic combinations of IL-18, IL-12, and TNF-. This
suggested that deficient IL-18 was not etiologic in the decreased
IL-12-dependent IFN- response observed. Consistent with this,
preliminary studies of serum IL-18 by ELISA demonstrated that serum
levels of IL-18, ranging from 2 to 3 ng/ml, were unchanged in control
and tolerized C3H/HeOuJ mice both before and after endotoxin challenge
(data not shown). Furthermore, we could not identify a specific
inhibitory role for IL-10 produced concurrently with IL-12 in cultures
of splenocytes from control and endotoxin-tolerant mice. Endotoxin-free
conditions were used in this bioassay to minimize confounding effects
that might be mediated by disparate production of other LPS-inducible
cytokines.
A potential explanation for IL-12 unresponsiveness included defective
IL-12R expression on the NK cells responsible for IFN- production
during endotoxemia. The IL-12R ß2 subunit was specifically studied
because expression is limited to the population of NK and activated T
cells that are the source of IFN- in the spleen. This receptor gene
was underexpressed by 4- to 5-fold relative to control spleen. This
finding in turn led to the recognition of a 3-fold reduced NK cell
population in tolerized spleen. Although increased numbers of
myelomonocytic cells in endotoxin-tolerant spleen may have provided a
dilutional effect, the calculated number of NK cells per spleen
remained reduced at 2-fold compared with controls. Further studies are
required to determine whether this represents redistribution of NK
cells to other organs, which should not have affected the systemic
IFN- response to IL-12, or a generalized depletion of this cell
type. Relevant to this possibility, cytokine-induced apoptosis of
cultured human NK cells has been previously described 26 . Apoptotic
NK cell depletion may therefore represent a potentially unique
mechanism for limiting inflammatory pathology in vivo and deserves
further investigation.
Taken together, these findings implicate multiple defects in the
cytokine and cellular cascade leading up to IFN- production in
endotoxin-tolerant mice. Some of these, such as the specific
down-regulation of circulating IL-12 heterodimer and apparent depletion
of NK cells in endotoxin-tolerant spleen, suggest unique
counterregulatory responses relevant to the recovery from bacterial
sepsis and other systemic inflammatory states. In this regard, the
etiology of the disrupted IL-12/NK/IFN- cascade in
endotoxin-tolerant animals may resemble the development of clinical
states of immunosuppression that follow thermal or surgical injury and
that are characterized by similar cytokine abnormalities 6, 8 . Our
findings may also be relevant to the apparent increase in
susceptibility to infection associated with injury-induced immune
paralysis. This may be consistent with the protective functions of
IL-12 and IFN- previously described in experimental models of
bacterial infection 27, 28, 29, 30 . In preliminary studies, we have similarly
shown that endotoxin-tolerant mice sustain a 2–4 log increase in
visceral CFU of Candida albicans following i.v. infection
(our unpublished data). The further analysis of molecular and cellular
defects in the innate cellular immune response of endotoxin-tolerant
mice are indicated and may lead to insights addressing the therapeutic
reversal of injury-related immune defects that might otherwise enhance
host susceptibility to common nosocomial pathogens.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hanan Balkhy, Division of Pediatric Infectious Diseases, Rainbow Babies and Children’s Hospital, 11100 Euclid Street, Cleveland, OH 44106-5000.
