The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riegert, P.
Right arrow Articles by Gilfillan, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riegert, P.
Right arrow Articles by Gilfillan, S.
The Journal of Immunology, 1999, 162: 3471-3480.
Copyright © 1999 by The American Association of Immunologists

A Conserved Sequence Block in the Murine and Human TCR J{alpha} Region: Assessment of Regulatory Function In Vivo1

Patricia Riegert and Susan Gilfillan2

The Basel Institute for Immunology, Basel, Switzerland


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Temporal control of rearrangement at the TCR {alpha}/{delta} locus is crucial for development of the {gamma}{delta} and {alpha}ß T cell lineages. Because the TCR {delta} locus is embedded within the {alpha} locus, rearrangement of any V{alpha}-J{alpha} excises the {delta} locus, precluding expression of a functional {gamma}{delta} TCR. Approximately 100 kb spanning the C{delta}-C{alpha} region has been sequenced from both human and mouse, and comparison has revealed an unexpectedly high degree of conservation between the two. Of interest in terms of regulation, several highly conserved sequence blocks (>90% over >50 bp) were identified that did not correspond to known regulatory elements such as the TCR {alpha} and {delta} enhancers or to coding regions. One of these blocks lying between J{alpha}4 and J{alpha}3, which appears to be conserved in other vertebrates, has been shown to augment TCR {alpha} enhancer function in vitro and differentially bind factors from nuclear extracts. To further assess a plausible regulatory role for this element, we have created mice in which this conserved sequence block is either deleted or replaced with a neomycin resistance gene driven by the phosphoglycerate kinase promoter (pgk-neor). Deletion of this conserved sequence block in vivo did have a local effect on J{alpha} usage, echoing the in vitro data. However, its replacement with pgk-neor had a much more dramatic, long range effect, perhaps underscoring the importance of maintaining overall structure at this locus.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Two distinct lineages of T cells develop in perhaps all jawed vertebrates 1 , distinguished almost exclusively by the type of TCR they express, {gamma}{delta} or {alpha}ß. How these two lineages are developmentally related has been extensively studied, particularly in mice. During ontogeny, {gamma}, {delta}, and ß gene rearrangement occurs several days before {alpha} rearrangement; hence, {gamma}{delta}-expressing cells can be detected around fetal day 14, whereas {alpha}ß cells are not evident until days 17 or 18 2, 3 . A similar, albeit compressed, pattern of rearrangement occurs in the adult thymus, as {gamma}, {delta}, and ß rearrangements occur during an immature CD4-CD8- double-negative stage, whereas significant {alpha} rearrangements are not detected until the more mature CD4+/CD8+ double-positive (DP)3 stage of development 4, 5, 6, 7, 8, 9 . This temporal regulation is critical, because the {delta} locus lies within the {alpha} locus 10, 11, 12 , thus rearrangement of any V{alpha} to any J{alpha} excises the {delta} locus, precluding expression of a {gamma}{delta} receptor. Therefore, understanding how rearrangement at the {alpha}/{delta} locus is regulated may be relevant to lineage commitment and maintenance in general as well as to TCR gene rearrangement and transcription in particular.

The {alpha}/{delta} locus itself is huge, spanning approximately 1 megabase; 90% of the locus, the 5' region, contains the V{alpha} and {delta} gene segments, while a 100-kb 3' region contains (5' to 3') the D{delta}, J{delta}, C{delta}, J{alpha}, and C{alpha} segments 13, 14 . Sixty-one J{alpha} segments have been identified in humans, and 59 closely related homologues are present in the mouse 15, 16, 17 . Approximately 100 V{alpha} gene segments, belonging to 20 distinct subfamilies, are dispersed in clusters, which appear to have been created by duplication of a primordial block during evolution 13, 14, 18 . Some V segments are used by both {alpha}ß and {gamma}{delta} T cells and are distributed throughout the locus, whereas four bona fide V{delta} segments are located at the 3' end of the {alpha} region; one resides 3' of C{delta} and, uniquely, rearranges by inversion rather than excision of intervening sequence 19 .

Following VDJ{delta}, rearrangement of the V{alpha}s to J{alpha}s occurs sequentially from the most proximal to the most distal segments (3' to 5' in the V locus and 5' to 3' in the J 7, 20, 21 and continues until a functional receptor is produced and the T cell is positively selected; this event shuts down expression of at least two genes required for rearrangement, RAG-1 and RAG-2 22, 23 . Early during ontogeny the repertoire is skewed, with most T cells expressing {alpha}-chains composed of the more proximal 3' V{alpha}s and 5' J{alpha}s; in adult mice the pattern changes, and all segments, including the distal 5' V{alpha}s and 3' J{alpha}s, are used 24, 25, 26, 27 . This may be due to differential regulation or simply time; adult thymocytes mature more slowly (3–4 days vs 2 days) and hence have more time to undergo secondary rearrangements 26 . Rearrangement is not random but appears to occur in defined blocks, with discrete regions of the J{alpha} locus being open at a given time. There is apparently no allelic exclusion at the {alpha} locus, and both alleles rearrange simultaneously, usually to the same region along the J{alpha} locus 28, 29, 30 . Two VJC{alpha} messages can be transcribed, and in some cases both chains are expressed on the cell surface 31, 32, 33 .

How is this complex process controlled? Although the same RAG-1- and RAG-2-dependent, site-specific recombination mechanism is used for all Ig and TCR rearrangements, each locus is clearly differentially regulated. Alt and colleagues originally proposed that regulation of the VDJ recombination is determined by accessibility; only genes with chromatin in an accessible open configuration can serve as substrates for recombination 34, 35, 36 . Accessibility is generally defined by transcription, DNase hypersensitivity, and changes in DNA methylation. Numerous cis regulatory elements apparently controlling accessibility have been defined within the {alpha}/{delta} locus. Among the most important and well characterized are the {delta} and {alpha} enhancers, E{delta} and E{alpha}.

E{delta} lies between J{delta}2 and C{delta} and is highly conserved between man and mouse 37, 38 , particularly binding sites for the transcription factors c-Myb, CBF/PEBP2, and GATA-3. Analysis of a number of transgenic mice carrying chromosomally integrated recombination substrates has shown that a 1.4-kb fragment containing E{delta} is required for VD{delta} to J{delta} rearrangement, but not for V{delta} to D{delta} rearrangement. Paralleling normal T cell development, a minilocus containing E{delta} rearranges on approximately day 14.5 during ontogeny. However, its activity is not lineage specific, as E{delta}+ substrates rearrange equally in {gamma}{delta} and {alpha}ß T cells 3, 39 . Located approximately 3 kb 3' of C{alpha} exon 4, E{alpha} (like E{delta}) is highly conserved between mouse and man 16, 40, 41 . Fragments containing either the mouse or the human E{alpha} confer both correct temporal and lineage-specific rearrangement patterns to artificial minilocus rearrangement constructs in transgenic mice 3, 42 . Production of mice in which a 1.1-kb fragment containing E{alpha} was deleted using homologous recombination in ES cells unequivocally demonstrated that E{alpha} is necessary for most V{alpha}-J{alpha} rearrangement 43 . More unexpectedly, it is also required for high level expression of complete VDJC{delta} transcripts as well as sterile germline transcripts originating along the J{alpha} locus. Thus, remarkably, the E{alpha} exerts its effects over a distance of 70–80 kb.

Clearly, E{delta} and E{alpha} play major roles in conferring accessibility at the {alpha}/{delta} locus. This is not without precedent, as deletion of the TCR ß enhancer completely inhibits VDJß rearrangement 44, 45 , and several enhancers are involved in rearrangement, class switching, and expression at the Ig loci 36 . However, the problem of progressive rearrangement remains: why isn’t the entire locus open at once? One definitive focusing element within the J{alpha} locus has been most extensively characterized by de Villartay and colleagues. The transcription early {alpha} (TEA) element resides just 5' of the J{alpha}s and gives rise to sterile transcripts that are expressed during T cell maturation just before V{alpha} gene rearrangement 9, 46, 47, 48 . Creation of mice lacking a 2.3-kb fragment containing the TEA element has shown that this element is required for rearrangement of V{alpha}s to the nine most 5' J{alpha}s (J{alpha}53-J{alpha}61) 49 , demonstrating a direct relationship between TEA transcription and accessibility to a particular block of J{alpha}s. What controls accessibility of the J{alpha}s further downstream remains an intriguing question. Numerous other sterile transcripts originate along the locus, and some may fulfill this function 50 .

Of great interest in terms of further dissecting regulation at this locus, the 100-kb 3' region containing C{delta}-C{alpha} (including the entire J{alpha} cluster) has been completely sequenced from both mouse and man 15, 17, 51 . Comparison revealed an extraordinary degree of conservation (~71% similarity between the two) 16 . As noted by Koop and Hood 16 , this contrasts sharply with comparisons made between other large sequenced regions, including the ß-globin gene cluster, the {gamma} crystalline gene cluster, the Ig µ/{delta} constant gene region, and the TCR ß V region, for which overall structure is not highly conserved between species. The high degree of conservation throughout the C{delta}-C{alpha} region suggests that its overall structure is critical, perhaps for correct regulation of rearrangement and transcription. As expected, most of the previously identified regulatory elements, including the {delta} and {alpha} enhancers, are conserved. Interestingly, numerous peaks of homology (90% and greater) do not coincide with coding or known regulatory sequences and are candidates for as yet unknown regulatory functions.

One of these blocks, designated a conserved sequence block (CSB), was identified in initial comparisons of human and mouse genomic {alpha}/{delta} sequences 15 . It was originally defined as a 232-bp fragment containing a 125-bp segment with 95% homology and a 50-bp segment 90% conserved, located approximately 5 kb 5' of C{alpha} exon 1 between J{alpha}3 and J{alpha}4. This degree of conservation is high even for this locus; for comparison, the human and mouse E{alpha}s share 84% homology over 240 bp (95% over a 50-bp region), and the E{delta}s are 70% homologous over a 370-bp region (80% over a 30-bp region) 16 . In addition, zoo blot analysis using the CSB as a probe suggests that this sequence may be conserved in other vertebrates. Kuo et al. 52 have recently reported evidence for possible regulatory functions of this block; when placed in tandem with the C{alpha} enhancer, the 125-bp CSB fragment augmented transcription around 2-fold in in vitro transfection assays, although it had no effect on its own. Moreover, this fragment does contain binding motifs for transcription factors known to be involved in lymphoid differentiation, including GATA and PU.1, and differentially binds factors from nuclear extracts, some of which appear to be lymphoid and/or T cell specific.

Given these data, it seems plausible that this CSB may contribute to regulation of the {alpha}/{delta} locus at either the rearrangement or the expression level. To assess this possibility in vivo, we have generated mice in which a 394-bp fragment containing these blocks of homology is either deleted or replaced with a neomycin resistance gene driven by the phosphoglycerate kinase promoter (pgk-neor). Analysis of these mice shows that deletion of this CSB does have a local effect on J{alpha} usage, probably due to decreased transcription. In addition, replacement of the CSB by pgk-neor has more dramatic effects on J{alpha} usage that extend over 20 kb of the locus.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Generation of mice lacking the CSB

The sequence of the C{delta}-C{alpha} region (GenBank accession no. M64239) was used to design oligos (listed in Table IGo) and the targeting construct. {lambda} clones containing the CSB region were obtained by screening a 129/Sv genomic library (Stratagene, La Jolla, CA) with a PCR-generated fragment containing C{alpha} exons 1–3. A 6.9-kb BamHI fragment subcloned into pBluescript was used to replace a 394-bp FokI-SacI fragment containing the CSB with the pgk-neor gene flanked by loxP sites (provided by Dr. P. Kastner, Institut de Génétique et de Biologie Moléculaire et Cellulaire, Strasbourg, France). The construct was either linearized with NotI or excised from the plasmid with BamHI and purified by gel electrophoresis. Fifteen to seventeen micrograms of the targeting construct was electroporated into 1 x 107 E14 embryonic stem (ES) cells 53 (provided by Dr. T. Miyazaki) with 400 V and 125 µF using a Gene Pulser (Bio-Rad, Richmond, CA). After 24–48 h cells were grown in G-418 sulfate, and resistant clones were picked after 6–8 days. Colonies were expanded in duplicate; one set was frozen in 24-well plates, and the other was used to isolate DNA.


View this table:
[in this window]
[in a new window]
  		Table I. Primers used

 
Clones containing a targeted allele were identified by Southern blot analysis using a 3' external probe; positive clones were confirmed with a 5' external probe, multiple digests, and internal probes. In the initial experiment using a linearized plasmid for electroporation, 1 of 187 clones was correctly targeted, whereas 9 of 136 correctly targeted clones were obtained in a second electroporation using the purified BamHI fragment. One clone was injected into blastocysts from which chimeras were produced, bred to C57BL/6 (B6) mice, and transmitted the mutant allele. Mice carrying the mutation were either intercrossed or bred with transgenic deleter mice expressing the cre recombinase under the CMV promoter very early during ontogeny 54 . The pgk-neor gene was efficiently deleted in all mice carrying the cre transgene. Mice were typed by Southern blot analysis or a PCR assay that distinguished all three genotypes using the oligos (5'-3') GATCGTGCCAATGACCAGAGCG, CGATATCAAGCTTATCGATACCG, AGCCTCGCTTGAAAGCACTGAG, and GAGATCAGCAGCCTCTGTTCC.

Cytofluorometric analysis

Anti-{gamma}{delta} (GL3)-FITC or -bio, anti-CD4-phycoerythrin, anti-CD8-Cychrome, anti-V{alpha}2-FITC, and anti-V{alpha}8-FITC were obtained from PharMingen (San Diego, CA). Anti-TCR ß (H57-597) 55 and anti-CD3{epsilon} (KT3) 56 were purified from culture supernatants and biotinylated or FITC conjugated. Thymus, lymph node, and spleen cell suspensions were prepared and stained essentially as described previously 57 . Cells were passed on a FACScan, and data were analyzed using CellQuest software (Becton Dickinson, Mountain View, CA).

DNA extraction, Southern blots

DNA was extracted from thymocyte cell suspensions, tail, kidney, and liver by proteinase K digestion (200 µg/ml in 50 mM Tris (pH 7.5), 50 mM EDTA, 0.5% SDS, and 0.2 M NaCl) for 24–48 h at 55°C followed by phenol/chloroform extraction and ethanol precipitation. DNA was resuspended at 1–2 µg/µl in 10 mM Tris (pH 7.5) and 0.1 mM EDTA.