Received for publication August 31, 1998. Accepted for publication December 15, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-independent production of interleukin-12 during murine endotoxemia. J. Immunol. 157:4521.[Abstract]
receptor deficient mice are resistant to endotoxic shock. J. Exp. Med. 179:1437. interferon. Infect. Immun. 62:4244. production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
-inducing factor and regulates LPS-induced IFN- production. Nature 386:619.[Medline]
production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041. in vivo. Int. Immunol. 6:157. as a mediator of the lethality of endotoxin and tumor necrosis factor-. J. Immunol. 149:1666.[Abstract]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
T cell development and early thymocyte maturation in IL-7-/- mice. J. Immunol. 157:2366.[Abstract]
-inducing factor) regulates early cytokine production in, and promotes resolution of, bacterial infection in mice. J. Immunol. 160:299. production in NK cells and CD4+ T cells. J. Immunol. 156:1458.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  M. Wysocka, L. J. Montaner, and C. L. Karp Flt3 Ligand Treatment Reverses Endotoxin Tolerance-Related Immunoparalysis J. Immunol., June 1, 2005; 174(11): 7398 - 7402. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Gould, J. A. Greene, V. Bhoj, J. L. DeVecchio, and F. P. Heinzel Distinct Modulatory Effects of LPS and CpG on IL-18-Dependent IFN-{gamma} Synthesis J. Immunol., February 1, 2004; 172(3): 1754 - 1762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. W. Murray, C. M. Lu, E. B. Brooks, R. E. Fichtl, J. L. DeVecchio, and F. P. Heinzel Modulation of T-Cell Costimulation as Immunotherapy or Immunochemotherapy in Experimental Visceral Leishmaniasis Infect. Immun., November 1, 2003; 71(11): 6453 - 6462. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. W. Murray, E. B. Brooks, J. L. DeVecchio, and F. P. Heinzel Immunoenhancement Combined with Amphotericin B as Treatment for Experimental Visceral Leishmaniasis Antimicrob. Agents Chemother., August 1, 2003; 47(8): 2513 - 2517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Schroder, C. Meisel, K. Buhl, N. Profanter, N. Sievert, H.-D. Volk, and G. Grutz Different Modes of IL-10 and TGF-{beta} to Inhibit Cytokine-Dependent IFN-{gamma} Production: Consequences for Reversal of Lipopolysaccharide Desensitization J. Immunol., May 15, 2003; 170(10): 5260 - 5267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. D. Joshi, D. V. Kalvakolanu, J. D. Hasday, R. J. Hebel, and A. S. Cross IL-18 Levels and the Outcome of Innate Immune Response to Lipopolysaccharide: Importance of a Positive Feedback Loop with Caspase-1 in IL-18 Expression J. Immunol., September 1, 2002; 169(5): 2536 - 2544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. K. Varma, T. E. Toliver-Kinsky, C. Y. Lin, A. P. Koutrouvelis, J. E. Nichols, and E. R. Sherwood Cellular Mechanisms That Cause Suppressed Gamma Interferon Secretion in Endotoxin-Tolerant Mice Infect. Immun., September 1, 2001; 69(9): 5249 - 5263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysocka, S. Robertson, H. Riemann, J. Caamano, C. Hunter, A. Mackiewicz, L. J. Montaner, G. Trinchieri, and C. L. Karp IL-12 Suppression During Experimental Endotoxin Tolerance: Dendritic Cell Loss and Macrophage Hyporesponsiveness J. Immunol., June 15, 2001; 166(12): 7504 - 7513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Salkowski, K. E. Thomas, M. J. Cody, and S. N. Vogel Impaired IFN-{gamma} Production in IFN Regulatory Factor-1 Knockout Mice During Endotoxemia Is Secondary to a Loss of Both IL-12 and IL-12 Receptor Expression J. Immunol., October 1, 2000; 165(7): 3970 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Verbon, N. P. Juffermans, P. Speelman, S. J. H. van Deventer, I. J. M. ten Berge, H.-J. Guchelaar, and T. van der Poll A Single Oral Dose of Thalidomide Enhances the Capacity of Lymphocytes to Secrete Gamma Interferon in Healthy Humans Antimicrob. Agents Chemother., September 1, 2000; 44(9): 2286 - 2290. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Pagenstecher, A. K. Stalder, C. L. Kincaid, B. Volk, and I. L. Campbell Regulation of Matrix Metalloproteinases and Their Inhibitor Genes in Lipopolysaccharide-Induced Endotoxemia in Mice Am. J. Pathol., July 1, 2000; 157(1): 197 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Rayhane, C. Fitting, and J.-M. Cavaillon Dissociation of IFN-{gamma} from IL-12 and IL-18 production during endotoxin tolerance Innate Immunity, October 1, 1999; 5(5-6): 319 - 324. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