Quantitative Southern blots using probes distributed along the J{alpha} region were conducted essentially as described by Petrie et al. 7 . Four probes distributed along the J{alpha} cluster were amplified using the oligos described previously 7 and subcloned into pBluescript. Five to ten micrograms of thymocyte and control DNA was digested with BamHI and HindIII, run on 0.9% agarose gels, and transferred to Zeta-Probe GT genomically tested blotting membranes (Bio-Rad) in 0.4 N NaOH. Membranes were neutralized in 2x SSC, prehybridized for 1–3 h, then hybridized with the four J{alpha} probes in Expresshyb solution (Clontech, Palo Alto, CA) for 3–12 h at 65°C. Membranes were stripped by submerging in boiling 0.1% SDS in H2O, then cooling to room temperature (twice). To normalize signal intensity for each sample, membranes were rehybridized with either a 300-bp fragment containing E{alpha} or a fragment spanning C{alpha} exons 3 and 4. Signal intensity was quantified using a PhosphorImager with ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The percentage of remaining signal intensity for each J{alpha} probe was determined using kidney, liver, or ES cell DNA as controls as follows: [(signal intensity of J{alpha} probe for thymic DNA/signal intensity of control probe for same sample)/(signal intensity of J{alpha} probe for control tissue/signal intensity of control probe for same sample)] x 100.

Long range PCR (LR PCR)

Primers complementary to the initial 30 bp of a number of J{alpha} segments distributed along the locus were tested using thymocyte DNA as a template with primers recognizing the V{alpha}3 and V{alpha}2 families (see Table IGo) using the Expand Long Template PCR System from Boehringer Mannheim (Indianapolis, IN), essentially following the manufacturer’s instructions. Briefly, each reaction contained 250 ng of thymocyte DNA (diluted to 50 ng/µl in H2O and heated to 65°C for 0.5 h before use), 15 pmol of each primer, 500 mM of each dNTP, 0.25 µl of the Taq Pwo enzyme mix, and 1x buffer 3 (2.25 mM MgCl2 with detergents) in a total volume of 50 µl. Amplification was conducted in thin-walled PCR tubes (Boehringer Mannheim) using the following conditions: 2 min at 93°C; 10 cycles of 93°C for 10 s, 65°C for 30 s, and 68°C for 12 min; 20 cycles of 93°C for 10 s, 65°C for 30 s, and 12 min for 68°C with a 20-s extension per cycle; and a final extension for 15 min at 68°C. A set of primers that consistently generated ladders of fragments up to 10 kb and almost completely covered the J{alpha} locus was used to amplify thymocyte DNA from CSB+/+, CSBn/n, and CSB-/- mice. PCR products were run on 1% agarose gels and transferred to Hybond N+ (Amersham) membranes, and each set was probed with a [{gamma}-32P]ATP-labeled oligo specific for the J{alpha} immediately 5' to that used for the amplification (see Table IGo). Controls included DNA isolated from E14 ES cells and tail tissue.

Isolation of RNA, RT-PCR, and sequencing analysis

RNA was isolated from thymus and lymph nodes using LiCl/urea essentially as described previously 58 , and cDNA was prepared from 2 µg of total thymus RNA using oligo(dT) and AMV reverse transcriptase (Pharmacia, Piscataway, NJ). V{alpha}2,3 and 10 V-J-C fragments were separately amplified using the V{alpha} and C{alpha} exon 3 primers listed in Table IGo. For allele-specific amplification, B6- and 129-specific C{alpha} exon 4 oligos were used with the V{alpha}3 primer. Amplification was conducted under standard conditions (1.5 mM MgCl2) using 5 µl of cDNA and 25 pmol of each primer in a 50-µl total volume: 94°C for 5 min; 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. For sequencing, fragments were purified as described previously 59 , filled in with T4 DNA polymerase (Pharmacia), phosphorylated with T4 polynucleotide kinase (New England Biolabs, Beverley, MA) 60 , and blunt-cloned into pBluescript that had been linearized with EcoRV and dephosphorylated with calf intestinal phosphatase (New England Biolabs). Minipreps were sequenced on an ABI 373XL DNA sequencer (Perkin-Elmer/Applied Biosystems, Foster City, CA) using ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kits with AmpliTaq DNA polymerase (Perkin-Elmer) according to the manufacturer’s instructions. Data were analyzed using ABI PRISM sequencing analysis, Fractura, and Sequence Navigator software (all from Perkin-Elmer).

For blots, duplicate gels were prepared using 3–4 µl of the PCR reaction/lane; DNA was transferred to Hybond N+ membranes (Amersham), and each blot was sequentially probed with several of the J{alpha}-specific oligos listed in Table IGo, with the control C{alpha} exon 1 oligo to normalize signal intensity, and with the C{alpha} exon 2 129-specific oligo as a final control. Hybridizations were conducted at 55–60°C, and blots were washed at high stringency for each oligo. Between each hybridization, blots were stripped by incubating the membranes at 50°C in 0.4 N NaOH and 2x SSC for 1 h, then briefly submerged in boiling H2O/0.1% SDS and cooled to room temperature. Stripping was confirmed by exposing the membranes to film or PhosphorImager screen before rehybridization. In total, the hybridization signal intensity for 29 J{alpha}-specific oligos was obtained and quantitated using a PhosphorImager. Relative J{alpha} usage in mutant mice was normalized to that in wild-type mice as follows: [(J{alpha} signal intensity from mutant mice/C{alpha}1 signal intensity from mutant mice)/(J{alpha} signal intensity CSB+/+ mice/C{alpha}1 signal intensity CSB+/+ mice)] x 100. Hybridization signals from control 129 and B6 mice were included and also normalized to the CSB+/+ animals. For allele-specific PCR, signal intensity was normalized to the B6 allele: [(J{alpha} signal intensity 129 allele/C{alpha}1 signal intensity of 129 allele)/(J{alpha} signal intensity of B6 allele/C{alpha}1 signal intensity of B6 allele)] x 100. (129 x B6)F1 mice served as controls for this experiment.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation of CSB deletion and pgk-neor replacement mice

The targeting construct included approximately 7 kb of homologous sequence with the selectable marker (pgk-neor) flanked by loxP sites (Fig. 1Go). Mice generated with this construct (designated CSBn/+) were intercrossed to produce homozygotes (CSBn/n) or were bred to transgenic mice expressing the cre recombinase under the CMV promoter very early during embryogenesis 54 to delete the pgk-neor gene and produce mice homozygous for the CSB deletion (CSB-/-). All possible genotypes were analyzed in this study, and breeding was conducted so that all mutant alleles (CSBn or-) were 129/Ola-derived and wild-type (W+) B6. Mice with and without the cre transgene were included to ensure that cre expression created no additional artifacts.



View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 1. Structure of the endogenous locus and targeting construct. J{alpha}s are represented by black arrows and are numbered (J{alpha}3 and J{alpha}1 are pseudogenes). CSBn/n mice contain pgk-neor oriented opposite to VJC{alpha} transcription, as shown in the targeting construct. The 126 bp of exogenous sequence remaining after excision of pgk-neor by the cre recombinase in CSB-/- mice is shown below.

 
The mutant (CSB-/- and CSBn/n) mice were phenotypically normal, healthy, and bred well. FACS analysis of thymus, lymph node, and spleen cells revealed no major perturbations in {alpha}ß or {gamma}{delta} T cell development; numbers were similar to those in CSB+/+ littermates, and peripheral cell surface expression of at least two V{alpha} families (no. 2 and 8) was similar in mutant and control mice. In all CSBn/n mice analyzed, however, fewer DP thymocytes expressed intermediate levels of TCR ß (Fig. 2Go). Because the increase in TCR ß cell surface expression from low to intermediate at the DP stage reflects replacement of pT{alpha} with real V-JC{alpha}-chain, these data suggested that {alpha}-chain expression might be somewhat impaired in the CSBn/n animals.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. Representative FACS analysis of thymocytes from CSB+/+, CSB-/-, and CSBn/n mice. CD4/CD8 staining is shown on the left, and TCR ß expression is shown on the right; the percentages of thymocytes expressing low and intermediate levels of TCR ß are indicated.

 
V{alpha}-J{alpha} rearrangement

Two methods that allow rearrangement along the J{alpha} locus to be both quantitatively and qualitatively assessed were employed. Initially, Southern blots prepared with thymocyte and control DNA were hybridized with four probes that effectively divide the J{alpha} cluster into equal regions 7 to assess the extent of rearrangement in adult (>5 wk of age) mutant and W+ mice (Fig. 3GoA). By normalizing the signal intensity for each J{alpha} region probe, then comparing the normalized signal intensity for each J{alpha} probe obtained using thymocyte DNA with that from control tissue (kidney, liver, or E14 cells), the percentage of control signal remaining in thymocyte DNA gives a quantitative assessment of rearrangement along the locus. Because {alpha} rearrangement is progressive, extensive rearrangement is observed at the 5' end of the locus, whereas much less is evident at the most 3' end in normal mice. By these criteria, rearrangement quite clearly occurred in all types of mice, with progressive rearrangement observed along the J{alpha} cluster in CSB+/+ and CSB-/- mice (Fig. 3GoB). In CSBn/n mice, however, the typical progressive pattern was not as evident; rearrangement appeared to be suppressed across the center portion of the J{alpha} cluster and overall more focused toward the 3' quarter of the locus (flanking the CSB).



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 3. Quantitative Southern blot analysis. A, Representative blot of control (kidney, liver, or ES cell) and thymocyte DNA from the mice noted. The probes are identical to those described by Petrie et al. (7), but are designated 1–4 for clarity; their positions along the J{alpha} locus, shown in B, are: 1 = 19,330, 2 = 42,417, 3 = 61,978, and 4 = 78,400. Probe 4 lies close to the CSB insertion/deletion; hence, the sizes of those fragments hybridizing to it are different in the three types of mice. C{alpha}, control probe spanning C{alpha} exons 3–4. B, Compiled data (from the blot shown) with a scaled diagram of the locus. The location of each probe is designated. Band intensities were quantitated on a PhosphorImager and normalized as described in Materials and Methods.

 
To look at J{alpha} accessibility in a more qualitative manner, a LR PCR assay was developed that allowed rearrangement to almost every J{alpha} within the cluster to be visualized. Primers specific for the V{alpha}2 and V{alpha}3 families were tested with a series of primers distributed along the J{alpha} locus, most homologous to the initial 30 bp of various J{alpha}s. As indicated in Fig. 4Go, the J{alpha}s are designated according to Koop et al. 17 , numbered 61 to 1, moving 5' to 3' along the locus (J{alpha}s 8 and 10 are not present in the mouse 16). Because the initial 3–5 bp of each J{alpha} is usually removed during the rearrangement process, these oligos should not preferentially amplify the very short V-J{alpha} primer fragment. A set of primers was identified that consistently amplified ladders of up to 10 kb when using thymocyte DNA as template, but amplified nothing with control E14 or tail DNA. PCR products were blotted and probed with a labeled oligo specific for the adjacent 5' J{alpha}. In each case the major bands corresponded to the sizes expected for 5' V-J products; in addition, a blot prepared from products amplified using the primer located between J{alpha}12 and J{alpha}13 was sequentially hybridized with seven 5' J{alpha} probes to ensure that all bands represented the expected V{alpha}-J{alpha} rearrangement (data not shown). Thymocyte DNA samples from three CSB+/+, CSBn/n, and CSB-/- mice were amplified with a V{alpha}3 primer and the J{alpha} primers shown in Fig. 4Go (listed in Table IGo). In total, rearrangement to at least 40 J{alpha}s was observed in this assay, and all were accessible in each type of mouse. This experiment was repeated using a V{alpha}2 primer and thymocyte DNA from CSB+/+ and CSBn/n mice; again, no major differences were observed (data not shown).



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 4. J{alpha} rearrangement assessed by LR PCR. A scaled diagram of the J{alpha} cluster (20–90 kb) shows the J{alpha}s, each designated by a vertical line. A primer specific for members of the V{alpha}3 family was used in conjunction with the J{alpha} and intronic oligos indicated (* in the scaled diagram, J{alpha} number noted above each blot). Each experiment included two control DNA samples (E14 and tail) and thymocyte DNA from three CSB+/+, CSBn/n, and CSB-/- mice (as shown above the J{alpha}4 blot). Each blot was hybridized with an oligo specific for the J{alpha} immediately 5' to that used for amplification (see Table IGo). The J{alpha} rearrangements detected in this assay are designated on the left of each blot (identified according to the expected sizes of the bands). C, control DNA.

 
Expression and J{alpha} usage

To assess total {alpha}-chain expression, Northern blots were prepared using thymus and lymph node RNA. Comparison of TCR {alpha} with ß message showed an approximate 40% decrease in total {alpha} message in thymocytes from CSBn/n mice; however, lymph node expression was similar in all three types of animals (data not shown).

To look at J{alpha} usage, we initially sequenced a large number of V-J-C{alpha} fragments amplified from total thymus RNA isolated from CSB+/+ and CSB-/- mice using primers for the V{alpha}2, -3, and -10 families; this established the relative frequency of J{alpha} usage in the two types of animals (Fig. 5Go) and also allowed identification of B6/129 polymorphisms. Of the 59 J{alpha}s identified in mice, at least 20 are probably pseudogenes. In line with this, we obtained sequences of 43 different J{alpha}s from CSB-/- and CSB+/+ mice, of which 12 were polymorphic. At least one of the apparent differences in expression, that of J{alpha}23, is probably due to polymorphism rather than manipulating the CSB: a single nucleotide change in the J{alpha}23 sequenced from CSB-/- thymocytes (derived from 129) introduces a stop codon in the 129 allele. This probably accounts for the low frequency of this message in the CSB-/- animals, as messages with stop or nonsense codons are known to be strongly down-regulated in lymphocytes 61 . This polymorphism was confirmed by sequencing J{alpha}23 amplified from E14 DNA (the 129/Ola ES cell line from which the mice were derived).



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 5. Frequency of J{alpha} usage in VJC fragments amplified from CSB+/+ and CSB-/- thymocyte RNA. Each plot includes six datasets. Initially, V{alpha}2, V{alpha}3, and V{alpha}10 primers were used separately to amplify VJC fragments from 6-wk-old CSB+/+ and CSB-/- mice; 40–50 of each type were cloned and sequenced. A second set for each V{alpha} primer was amplified, cloned, and sequenced using thymocyte RNA isolated from other adult CSB+/+ and CSB-/- animals.

 
In addition to the marked difference in J{alpha}23 expression, the overall J{alpha} distributions obtained from the sequencing data (Fig. 5Go) suggested that there might be other differences in J{alpha} usage between W+ and mutant animals. To assess this in a number of animals (as well as B6 and 129 controls to distinguish strain differences) we used a semiquantitative assay based on that originally described by Villey et al. 49 . For this analysis, we amplified V{alpha}2, -3, and -10 VJC fragments from thymus RNA derived from five each of CSB+/+, CSBn/n, CSBn/-, and CSB-/- mice as well as two B6 and 129/Ola controls. PCR products were run on duplicate gels and blotted, and membranes were sequentially probed with several J{alpha}-specific oligos; in total, expression of 29 J{alpha}s was assessed for each sample. Each blot was probed with a C{alpha}1-specific oligo to normalize signal intensities and, finally, with a C{alpha}2 129-specific oligo to ensure that all amplified fragments were derived from the correct allele. A representative blot is shown in Fig. 6GoA, and compiled data are presented in Fig. 6GoC, where normalized signal intensities are expressed as a percentage of the CSB+/+ mice.



View larger version (72K):
[in this window]
[in a new window]
  		FIGURE 6. J{alpha} usage. A, VJC{alpha} fragments were amplified from thymocyte RNA (from five CSB+/+, CSB-/-, CSBn/-, and CSBn/n) mice using primers specific for the V{alpha}3, V{alpha}2, and V{alpha}10 families (each separately) with a C{alpha} primer (see Table IGo). PCR products were run on gels and blotted, and filters were sequentially probed with a total of 29 J{alpha}-specific oligos, a C{alpha} oligo specific for a 129 polymorphism in exon 2 (C{alpha}129), and a control C{alpha} primer. Representative blots of PCR products obtained with the V{alpha}3 primer are shown. B, 129 and B6 alleles were separately amplified using the V{alpha}3 primer with C{alpha} primers designed based on a polymorphism in exon 4 (see Table IGo); B6 or 129 above each lane designates which oligo was used for amplification. Controls on the left demonstrate that the amplification is specific; the B6 oligo only amplified VJC products from B6- and W+-derived cDNA, whereas the 129 primer only amplified fragments from 129 and mutant (CSB- or CSBn) cDNA. Results from heterozygous B6/129 F1 (controls), CSBn/+, and CSB-/+ amplifications are shown on the right. Below, hybridization with the C{alpha}129-specific oligo confirms that the correct alleles were amplified. Again, 29 J{alpha}s were used for hybridization, and representative blots are shown. C, Hybridization intensities were quantitated using a PhosphorImager and were normalized to those from CSB+/+ mice as described in Materials and Methods; compiled data are shown for each V{alpha}. The numbers represent kilobases along the locus, and the CSB is designated by an arrow. D, Compiled data from the heterozygote (F1) experiment is shown in more detail; the relative expression of every J{alpha} assessed is shown. In this case expression of the 129 allele was normalized to that of the B6 in each mouse.

 
As expected, B6 and CSB+/+ J{alpha} expression patterns were quite similar, whereas 129/Ola mice had a distinct distribution, mirroring that seen in the CSB-/- sequencing data. In particular, J{alpha}23 expression was very low in all 129-derived samples. In the CSB-/- animals, J{alpha} usage paralleled that seen in 129/Ola animals except for those J{alpha} segments flanking the CSB deletion; expression of J{alpha}4 was diminished 2-fold in comparison with that in B6 and 129 mice, and J{alpha}2 usage was similar to that in W+ littermates but was less than that in the 129/Ola controls. In contrast, replacement of the CSB with pgk-neor had a dramatic effect on J{alpha} usage. In CSBn/n animals there was a striking increase in J{alpha}2 usage. Intriguingly, J{alpha}4 usage was normal, yet there was a profound decrease in expression in the J{alpha}s immediately upstream. This suppression was most marked for J{alpha}5 and gradually tapered off over a 20-kb distance (upstream of J{alpha}26; see Fig. 6Go).

To confirm that these effects were imposed in cis, we compared J{alpha} expression from W+ and mutant alleles within heterozygote animals. B6 and 129-derived V{alpha}3-JC fragments were separately amplified from thymus RNA isolated from three CSBn/+ and three CSB-/+ mice using oligos differentially hybridizing to a polymorphic segment of C{alpha} exon 4 (see Table IGo). For this experiment thymus RNA isolated from two wild-type B6/129 F1 offspring of an E14 chimera generated for a different study served as the control. As described above, duplicate blots were sequentially probed with J{alpha}-specific oligos and controls. Representative blots are shown in Fig. 6GoB, and compiled data are presented in Fig. 6GoD; in this case normalized signal intensities are expressed as a percentage of the B6 allele (seeMaterials and Methods).

Again, J{alpha} expression of the CSB- 129 allele was quite similar to that of the W+ 129 allele from the E14/B6 control except for a 35–40% reduction in J{alpha}4. Thus, deleting the CSB does have a very local cis effect on expression of flanking J{alpha}s, the most significant being the approximate 2-fold decrease in expression of J{alpha}4, which lies 300 bp 5' to the deletion. In addition, the CSBn 129 allele was clearly expressed very differently from the B6 or W+ 129 allele, and the pattern mirrored that seen in CSBn/n mice: a striking increase in J{alpha}2 usage, normal expression of J{alpha}4, and a profound decrease in expression in the J{alpha}s immediately upstream that gradually tapers off over a 20-kb distance. These data confirmed that insertion of pgk-neor acts in cis and affects J{alpha} expression up to 20 kb along the locus. Because all the J{alpha}s within this 20-kb region are clearly accessible (rearrangement to each of them was evident in the LR PCR assay; Fig. 4Go), much of this specific suppression of J{alpha} usage probably occurs at the transcriptional level.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Clearly, deletion of this CSB has only a subtle effect on V{alpha}-J{alpha} rearrangement and expression. The 2-fold decrease in J{alpha}4 expression in CSB-/- mice is, however, very consistent with the in vitro data indicating that the CSB augments E{alpha} activity ~2-fold 52 . Our results suggest that the CSB may also augment E{alpha} activity in vivo, but only over a relatively short distance (300–400 bp). The CSB may be one of several redundant regulatory elements, or perhaps it primarily serves a structural role. Because this CSB is only one of several highly conserved blocks along the locus, it is possible that they collectively contribute to a specific chromatin structure. Indeed, that the entire locus is highly conserved suggests that maintaining a particular overall structure is essential. If this is the case, deleting a single homology block would not be expected to (and seemingly does not) have a major effect on the entire organization. In this respect, the effects seen in the CSBn/n mice are quite intriguing.

Merely inserting a resistance gene driven by any one of several promoters into a locus can have dramatic effects on both transcription and rearrangement 44, 62, 63, 64, 65, 66, 67, 68 . Although this has been well documented in several systems, the pgk-neor insertion at this locus has allowed a more detailed analysis of these effects, which may help define the underlying mechanism. Replacement of the CSB with pgk-neor in opposite orientation to V-J{alpha} transcription (so that it should not interfere directly with VJC{alpha} messages) does at least two things: it introduces a constitutively open chromatin configuration where the CSB normally resides, and it introduces the pgk promoter, which may compete for transcription factors 62, 63, 67 . Both could contribute to the results seen, but the most plausible interpretation of our data is as follows.

1) The insertion of a constitutive promoter may focus more rearrangement to the J{alpha}s immediately flanking it (in this case J{alpha}2 and J{alpha}4; J{alpha}3 and J{alpha}1 are pseudogenes); this is consistent with the quantitative Southern blot data. In addition, because J{alpha}2 lies 3' to the CSB, any rearrangement to J{alpha}2 will delete the CSB (or pgk-neo insertion in CSBn mice); thus, the huge increase in J{alpha}2 usage observed on the CSBn allele must be due to increased rearrangement rather than transcription. Notably, this insertion of pgk-neor does not dramatically repress rearrangement along the J{alpha} cluster, as has been observed in similar replacements of the Ig{kappa} intronic and heavy chain enhancers 63, 64, 65, 66 .

2) J{alpha}4 lies within 300 bp of pgk-neor; because this region is already in a transcriptionally active configuration, expression of V{alpha}s rearranged to J{alpha}4 is efficient. However, just 2 kb upstream of the insertion, V{alpha} segments rearranged to J{alpha}5 (easily detected in the LR PCR assay) are barely expressed, perhaps because forming a transcriptionally open structure is inhibited by the constitutively open pgk-neor downstream. This suppressive effect extends for 20 kb along the locus (to J{alpha}26) and decreases with distance from the pgk-neo insertion. Relative expression of J{alpha}s in the region 5' to J{alpha}26 is normal. Interestingly, Fiering et al. noted a very similar effect after replacing a DNase-hypersensitive site in the ß-globin LCR with pgk-neor 67 . In this case, transcription of the globin gene closest to pgk-neor decreased 10-fold, and those further away decreased 2-fold. Although competition was invoked as the most likely explanation for their observations, it is difficult to interpret our results in the same way; given the relatively high expression of V{alpha}s rearranged to J{alpha}4 immediately flanking the pgk-neor insertion, disruption of the chromatin structure seems a more likely candidate for the suppressive effects seen further upstream.

3) Suppressing expression of functional messages from J{alpha}26–5 in the CSBn/n thymocytes probably forces even more rearrangement to J{alpha}2 as thymocytes attempt to make a functional {alpha}-chain. Because J{alpha}2 is apparently selected against (i.e., is detected at lower levels in lymph node than in thymus RNA from W+ and mutant mice; data not shown) the heavy reliance on this particular J{alpha} in the CSBn/n mice may contribute to the inefficient T cell maturation evident in the FACS analysis (Fig. 1Go).

In summary, this CSB does not appear to play a major independent regulatory role in the {alpha}/{delta} locus. However, the high degree of conservation of this locus remains intriguing, and it seems plausible that the conserved sequence blocks along the locus do contribute to regulation, perhaps by providing a structural context that helps guide regulatory elements, including the enhancers and TEA. As the overall structure appears to be more critical than individually conserved elements, experiments designed to introduce specific structural changes along the locus may be more informative than focusing on the roles of individual conserved sequence blocks.


   Acknowledgments
 
We thank Dr. P. Kastner (Institut de Génétique et de Biologie Moléculaire et Cellulaire, Strasbourg, France) for a plasmid containing pgk-neor flanked by loxP sites; Dr. K. Rajewsky (Cologne, Germany) for the Cre transgenic deleter mice, Dr. T. Miyazaki for a subclone of E14 ES cells; U. Mueller for blastocyst injection; E. Wagner, W. Metzger, and colleagues for superb mouse care; J. Koeck for contributing to the sequencing analysis; M. Kuhn for technical assistance; Dr. C. Steinberg for statistical advice; W. Marston for helpful editing; and Drs. F. McBlane, K. Karjalainen, and M. Colonna for critically reading the manuscript.


   Footnotes
 
1 The Basel Institute for Immunology was founded and is supported by Hoffmann-La Roche Ltd. (Basel, Switzerland). Back

2 Address correspondence and reprint requests to Dr. Susan Gilfillan, The Basel Institute for Immunology, Grenzacherstrasse 487, CH 4005 Basel, Switzerland. E-mail address: Back

3 Abbreviations used in this paper: DP, double positive; RAG, recombinase-activating gene; E{delta}, T cell receptor {delta} enhancer; E{alpha}, T cell receptor {alpha} enhancer; TEA, transcription early {alpha}; CSB, conserved sequence block; ES, embryonic stem; pgk-neor, neomycin resistance gene driven by the phosphoglycerate kinase promoter; B6, C57BL/6; LR PCR, long range PCR; W+, wild type. Back

Received for publication September 9, 1998. Accepted for publication December 17, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rast, J. P., M. K. Anderson, S. J. Strong, C. Luer, R. T. Litman, G. W. Litman. 1997. {alpha}, ß, {gamma}, and {delta} T cell antigen receptor genes arose early in vertebrate phylogeny. Immunity 6:1.[Medline]
  2. Fowlkes, B. J., D. M. Pardoll. 1989. Molecular and cellular events of T cell development. Adv. Immunol. 44:207.[Medline]
  3. Lauzurica, P., M. Krangel. 1994. Temporal and lineage-specific control of T cell receptor {alpha}/{delta} gene rearrangement by T cell receptor {alpha} and {delta} enhancers. J. Exp. Med. 179:1913.[Abstract/Free Full Text]
  4. Dudley, E., M. Girardi, M. Owen, A. Hayday. 1995. {alpha}ß and {gamma}{delta} T cells can share a late common precursor. Curr. Biol. 5:659.[Medline]
  5. Godfrey, D. I., J. Kennedy, P. Mombaerts, S. Tonegawa, A. Zlotnik. 1994. Onset of TCR-ß gene rearrangement and role of TCR-ß expression during CD3-CD4-CD8- thymocyte differentiation. J. Immunol. 152:4783.[Abstract]
  6. Passoni, L., E. S. Hoffman, S. Kim, T. Crompton, W. Pao, M. Q. Dong, M. J. Owen, A. C. Hayday. 1997. Intrathymic {delta} selection events in {gamma}{delta} cell development. Immunity 7:83.[Medline]
  7. Petrie, H. T., F. Livak, D. Burtrum, S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production. J. Exp. Med. 182:121.[Abstract/Free Full Text]
  8. Tourigny, M. R., S. Mazel, D. B. Burtrum, H. T. Petrie. 1997. T cell receptor (TCR)-ß gene recombination: dissociation from cell cycle regulation and developmental progression during T cell ontogeny. J. Exp. Med. 185:1549.[Abstract/Free Full Text]
  9. Wilson, A., J. P. de Villartay, H. R. MacDonald. 1996. T cell receptor {delta} gene rearrangement and T early {alpha} (TEA) expression in immature {alpha}ß lineage thymocytes: implications for {alpha}ß/{gamma}{delta} lineage commitment. Immunity 4:37.[Medline]
  10. Hockett, R. D., J. P. de Villartay, K. Pollock, D. G. Poplack, D. I. Cohen, S. J. Korsmeyer. 1988. Human T-cell antigen receptor (TCR) {delta}-chain locus and elements responsible for its deletion are within the TCR {alpha}-chain locus. Proc. Natl. Acad. Sci. USA 85:9694.[Abstract/Free Full Text]
  11. Chien, Y., M. Iwashima, K. Kaplan, J. Elliott, M. Davis. 1987. A new T-cell receptor gene located within the {alpha} locus and expressed early in T-cell differentiation. Nature 327:677.[Medline]
  12. Satyanarayana, K., S. Hata, P. Devlin, M. Roncarolo, J. De Vries, H. Spits, J. Strominger, M. Krangel. 1988. Genomic organization of the human T-cell antigen-receptor {alpha}/{delta} locus. Proc. Natl. Acad. Sci. USA 85:8166.[Abstract/Free Full Text]
  13. Jouvin-Marche, E., I. Hue, P. N. Marche, C. Liebe-Gris, J. P. Marolleau, B. Malissen, P. A. Cazenave, M. Malissen. 1990. Genomic organization of the mouse T cell receptor V {alpha} family. EMBO J. 9:2141.[Medline]
  14. Wang, K., J. L. Klotz, G. Kiser, G. Bristol, E. Hays, E. Lai, E. Gese, M. Kronenberg, L. Hood. 1994. Organization of the V gene segments in mouse T-cell antigen receptor {alpha}/{delta} locus. Genomics 20:419.[Medline]
  15. Koop, B. F., R. K. Wilson, K. Wang, B. Vernooij, D. Zallwer, C. L. Kuo, D. Seto, M. Toda, L. Hood. 1992. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C{alpha}/C{delta} region. Genomics 13:1209.[Medline]
  16. Koop, B. F., L. Hood. 1994. Striking sequence similarity over almost 100 kilobases of human and mouse T-cell receptor DNA. Nat. Genet. 7:48.[Medline]
  17. Koop, B. F., L. Rowen, K. Wang, C. L. Kuo, D. Seto, J. A. Lenstra, S. Howard, W. Shan, P. Deshpande, L. Hood. 1994. The human T-cell receptor TCRAC/TCRDC (C{alpha}/C{delta}) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]
  18. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
  19. Iwashima, M., A. Green, M. Davis, Y. Chien. 1988. Variable region (V{delta}) gene segment most frequently utilized in adult thymocytes is 3' of the constant (C{delta}) region. Proc. Natl. Acad. Sci. USA 85:8161.[Abstract/Free Full Text]
  20. Takeshita, S., M. Toda, H. Yamagishi. 1989. Excision products of the T cell receptor gene support a progressive rearrangement model of the {alpha}/{delta} locus. EMBO J. 8:3261.[Medline]
  21. McCormack, W. T., M. Liu, C. Postema, C. B. Thompson, L. A. Turka. 1993. Excision products of TCR V{alpha} recombination contain in-frame rearrangements: evidence for continued V(D)J recombination in TCR+ thymocytes. Int. Immunol. 5:801.[Abstract/Free Full Text]
  22. Turka, L. A., D. G. Schatz, M. A. Oettinger, J. J. Chun, C. Gorka, K. Lee, W. T. McCormack, C. B. Thompson. 1991. Thymocyte expression of RAG-1 and RAG-2: termination by T cell receptor cross-linking. Science 253:778.[Abstract/Free Full Text]
  23. Brandle, D., C. Muller, T. Rulicke, H. Hengartner, H. Pircher. 1992. Engagement of the T-cell receptor during positive selection in the thymus down-regulates RAG-1 expression. Proc. Natl. Acad. Sci. USA 89:9529.[Abstract/Free Full Text]
  24. Thompson, S. D., J. Pelkonen, M. Rytkonen, J. Samaridis, J. L. Hurwitz. 1990. Nonrandom rearrangement of T cell receptor J{alpha} genes in bone marrow T cell differentiation cultures. J. Immunol. 144:2829.[Abstract]
  25. Thompson, S. D., A. R. Manzo, J. Pelkonen, M. Larche, J. L. Hurwitz. 1991. Developmental T cell receptor gene rearrangements: relatedness of the {alpha}/ß and {gamma}/{delta} T cell precursor. Eur. J. Immunol. 21:1939.[Medline]
  26. Roth, M. E., P. O. Holman, D. M. Kranz. 1991. Nonrandom use of J{alpha} gene segments: influence of V{alpha} and J{alpha} gene location. J. Immunol. 147:1075.[Abstract]
  27. Rytkonen, M. A., J. L. Hurwitz, S. D. Thompson, J. Pelkonen. 1996. Restricted onset of T cell receptor {alpha} gene rearrangement in fetal and neonatal thymocytes. Eur. J. Immunol. 26:1892.[Medline]
  28. Thompson, S. D., J. Pelkonen, J. L. Hurwitz. 1990. First T cell receptor {alpha} gene rearrangements during T cell ontogeny skew to the 5' region of the J{alpha} locus. J. Immunol. 145:2347.[Abstract]
  29. Hurwitz, J. L., J. Samaridis, J. Pelkonen. 1989. Immature and advanced patterns of T cell receptor gene rearrangement among lymphocytes in splenic culture. J. Immunol. 142:2533.[Abstract]
  30. Rytkonen, M., J. L. Hurwitz, K. Tolonen, J. Pelkonen. 1994. Evidence for recombinatorial hot spots at the T cell receptor J{alpha} locus. Eur. J. Immunol. 24:107.[Medline]
  31. Hardardottir, F., J. Baron, J. Janeway CA. 1995. T cells with two functional antigen-specific receptors. Proc. Natl. Acad. Sci. USA 92:354.[Abstract/Free Full Text]
  32. Padovan, E., G. Casorati, P. Dellabona, S. Meyer, M. Brockhaus, A. Lanzavecchia. 1993. Expression of two T cell receptor {alpha} chains: dual receptor T cells. Science 262:422.[Abstract/Free Full Text]
  33. Malissen, M., J. Trucy, E. Jouvin-Marche, P. A. Cazenave, R. Scollay, B. Malissen. 1992. Regulation of TCR {alpha} and ß gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
  34. Yancopoulos, G., F. Alt. 1985. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40:271.[Medline]
  35. Yancopoulos, G., F. Alt. 1986. Regulation of the assembly and expression of variable-region genes. Annu. Rev. Immunol. 4:339.[Medline]
  36. Sleckman, B. P., J. R. Gorman, F. W. Alt. 1996. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14:459.[Medline]
  37. Redondo, J., S. Hata, C. Brocklehurst, M. Krangel. 1990. A T cell-specific transcriptional enhancer within the human T cell receptor {delta} locus. Science 247:1225.[Abstract/Free Full Text]
  38. Gill, L. L., D. Zaninetta, K. Karjalainen. 1991. A transcriptional enhancer of the mouse T cell receptor {delta} gene locus. Eur. J. Immunol. 21:807.[Medline]
  39. Lauzurica, P., M. S. Krangel. 1994. Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor {delta} transgene. J. Exp. Med. 179:43.[Abstract/Free Full Text]
  40. Ho, I. C., L. H. Yang, G. Morle, J. M. Leiden. 1989. A T-cell-specific transcriptional enhancer element 3' of C{alpha} in the human T-cell receptor {alpha} locus. Proc. Natl. Acad. Sci. USA 86:6714.[Abstract/Free Full Text]
  41. Winoto, A., D. Baltimore. 1989. A novel, inducible and T cell-specific enhancer located at the 3' end of the T cell receptor {alpha} locus. EMBO J. 8:729.[Medline]
  42. Capone, M., F. Watrin, C. Fernex, B. Horvat, B. Krippl, L. Wu, R. Scollay, P. Ferrier. 1993. TCR ß and TCR {alpha} gene enhancers confer tissue- and stage-specificity on V(D)J recombination events. EMBO J. 12:4335.[Medline]
  43. Sleckman, B. P., C. G. Bardon, R. Ferrini, L. Davidson, F. W. Alt. 1997. Function of the TCR{alpha} enhancer in {alpha}ß and {gamma}{delta} T cells. Immunity 7:505.[Medline]
  44. Bories, J.-C., J. Demengeot, L. Davidson, F. W. Alt. 1996. Gene-targeted deletion and replacement mutations of the T-cell receptor ß-chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. Acad. Sci. USA 93:7871.[Abstract/Free Full Text]
  45. Bouvier, G., F. Watrin, M. Naspetti, C. Verthuy, P. Naquet, P. Ferrier. 1996. Deletion of the mouse T-cell receptor ß gene enhancer blocks {alpha}ß T-cell development. Proc. Natl. Acad. Sci. USA 93:7877.[Abstract/Free Full Text]
  46. Hockett, R. D., G. J., G. Nunez, S. Korsmeyer. 1989. Evolutionary comparison of murine and human {delta} T-cell receptor deleting elements. New Biol. 1:266.[Medline]
  47. Shimizu, T., S. Takeshita, M. Muto, E. Kubo, T. Sado, H. Yamagishi. 1993. Mouse germline transcript of TCR {alpha} joining region and temporal expression in ontogeny. Int. Immunol. 5:155.[Abstract/Free Full Text]
  48. de Villartay, J. P., D. Lewis, R. Hockett, T. A. Waldmann, S. J. Korsmeyer, D. I. Cohen. 1987. Deletional rearrangement in the human T-cell receptor {alpha}-chain locus. Proc. Natl. Acad. Sci. USA 84:8608.[Abstract/Free Full Text]
  49. Villey, I., D. Caillol, F. Selz, P. Ferrier, J. P. de Villartay. 1996. Defect in rearrangement of the most 5' TCR-J{alpha} following targeted deletion of T early {alpha} (TEA): implications for TCR {alpha} locus accessibility. Immunity 5:331.[Medline]
  50. Villey, I., P. Quartier, F. Selz, J. P. de Villartay. 1997. Germ-line transcription and methylation status of the TCR-J{alpha} locus in its accessible configuration. Eur. J. Immunol. 27:1619.[Medline]
  51. Wilson, R. K., B. F. Koop, C. Chen, N. Halloran, R. Sciammis, L. Hood. 1992. Nucleotide sequence analysis of 95 kb near the 3' end of the murine T-cell receptor {alpha}/{delta} chain locus: strategy and methodology. Genomics 13:1198.[Medline]
  52. Kuo, C. L., M. L. Chen, K. Wang, C. K. Chou, B. Vernooij, D. Seto, B. F. Koop, L. Hood. 1998. A conserved sequence block in murine and human T cell receptor (TCR) J{alpha} region is a composite element that enhances TCR {alpha} enhancer activity and binds multiple nuclear factors. Proc. Natl. Acad. Sci. USA 95:3839.[Abstract/Free Full Text]
  53. Papaionnou, V., R. Johnson. 1993. Production of chimeras and genetically defined offspring from targeted ES cells. A. L. Joyner, ed. Gene Targeting 107. Oxford University Press, Oxford.
  54. Schwenk, F., U. Baron, K. Rajewsky. 1995. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res. 23:5080.[Free Full Text]
  55. Kubo, R. T., W. Born, J. W. Kappler, P. Marrack, M. Pigeon. 1989. Characterization of a monoclonal antibody which detects all murine {alpha}ß T cell receptors. J. Immunol. 142:2736.[Abstract]
  56. Tomonari, K.. 1988. A rat antibody against a structure functionally related to the mouse T-cell receptor/T3 complex. Immunogenetics 28:455.[Medline]
  57. Cosgrove, D., D. Gray, A. Dierich, J. Kaufman, M. Lemeur, C. Benoist, D. Mathis. 1991. Mice lacking MHC class II molecules. Cell 66:1051.[Medline]
  58. Auffray, C., F. Rougeon. 1980. Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107:303.[Medline]
  59. Lau, C. F., S. S. Sheu. 1992. Rapid and direct recovery of DNA fragments from agarose gels: an extremely simple method. Methods Mol. Cell. Biol. 3:190.
  60. Wang, K., B. F. Koop, L. Hood. 1994. A simple method using T4 DNA polymerase to clone polymerase chain reaction products. BioTechniques 17:236.[Medline]
  61. Li, S., M. F. Wilkinson. 1998. Nonsense surveillance in lymphocytes?. Immunity 8:135.[Medline]
  62. Gorman, J. R., N. van der Stoep, R. Monroe, M. Cogne, L. Davidson, F. W. Alt. 1996. The Ig(kappa) enhancer influences the ratio of Ig({kappa}) versus Ig({lambda}) B lymphocytes. Immunity 5:241.[Medline]
  63. Takeda, S., Y. R. Zou, H. Bluethmann, D. Kitamura, U. Muller, K. Rajewsky. 1993. Deletion of the immunoglobulin {kappa} chain intron enhancer abolishes {kappa} chain gene rearrangement in cis but not {lambda} chain gene rearrangement in trans. EMBO J. 12:2329.[Medline]
  64. Xu, Y., L. Davidson, F. W. Alt, D. Baltimore. 1996. Deletion of the Ig {kappa} light chain intronic enhancer/matrix attachment region impairs but does not abolish V{kappa}J{kappa} rearrangement. Immunity 4:377.[Medline]
  65. Serwe, M., F. Sablitzky. 1993. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer. EMBO J. 12:2321.[Medline]
  66. Chen, J., F. Young, A. Bottaro, V. Stewart, R. K. Smith, F. W. Alt. 1993. Mutations of the intronic IgH enhancer and its flanking sequences differentially affect accessibility of the JH locus. EMBO J. 12:4635.[Medline]
  67. Fiering, S., E. Epner, K. Robinson, Y. Zhuang, A. Telling, M. Hu, D. I. Martin, T. Enver, T. J. Ley, M. Groudine. 1995. Targeted deletion of 5'HS2 of the murine ß-globin LCR reveals that it is not essential for proper regulation of the ß-globin locus. Genes Dev. 9:2203.[Abstract/Free Full Text]
  68. Kim, C. G., E. M. Epner, W. C. Forrester, M. Groudine. 1992. Inactivation of the human ß-globin gene by targeted insertion into the ß-globin locus control region. Genes Dev. 6:928.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
H. Xi and G. J. Kersh
Sustained Early Growth Response Gene 3 Expression Inhibits the Survival of CD4/CD8 Double-Positive Thymocytes
J. Immunol., July 1, 2004; 173(1): 340 - 348.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
N. Yannoutsos, P. Wilson, W. Yu, H. T. Chen, A. Nussenzweig, H. Petrie, and M. C. Nussenzweig
The Role of Recombination Activating Gene (RAG) Reinduction in Thymocyte Development in Vivo
J. Exp. Med., August 20, 2001; 194(4): 471 - 480.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riegert, P.
Right arrow Articles by Gilfillan, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riegert, P.
Right arrow Articles by Gilfillan, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS