HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nociari, M. M. Articles by Russo, C. Search for Related Content PubMed PubMed Citation Articles by Nociari, M. M. Articles by Russo, C.

Postthymic Development of CD28^-CD8⁺ T Cell Subset: Age-Associated Expansion and Shift from Memory to Naive Phenotype¹

Marcelo M. Nociari^*, William Telford and Carlo Russo^2,*

^* Laboratory of Immunology, Divisions of Geriatrics and Gerontology and International Medicine and Infectious Diseases, Cornell University Medical College, New York, NY 10021; and Section of Immunology and Inflammation, Hospital for Special Surgery, New York, NY 10021

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
During human aging, one of the major changes in the T cell repertoire is a dramatic expansion of T cells with the atypical CD28^-CD8⁺ phenotype. In this study, we show that this increase is a consequence not only of an expansion in the CD28^-CD8⁺ population but also of a decrease in the number of CD28⁺CD8⁺ T cells. The decrease in circulating CD28⁺CD8⁺ T cells is dramatically accelerated after the age of 50 and is not accompanied by an equivalent reduction in the CD28⁺CD4⁺ subset. Our findings confirm that aging leads to an accumulation of CD45RO⁺ T cells within the CD28⁺CD8⁺ subset as previously observed. Surprisingly, we found an increase in CD45RA⁺ expression with age in the CD28^-CD8⁺ subset. Immune-phenotyping for activation markers, measurement of telomere DNA content, and cytokine production analysis indicate that the large majority of CD28^-CD8⁺ T cells are Ag-experienced, despite their CD45RA⁺ phenotype. Our study further demonstrates that the poor proliferative response displayed by CD28^-CD8⁺ T cells is not a consequence of telomere shortening. Also, analysis of cytokine production at the single cell level revealed that the proportions of IFN-⁺, IL-4⁺, and IL-10⁺ T cells are considerably higher among the CD28^-CD8⁺ than the CD28⁺CD8⁺ subset. In summary, these data explain the presence of CD45RA⁺ T cells in the elderly, shed light on the phylogenetic origin of CD28^-CD8⁺ T cells, and suggest a role for these cells in the immune senescence process.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The increased susceptibility to infectious, neoplastic, and degenerative diseases observed in the elderly is, in part, the consequence of an impaired ability to mount effective humoral and cellular immune responses against new Ags 1, 2 . A decrease in both T and B cell-mediated protection seems to be driven by age-related changes in the T lymphocyte population 3 . Indeed, T cells in the aged show decreased ability to promote B cell activation and differentiation 4 , decreased proliferative response to mitogens and Ags 5 , and decreased ability to generate allospecific CTLs 6 .

T cell immune senescence has traditionally been associated with thymic involution, since a striking decline in the output of newly thymus-derived T cells occurs with age 7 . Nonetheless, the number of T lymphocytes in circulation remains relatively constant throughout life 8 , and a significant number of T cells with unprimed-naive (CD45RA⁺) phenotype are readily detectable in the aged 9 . Indeed, it was recently shown that the percentage of CD45RA⁺ T cells reaches about 50% of the total T lymphocyte population in centenarians, a value only slightly lower than in young donors 10 . Furthermore, it was noticed that CD45RA⁺ T cells in these individuals were unequally distributed, being more common in the CD8⁺ than the CD4⁺ subset 11 . Since a lifespan of several decades is highly improbable for most T cells, the origin and continuous renewal of T cells in the elderly remains unexplained.

One intriguing change observed in the T cell pool with aging is the marked increase in the proportion of CD8⁺ lymphocytes lacking expression of CD28 Ag 12 . CD28 is a major costimulatory molecule required for functional T cell activation 13 . In a prior study 14 , we have found that clonal expansions of CD28^-CD8⁺ T cell occurs in virtually all healthy elderly subjects. These clonally expanded T cells can persist in humans for years 15 . Elevated numbers of CD28^-CD8⁺ T cells in blood have been also associated with numerous immunocompromised conditions, such as systemic lupus erythematosus 16 , rheumatoid arthritis 17 , Chagas disease 18 , allograft transplants 19 , and HIV infection 20 . However, the role played by CD28^-CD8⁺ T cells in disease progression remains to be determined. Previous studies have suggested a suppressor role for CD28^-CD8⁺ T cells on B and T cell function 21, 22, 23 . Moreover, these atypical T cells exhibit unique cytotoxic properties. CD28^-CD8⁺ T cells can exert direct lysis of anti-CD3-coated P815 target cells 12, 24 and may mediate HLA-unrestricted cytolysis 25 . The nature of the target they recognize in the elderly is unknown. In contrast to their in vivo predominance, CD28^-CD8⁺ T cells do not proliferate readily in vitro, regardless of the stimulus used 22, 24 . CD28^-CD8⁺ T cells frequently are CD11b⁺, and to a lesser extent CD57⁺, two molecules associated with differentiated cytotoxic and suppressor T cells 24 . Coexpression of some activation Ags like CD38 and HLA-DR has been described in CD28^-CD8⁺ recovered from HIV⁺ patients 26 . CD28^-CD8⁺ T lymphocytes are very infrequent in cord blood and are uncommon in thymus and lymph nodes but are widely distributed in the gut and lung mucosal tissues 27, 28, 29, 30 . It is still unclear whether they arise from the CD28⁺ subset or whether they belong to a separate T cell lineage of extrathymic origin. CD28^-CD8⁺ cells have been shown to have shorter telomeres than CD28⁺CD8⁺ cells 31, 32 . It has therefore been proposed that CD28^-CD8⁺ T cells represent the replicative senescent progeny of CD28⁺CD8⁺ T cells. If that is the case, progression of age-associated loss of immune function may be related to accumulation of the CD28^-CD8⁺ subset and exhaustion of the regenerative capacity of the CD8⁺ population 33, 34, 35 .

Therefore, postthymic or extrathymic developmental models are needed to explain the maintenance of the peripheral pool size in the face of reduced thymic output and to understand the senescent changes occurring in T cell population in adults. In the present study, we investigate the phylogenetic origin of the CD28^-CD8⁺ and CD45RA⁺ T cells found in the elderly. Overall, the results support the hypothesis that CD28^-CD8⁺ lymphocytes derive from CD28⁺CD8⁺CD45RA^- precursors, which become CD28^-CD8⁺CD45RA^- first and CD28^-CD8⁺CD45RA⁺ later. In addition, they suggest that the presence and persistence of CD45RA⁺ T cells in the elderly are due to an extensive CD45RO to CD45RA reversion process. Our data also reveals that CD28^-CD8⁺ T cells are highly differentiated T cells rather than replicative exhausted lymphocytes. Finally, we present evidence that, based on their cytokine profile, CD28^-CD8⁺ may play an important role in the immune senescence process.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abs and reagents

Phycoerythrin (PE)³-goat anti-mouse Ig and RED-613-streptavidin were obtained from Life Technologies (Grand Island, NY). PE-anti-CD28, anti-CD28, anti-CD4, anti-HLA-DR, FITC-anti-TCRß, and PE-anti-IL-2 were purchased from Becton Dickinson (San Jose, CA). Anti-CD8, PE-anti-CD4, and anti-CD11b were obtained from Coulter (Miami, FL). FITC-anti-CD45RO was obtained from AMAC (Westbrook, ME). Biotin-anti-CD3, anti-CD8ß, and anti-CD25 were obtained from Immunotech (Westbrook, ME). Conjugation of purified anti-CD3 with the fluorochrome Cy5 was performed using a kit from Amersham (Arlington Heights, IL). All other surface marker and cytokine Abs were obtained from PharMingen (San Diego, CA). Complete medium consisting of RPMI 1640 supplemented with 10% FBS (Gemini Biological Products, Calabasas, CA), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies) was used as culture medium for T cells. PMA and ionomycin were obtained from Calbiochem (San Diego, CA). Monensin was obtained from Sigma (St. Louis, MO). Human rIL-2, rIL-4, and rIFN- were obtained from Life Technologies. FACS permeabilizing solution (10x) was obtained from Becton Dickinson.

Isolation of PBMC

Heparinized peripheral blood was obtained from healthy donors, 18-87 yr old. Mononuclear cells were isolated by centrifugation over Ficoll-Hypaque (Pharmacia Biotech, Piscataway, NJ) and further depleted of adherent cells by incubation in plastic plates for 90 min at 37°C.

Magnetic purification of CD8⁺ T lymphocytes

Nonadherent cells were incubated with anti-CD8 mAb for 30 min at 4°C, washed twice, and incubated with goat anti-mouse-conjugated immunomagnetic beads (Dynal, Lake Success, NY) at a ratio of 20 beads/cell for 30 min. CD8⁺ cells were then separated by positive selection with a magnet and incubated overnight at 37°C to release the beads. For some experiments, cells were additionally purified by subsequent removal of CD4⁺ cells via magnetic negative selection. The purity of CD8⁺ T cells was routinely 95–97%. TCRß expression was >98% within the CD3⁺ subset as measured by flow cytometry.

FACS

Before sorting, nonadherent PBMCs were incubated for 1 h on ice with 2-aminoethylisothiouronium bromide (AET)-treated SRBC (Hazleton-Dutchland, Denver, PA) prepared as previously described 36 . T cells (rosetted cells) were separated from non-T cells by Ficoll-Hypaque density gradient centrifugation, and washed with SRBC lysis buffer. The resulting T cells were then labeled for four-color flow analysis and sorting with FITC-anti-CD45RA, PE-anti-CD28, APC-anti-CD8, biotin-anti-CD3, and Red-613-streptavidin. Cell sorting was performed using a FACSVantage cell sorter (Becton Dickinson Immunocytometry Systems, San Jose, CA) equipped with argon ion and helium neon lasers emitting spatially separated beams at 488 nm (for FITC, PE, and Red-613 excitation) and 632 nm (for APC excitation). FITC, PE, and Red-613 signals were separated using 610-nm and 560-nm short pass reflecting dichroics, and collected through 535/30-, 575/20-, and 610/20-nm narrow bandpass filters, respectively. APC signals were collected through a 660/20-nm narrow bandpass filter. CD28⁺CD45RA^high, CD28⁺CD45RA^-, CD28^-CD45RA^high, and CD28^-CD45RA^- CD8⁺CD3⁺ T cell subsets were gated and sorted using a FACSVantage MacroSort sort module (Becton Dickinson). All sorted cell populations exhibited >95% purity as evidenced by back-analysis of sorted fractions.

Three- and four-color flow cytometric analysis

Three-color flow cytometry was performed by incubating PBMCs or purified CD8⁺ cells with three directly conjugated mAbs (FITC-, PE-, and Cy5 conjugated) for 30 min at 4°C. Cells were fixed in 2% paraformaldehyde and analyzed using a Coulter EPICS XL flow cytometry equipped with a single argon ion laser emitting at 488 nm. Absolute subset cell numbers were determined by multiplying the total cell count by the percentage of cells exhibiting the indicated phenotype. For four-color flow cytometry, purified CD8⁺ cells were labeled with an unconjugated mAb (as indicated) followed by PE-goat anti-mouse, FITC-anti-CD45RA, Cy5-anti-CD3, biotin-anti-CD28, and Red-613-streptavidin. Cells were then washed and fixed as described above. Acquisition was performed using a FACSCalibur flow cytometer (Becton Dickinson) equipped with an argon ion laser emitting at 488 nm (for FITC, PE, and Red-613 excitation) and a spatially separated diode laser emitting at 631 nm (for Cy5 excitation). For each sample, 20,000 events were acquired and analyzed using CellQuest software (Becton Dickinson).

Detection of cytokine production at single cell level

Flow cytometric measurement of cytokine production was performed as previously described 37, 38 with some modifications. Briefly, 10⁶ CD8⁺ cells were stimulated for 5 h with 10 ng/ml PMA and 1 µM ionomycin in the presence of 1 µM monensin. This short-term incubation did not affect membrane expression of CD28 and CD45RA molecules as confirmed by flow cytometry (data not shown). Cells were then labeled with FITC-anti-CD45RA, Cy5-anti-CD3, biotin-anti-CD28, and Red-613-streptavidin. Cells were then permeabilized and fixed with FACS permeabilizing solution for 10 min at room temperature. Permeabilized cells were subsequently incubated with a blocking solution followed by labeling with PE-anti-cytokine mAb (0.2 µg/10⁶ cells) for an additional 30 min. Recombinant cytokine-blocking controls using a 100-fold molar excess of the relevant cytokine added 2 h before labeling were performed in parallel to differentiate specific labeling from background. Stained cells were then fixed with paraformaldehyde and analyzed on a FACSCalibur flow cytometer as described above.

Telomere DNA content

Telomere DNA content was determined as previously described 39 with minor modifications. Genomic DNA was isolated from 3–5 x 10⁵ cell sorter-purified T cells using the Wizard Genomic DNA purification kit (Promega, Madison, WI) according to the manufacturer’s instructions. DNA was diluted and denatured in 0.5 M NaOH, 1.5 M NaCl buffer at 55°C for 30 min. DNA samples were then vacuum blotted onto ZetaProbe nylon membranes (BioRad Laboratories, Hercules, CA) and UV-cross-linked. The telomere-specific oligonucleotide [TTAGGG]₄ and centromere specific oligonucleotides [GTTTTGAAACACTCTTTTTGTAGAATCTGC] were end-labeled with 100 µCi [-³²P]ATP (>5000 Ci/mmol; Amersham) with polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN). Duplicated membranes were then hybridized with either the telomere or centromere for 24 h at 56°C. Membranes were then washed, air-dried, and exposed to a storage Phosphor Screen (Molecular Dynamics, Sunnyvale, CA) for 16 h. The density of the dots was determined with a PhosphorImager (Molecular Dynamics) and quantified using the volume-integration function of the ImageQuant software (Molecular Dynamics). Telomere DNA content of each population was expressed as the ratio between telomere and centromere signals, as a percentage of the control placental DNA measurement.

Proliferation assays

T cell proliferation was induced with anti-CD3 mAb immobilized on 96-well flat-bottom plates. Freshly and highly purified CD8⁺ T cell subsets were added in triplicate wells at 5 x 10⁴ cells/well and cultured for 4 days in complete culture medium RPMI 1640 in the presence and absence of 40 U/ml of rIL-2. Cultures were pulsed for the final 24 h of culture with 1 µCi/well [³H]TdR (Amersham) and subsequently analyzed for incorporation with a ß scintillation counter.

Statistical analysis

Nonparametric analyses were performed on most data, since most data did not fit a Gaussian distribution. Data are therefore represented by the median value and confidence interval unless otherwise indicated. The statistical significance of differences was assessed using Mann-Whitney U tests 40 .

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Changes in the CD8⁺ T cell peripheral pool during aging

The frequency of CD28^-CD8⁺ T cells in 51 healthy individuals was measured by three-color immunofluorescence analysis of PBMC. The subjects were arbitrarily divided into young (mean 22 years of age, range 18–25), middle-aged (mean 43.9, range 37–50), and old (mean 75.4, range 66–89). The proportion of CD28^-CD8⁺ T cells within the CD8⁺ T cell population increased with age (Fig. 1a). CD28^-CD8⁺ T cells represented 23% (±6.5), 29% (±7.0) and 61% (±6.1) of total CD8⁺ T cells within the young, middle-aged, and old groups, respectively. The kinetics of CD28^-CD8⁺ T cell increase was not progressive; instead, the increase occurred suddenly and relatively late in life.

View larger version (13K): [in this window] [in a new window]   FIGURE 1. Changes in the proportion of CD28- T cells within the CD8+CD3+ and CD4+CD3+ subsets with aging. PBMC from 51 healthy donors (11 younger than 25, 10 between 37 and 50, and 30 older than 66 years of age) were three-color stained using FITC anti-CD28, PE anti-CD8, or PE anti-CD4, and Cy5 anti-CD3. Appropriated fluorochrome-conjugated control-Ig were used to set the position of the quadrant markers. a, Median percentages (±95% confidence interval) of CD28- cells within the CD4+ () and CD8+ T cell subsets () are represented for each age group. All values were compared by Mann-Whitney U test. * indicates significant differences between the old and the two youngest groups (p < 0.001). # indicates significant difference between the old and the youngest group (p = 0.008). b and c, Absolute cell numbers of CD28+CD8+ and CD28-CD8+ T lymphocytes among the different age groups, respectively. Absolute cell numbers were calculated by multiplying the total lymphocyte count by the percent of lymphocytes exhibiting the indicated phenotypes. Median and individual values are displayed correspondingly. d, Correlation between the percentage of CD28-CD8+ T cells in the CD8+CD3+ population and the proportion of CD4+ T cells in the blood of elderly volunteers. The regression line with r value is indicated. The p value was calculated by linear regression analysis.

Changes in the CD4⁺ T cell peripheral pool during aging

The frequency of CD28^- T cells within the CD4⁺ T cell pool also increased with age (Fig. 1a). However, this augmentation was less pronounced than that observed in the CD8⁺ population. CD28^-CD4⁺ T cells represented 3% (±2.0), 7% (±3.7), and 10% (±2.7) of total CD4⁺ T cells within the young, middle-aged, and old groups, respectively. Absolute numbers of circulating CD28⁺CD4⁺ did not undergo an equivalent age-related reduction as was observed in the CD28⁺CD8⁺ subset. In fact, the CD28⁺CD4⁺:CD28⁺CD8⁺ T cell ratio increased significantly with age, although the absolute number of CD28⁺CD4⁺ T cells did not rise (Table I). On the other hand, increases in the absolute number of peripheral CD28^-CD4⁺ T cells paralleled the increases in the number of CD28^-CD8⁺ T cells as suggested by the constancy in the CD28^-CD4⁺:CD28^-CD8⁺ T cell ratio among the three age groups (Table I). These findings suggest that the age-associated increase in the percentage of CD28^- within the CD4⁺ population was mainly due to the increase in the number of peripheral CD28^-CD4⁺ T cells.

It has been recently shown that in asymptomatic HIV⁺ patients, there is a homeostatic mechanism by which variations in the percentage of CD4⁺ T cells inversely correlate with variations of CD28^-CD8⁺ T cells in blood 41 . We therefore analyzed the proportions of CD4⁺ and CD28^-CD8⁺ T cells in PBMCs from 32 healthy volunteers. An apparently inverse correlation between the percentage of CD28^-CD8⁺ T cells within the circulating CD8⁺CD3⁺ population and the percentage of CD4⁺ T cells existed in some, but not other individuals (Fig. 1d). Although regression analysis did not reveal a linear relationship between the two subsets, this result may suggest that changes in the number of CD4⁺ and CD28^-CD8⁺ T cells in the elderly are not random events but instead are mutually regulated.

Expression of CD45RA and CD45RO molecules on CD28⁺CD8⁺ and CD28^-CD8⁺ T cell subsets

To clarify the process that leads to the partial replacement of the CD28⁺CD8⁺ by CD28^-CD8⁺ T cells, we studied the maturational stage of these subsets via expression of CD45RA and CD45RO molecules. More than 95% purified CD8⁺ lymphocyte populations from 10 young donors (mean 21.9 years of age, range 18–25) and 20 old donors (mean 75.5 years of age, range 68–89) were analyzed for CD3, CD28, and CD45RA or CD45RO expression by three-color flow cytometry. In young subjects, the percentages of CD45RA⁺ and CD45RO⁺ T cell subsets did not differ significantly within the CD28⁺CD8⁺ and CD28^-CD8⁺ T cell subpopulations (Fig. 2a), in accordance with previous reports 24 . In contrast, the CD28^-CD8⁺ T cell subset from elderly individuals contained a high percentage of cells with CD45RA⁺ phenotype, while the CD28⁺CD8⁺ subset was rich in T cells with CD45RO⁺ phenotype (Fig. 2b). This dichotomy in CD45 expression was reflected in the CD45RA:CD45RO T cell ratios (Fig. 2c).

View larger version (20K): [in this window] [in a new window]   FIGURE 2. Expression of CD45RA and CD45RO Ags within the CD28+CD8+ and CD28-CD8+ T cell subsets. CD8+ purified cells from 10 individuals younger than 25 yr, and 20 older than 67 were three-color analyzed using FITC anti-CD45RA or FITC anti-CD45RO, PE anti-CD28, and CyChrome anti-CD3 Abs. a, Proportions of CD45RA and CD45RO cells within the CD28+CD8+ and CD28-CD8+ T cell subsets in young individuals. b, Proportions of CD45RA and CD45RO cells within the CD28+CD8+ and CD28-CD8+ T cell subsets in old individuals. c, Changes in the CD45RA:CD45RO ratio among the CD28+CD8+ and CD28-CD8+ T cell subset with age. For each subset, the medians (±95% confidence intervals) of percent of positive cells were represented. Statistical differences were established using the Mann-Whitney U test.

View larger version (21K): [in this window] [in a new window]   FIGURE 3. Coexpression of CD45RA and CD45RO Ags on CD28+CD8+ and CD28-CD8+ T cells. CD8+ cells from four young donors and four old donors were four-color stained using FITC anti-CD45RA, PE anti-CD45RO, Red 613 anti-CD28, and Cy5 anti-CD3. a, Expression of CD45RA, CD45RO, and CD28 Ags on CD3+ gated lymphocytes from a 24-yr-old donor. Dot plots show distribution of CD45RO positive cells (black) among the total CD3+-gated population (gray). b, Simultaneous expression of CD45RA and CD45RO Ags on CD28-CD8+CD3+-gated lymphocytes in the same 24-yr-old subject analyzed before. c and d, identical to a and b but in an 84-yr-old subject.

View larger version (19K): [in this window] [in a new window]   FIGURE 4. Replicative history and proliferative capacity of CD8+ T cell subsets. CD28+CD45RA-, CD28+CD45RAhigh, CD28- CD45RA-, and CD28-CD45RAhigh CD8+ T cells were isolated by four-color cell sorting from seven individuals older than 66 yr. For this purpose PBMC cells were stained with FITC anti-CD45RA, PE anti-CD28, Red-613 anti-CD3, and APC anti-CD8. a, Replicative history of each CD8+ T cell subset as depicted by their T:C DNA ratio. For each individual, a different symbol was utilized to depict his T:C ratios, and the means of the T:C ratios for each subset are indicated. b, Comparison of the proliferative capacity of CD28- T cells with the proliferative capacity of CD28+ T cells that bear similar or lower telomere DNA content. T lymphocytes from donors , , and (see a) were investigated. Representative results obtained with T lymphocytes from donor are shown. Statistical differences were established using the Mann-Whitney U test.

We then attempted to determine whether this RO to RA phenotypic change within the CD28^-CD8⁺ subset was due to an age-related differentiation process or to the de novo emergence of a nonphylogenetically related CD28^-CD45RA⁺ population. Telomere DNA content is a powerful tool used to assess the amount of cellular divisions undergone by a population 42, 43 . We used this procedure to estimate the phylogenetic relationship among the CD8⁺ T cell subsets. For this purpose, CD28⁺CD45RA⁺, CD28⁺CD45RA^-, CD28^-CD45RA⁺, and CD28^-CD45RA^- CD8⁺ T cells were isolated from the peripheral blood of seven elderly volunteers 66 years of age or older using four-color cell sorting as described in Materials and Methods. Telomere DNA content was analyzed by determining the telomere:centromere ratio (T:C) as previously described 39 . Results are shown in Fig. 4a. The means of the T:C ratios for the CD28⁺CD45RA⁺, CD28⁺CD45RA^-, CD28^-CD45RA^-, and CD28^-CD45RA⁺ T cell subsets were 1.60 (±0.24), 1.06 (±0.31), 1.32 (±0.36), and 1.16 (±0.18), respectively. We found that for all seven donors, the CD28⁺CD45RA⁺ subset had more telomere DNA than CD28⁺CD45RA^- T cells, consistent with the idea that, upon proper Ag presentation, CD28⁺CD45RA⁺ (unprimed-naive) T cells become activated, divide, and transform into CD28⁺CD45RA^- (primed-memory) T cells. CD28^-CD45RA⁺ T cells had significantly less telomere DNA than naive (CD28⁺CD45RA⁺) T cells but similar amounts compared with primed-memory (CD28⁺CD45RA^-) T cells, indicating that CD28^-CD45RA⁺ T cells were not de novo generated lymphocytes. In most individuals analyzed, CD28^-CD45RA^- T cells exhibited higher telomere DNA content than CD28^-CD45RA⁺ T cells. However, in contrast to what we observed within the CD28⁺CD8⁺ subset, the difference in the telomere content between the CD28^-CD8⁺ subsets was not statistically significant. This observation suggests that in vivo CD45RA isoform shifting within the CD28^-CD8⁺ subset requires less extensive cell division than within the CD28⁺CD8⁺ T cell subset.

Telomere DNA content may play a critical control in regulating cell division 44, 45 . Therefore, to test if the poor response to mitogens described for CD28^-CD8⁺ T cells was a consequence of their shortened telomeres, we compared the proliferative response of CD28^-CD8⁺ T cells to CD28⁺CD8⁺ T cells with equivalent telomere DNA content. The CD28⁺CD8⁺CD45RA^- and CD28^-CD8⁺CD45RA⁺ T cells satisfied this condition. Furthermore, the proliferative response of the CD28⁺CD8⁺CD45RA⁺ subset, a population with significant more telomere DNA than the other two, was also evaluated. Freshly four-color sorted T cells were stimulated with plate-coated anti-CD3 for 4 days in the presence or absence of rIL-2. Although CD25 (IL-2R -subunit) up-regulation was confirmed in the CD28^- subpopulation (data not shown), [³H]thymidine incorporation by CD28^-CD8⁺CD45RA⁺ T cells was considerably lower than in the CD28⁺CD8⁺CD45RA^- and CD28⁺CD8⁺CD45RA⁺ T cell subsets (Fig. 4b). Thus, in spite of having similar or even higher telomere content, the proliferative response of these CD28^-CD8⁺ T cells was considerably reduced with respect to the proliferative response of the CD28⁺CD8⁺ T cells. These results show that the low proliferative capacity of the CD28^-CD8⁺ T cells is not directly related to their telomere length.

Phenotypic and functional characterization of CD8⁺ T cell subsets defined by CD45RA and CD28 expression

To define whether the CD28^-CD45RA⁺ CD8⁺ T cells found in elderly donors were Ag-experienced cells, we analyzed the expression of other markers indicative of unprimed- and primed-memory status, including CD29, CD11a, and CD62 ligand (CD62L). CD29 and CD11a, which are expressed at low levels on naive cells but increase in primed-memory cells, were both constantly expressed on all the CD28^-CD8⁺ T cells at levels consistent with primed-memory cells (Fig. 5a). Conversely, the homing Ag receptor CD62L, which is associated with naive T cells, was poorly expressed on CD28^-CD8⁺ T cells (Fig. 5b). Expression of the activation markers HLA-DR and CD25 was also evaluated. The largest incidence of HLA-DR⁺ cells was found within the CD28^-CD8⁺ subset independent of CD45RA expression (Fig. 5b). Expression of CD25 was also significant within the CD28^-CD8⁺CD45RA^high subset in some individuals (Fig. 5b). Taken together, these data support the concept that the CD28^-CD45RA^high T cells represent a population of Ag-experienced lymphocytes.

View larger version (41K): [in this window] [in a new window]   FIGURE 5. Phenotypic characteristics of CD8+ T cell subsets. Purified CD8+ cells from five donors older than 67 yr were four-color stained using FITC-anti-CD45RA; PE-anti-CD29, anti-CD11a, anti-CD62L, anti-HLA-DR, anti-CD25, anti-CD57, anti-CD11b, or anti-CD8b; Red-613 anti-CD28; and Cy5-anti- CD3. a, Expression of CD29, CD11a, and CD62L by CD3+CD8+ lymphocytes with differential expression of CD28 molecule. b, Dot plots show expression of HLA-DR, CD25, CD56, CD57, CD11b, and CD8ß within the CD28-CD8+CD3+ vs CD45RA expression.

To assess the functional capabilities of the different CD8⁺ T cell subsets found in elderly subjects, synthesis of IL-2, IFN-, IL-4, and IL-10 was measured in cells stimulated with PMA and ionomycin. As illustrated in Fig. 6, IL-2 was almost exclusively produced by the CD28⁺CD8⁺ T cells. The low percentage of IL-2⁺ cells within CD28^-CD8⁺ population was inversely associated with CD45RA expression. In contrast, IFN- was mainly produced by the CD28^-CD8⁺ subset. Remarkably, the largest percentage of IL-4-producing cells was found among both CD28^-CD8⁺ subsets. Finally, IL-10 was preferentially produced by CD28^-CD8⁺CD45RA⁺ subset. The presence of cells with the same unusual phenotype and with the same unique pattern of lymphokine expression support the notion that CD28^-CD45RA^- and CD28^-CD45RA⁺ subsets contain highly specialized and phylogenetically related T lymphocytes. Expression of NK markers such as CD56 and cytokine profile of human CD28^-CD8⁺ T cells may suggest that these lymphocytes represent the equivalent to the NK1.1⁺ T cells in mice 46 .

View larger version (20K): [in this window] [in a new window]   FIGURE 6. Intracellular measurement of cytokine production by CD8+ T cell subsets from aged individuals. Purified CD8+ T cells were stimulated for 5 h with PMA and ionomycin in presence of monensin. After surface staining with CD45RA, CD28, and CD3, cells were fixated and permeabilized, and intracellular cytokines were detected with specific PE-conjugated mAbs. The positions of the quadrant markers were set using as negative controls the PE-conjugated specific anti-cytokine mAbs pre-blocked with the corresponding cytokine. Percentage of positive cells among each CD8+ subset (median ± confidence interval, n = 5).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The phylogenetic origin of circulating CD28^-CD8⁺ T cells in the elderly is unclear. It has been suggested that they may derive from Ag-experienced CD28⁺CD8⁺ T cells 32 , but they may also represent de novo-generated T cells from extrathymic sites 50, 51 . To test these hypotheses, we determined the memory status of this subset. Our results showed that the CD28^-CD8⁺ subset did not contain any preferential accumulation of CD45RO⁺ T cells as compared with the CD28⁺CD8⁺ subset and that the proportion of CD28^-CD45RA⁺ T cells increased with age, representing the majority of CD28^-CD8⁺ cells in elderly individuals. These findings fit well with a previous report by Okumura et al. 52 showing an age-related increase in the amount of CD45RA⁺ cells within the CD8⁺ T cell population. Since reversion from CD45RO to CD45RA has been shown to occur following adoptive transfer in nude rats 53, 54 and has been also suggested in humans 55 , we investigated whether these CD28^-CD45RA⁺ T cells were CD45RO⁺ reversions or newly generated T cells. We have four lines of evidence indicating that CD28^-CD45RA⁺ cells may be derived from CD45RO⁺ T cells. CD28^-CD45RA⁺ T cells expressed the adhesion molecules CD29 and CD11a with high intensity but did not express CD62L, a characteristic phenotype of memory T cells 52, 56, 57 . The CD28^-CD45RA⁺ subset contained HLA-DR⁺ and CD25⁺ cells, two molecules expressed by recently primed T cells. The CD28^-CD45RA⁺ subset also produced IFN-, IL-4, and IL-10, three cytokines characteristically produced by highly differentiated primed-memory T cells 58, 59, 60 . Finally, we showed that the telomere DNA content of CD28^-CD45RA⁺ T cells was reduced to a similar degree to that observed in primed-memory T cells (CD28⁺CD45RA^-). Thus, our data indicate that irrespective of CD45RA expression, all CD28^-CD8⁺ T cells were Ag-experienced cells. Expression of CD45RA within the CD28^-CD8⁺ population appears to reflect a differentiation state rather than immunological memory.

We found that the general concept of aging leading to an increase in the proportion of CD45RO⁺ T cells 3 may apply for T cells with CD28⁺CD8⁺ phenotype. In contrast, our results suggest that CD28^-CD8⁺ T cells become CD45RA⁺ with aging. Additionally, preliminary data from our laboratory suggests that the same age-related patterns of CD45-isoform switch occur among the CD28⁺CD4⁺ and CD28^-CD4⁺ subsets (data not shown). We have presented evidence suggesting that CD28^-CD45RA⁺ T cells derive from CD28^-CD45RO⁺ precursors. We showed that CD28^-CD45RA⁺ T cells have characteristics of memory-reverting T cells. We found that CD28^-CD45RO⁺ cells appear before CD28^-CD45RA⁺ T cells in blood. CD28^-CD45RA⁺ and CD28^-CD45RO⁺ T cells shared the same atypical phenotype (CD57⁺, CD56⁺, CD11b⁺) and unique profile of cytokine production (IL-2^-, IL-4⁺, IL-10⁺, IFN-⁺), which support a common lineage for both populations. Thus, this new study provides additional evidence in support of an extensive RO-RA reversion, which takes place in human aging. In addition, our findings explain not only the presence and persistence of CD45RA⁺ T cells in centenarians, but provides a potential mechanism for their higher frequency in the CD8⁺ vs the CD4⁺ T cell subset in aged individuals 10 .

Our results on telomere DNA content show that CD28^-CD45RA^- T cells had an intermediate telomere content with respect to CD28⁺CD45RA⁺ and CD28⁺CD45RA^- T cells. This finding agrees with the hypothesis that CD28^-CD45RA^- T cells derive from CD28⁺CD45RA^- T cells. It has been suggested that memory T cells show migratory preferences for nonlymphoid tissue 61, 62 . Hence, we propose that primed T cells (CD28⁺CD45RA^-) migrate to peripheral sites where they acquire the CD28^-CD45RA^- phenotype. Once cells become CD28^-, they decrease their proliferation rate and consequently preserve their telomere DNA content. This could explain why CD28^-CD45RA^- T cells have more telomere DNA content than CD28⁺CD45RA^- T cells. Evidence supporting a common origin for CD28⁺ and CD28^- T cells was provided by previous studies 63, 64 , where it was shown that the similitude of Vß repertoires between peripheral CD28^- and CD28⁺ T cells can only be attributed to their divergence from a same T cell population.

Telomere length, in addition to providing a historical record of cell replication, appears to play a critical control in regulating cell division. Nevertheless, we have showed that the poor proliferative response of CD28^-CD8⁺ T cells cannot be attributed to their shortened telomeres. CD28⁺CD45RA^- T cells proliferated considerably more upon mitogenic stimulation than CD28^-CD45RA⁺ T cells, although both subsets held similar telomere DNA content. In addition, telomere shortening was not associated with CD28 loss since the CD28⁺CD45RA^- showed the lowest telomere content in most donors. Lack of CD28 expression in vivo seems to be the result of differentiation rather than of proliferation.

We have shown that on a per cell basis the vast majority of CD28^-CD8⁺ T cells produced IFN- but not IL-2 and that these cells were positive for IL-4 and IL-10 in elderly donors. Moreover, the proportions of IFN-⁺, IL-4⁺, and IL-10⁺ T cells were considerably higher among the CD28^-CD8⁺ than in the CD28⁺CD8⁺ subset. Considering the large predominance of CD28^-CD8⁺ T cells in the elderly, it would be reasonable to expect significant alterations in the cytokine network during aging. In fact, several studies have shown that cytokines preferentially secreted by preactivated or memory T cells, such as IFN-, IL-4, and IL-10, are produced in increasing concentrations later in life 65, 66, 67 . This cytokine profile may also explain some of the suppressor effects on T cell response that have been associated with CD28^-CD8⁺ T lymphocytes. In that respect, it was shown that inhibition of the proliferative response of CD4⁺ T cells by CD8⁺ T cell clones was mediated by the simultaneous production of IL-10 and IFN- 68 . In addition, it has been shown that IL-4 is capable of down-regulating the cytotoxic function of CD8⁺ cells 69 while IL-10 induces T cell anergy 70 and both cytokines act synergistically to inhibit cell mediated immune-responses 65, 71 . Further studies will be necessary to establish the significance of these findings in the impairment of the immune response in aging. Moreover, future investigations to determine the conditions that lead to the generation of CD28^- T cells will bring about increased understanding not only on the pathobiology of the aging process but also on normal T cell homeostasis.

	Acknowledgments

 
We thank Matias Maskin and Stephen Gutman for technical assistance and Enrique Mesri, Patricia Fontan, and Carlos Bais for their critical reading of this manuscript.

	Footnotes

 
¹ This work was supported in part by the National Institute of Aging Grants AG-00541 and RO1 AG-12855 and the Clinical Research Support Grant R00047.

² Address correspondence and reprint requests to Dr. Carlo Russo, Merck Research Laboratories, P.O. Box 4, BLA 34, West Point, PA 19486. E-mail address:

³ Abbreviations used in this paper: PE, phycoerythrin; L, ligand; T:C, telomere:centromere ratio; AET, 2-aminoethylisothiouronium bromide.

Received for publication July 17, 1998. Accepted for publication December 16, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Ershler, W. B.. 1993. Tumors and aging: the influence of age-associated immune changes upon tumor growth and spread. Adv. Exp. Med. Biol. 330:77.[Medline]
2. Gardner, I. D.. 1980. The effect of aging on susceptibility to infection. Rev. Infect. Dis. 2:801.[Medline]
3. Miller, R. A.. 1996. The aging immune system: primer and prospectus. Science 273:70.[Abstract]
4. Yang, X., J. Stedra, J. Cerny. 1996. Relative contribution of T and B cells to hypermutation and selection of the antibody repertoire in germinal centers of aged mice. J. Exp. Med. 183:959.[Abstract/Free Full Text]
5. Flurkey, K., R. A. Miller, D. E. Harrison. 1992. Cellular determinants of age-related decrements in the T-cell mitogen response of B6CBAF1 mice. J. Gerontol. 47:B115.[Abstract]
6. Bloom, E. T., J. A. Horvath. 1994. Cellular and molecular mechanisms of the IL-12-induced increase in allospecific murine cytolytic T cell activity: implications for the age-related decline in CTL. J. Immunol. 152:4242.[Abstract]
7. George, A. J., M. A. Ritter. 1996. Thymic involution with ageing: obsolescence or good housekeeping?. Immunol. Today 17:267.[Medline]
8. Stulnig, T., C. Maczek, G. Bock, O. Majdic, G. Wick. 1995. Reference intervals for human peripheral blood lymphocyte subpopulations from ‘healthy’ young and aged subjects. Int. Arch. Allergy Immunol. 108:205.[Medline]
9. Cossarizza, A., C. Ortolani, D. Monti, C. Franceschi. 1997. Cytometric analysis of immunosenescence. Cytometry 27:297.[Medline]
10. Cossarizza, A., C. Ortolani, R. Paganelli, D. Barbieri, D. Monti, P. Sansoni, U. Fagiolo, G. Castellani, F. Bersani, M. Londei, C. Franceschi. 1996. CD45 isoforms expression on CD4⁺ and CD8⁺ T cells throughout life, from newborns to centenarians: implications for T cell memory. Mech. Ageing Dev. 86:173.[Medline]
11. Franceschi, C., D. Monti, P. Sansoni, A. Cossarizza. 1995. The immunology of exceptional individuals: the lesson of centenarians. Immunol. Today 16:12.[Medline]
12. Fagnoni, F. F., R. Vescovini, M. Mazzola, G. Bologna, E. Nigro, G. Lavagetto, C. Franceschi, M. Passeri, P. Sansoni. 1996. Expansion of cytotoxic CD8⁺ CD28^- T cells in healthy ageing people, including centenarians. Immunology 88:501.[Medline]
13. Sperling, A. I., J. A. Bluestone. 1996. The complexities of T-cell co-stimulation: CD28 and beyond. Immunol. Rev. 153:155.[Medline]
14. Posnett, D. N., R. Sinha, S. Kabak, C. Russo. 1994. Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy" [Published erratum appears in 1994 J. Exp. Med. 179:1077.]. J. Exp. Med. 179:609.[Abstract/Free Full Text]
15. Schwab, R., P. Szabo, J. S. Manavalan, M. E. Weksler, D. N. Posnett, C. Pannetier, P. Kourilsky, J. Even. 1997. Expanded CD4⁺ and CD8⁺ T cell clones in elderly humans. J. Immunol. 158:4493.[Abstract]
16. Kaneko, H., K. Saito, H. Hashimoto, H. Yagita, K. Okumura, M. Azuma. 1996. Preferential elimination of CD28⁺ T cells in systemic lupus erythematosus (SLE) and the relation with activation-induced apoptosis. Clin. Exp. Immunol. 106:218.[Medline]
17. Fitzgerald, J. E., N. S. Ricalton, A. C. Meyer, S. G. West, H. Kaplan, C. Behrendt, B. L. Kotzin. 1995. Analysis of clonal CD8⁺ T cell expansions in normal individuals and patients with rheumatoid arthritis. J. Immunol. 154:3538.[Abstract]
18. Dutra, W. O., O. A. Martins-Filho, J. R. Cancado, J. C. Pinto-Dias, Z. Brener, G. Gazzinelli, J. F. Carvalho, D. G. Colley. 1996. Chagasic patients lack CD28 expression on many of their circulating T lymphocytes. Scand. J. Immunol. 43:88.[Medline]
19. Garin, L., D. Rigal, G. Souillet, C. Nemoz, J. Bernaud, Y. Merieux, N. Philippe. 1995. Allogenic BMT in children: differential lymphocyte subset reconstitution according to the occurrence of acute GVHD. Clin. Immunol. Immunopathol. 77:139.[Medline]
20. Vingerhoets, J. H., G. L. Vanham, L. L. Kestens, G. G. Penne, R. L. Colebunders, M. J. Vandenbruaene, J. Goeman, P. L. Gigase, M. De Boer, J. L. Ceuppens. 1995. Increased cytolytic T lymphocyte activity and decreased B7 responsiveness are associated with CD28 down-regulation on CD8⁺ T cells from HIV-infected subjects. Clin. Exp. Immunol. 100:425.[Medline]
21. Autran, B., G. Carcelain, T. S. Li, C. Blanc, D. Mathez, R. Tubiana, C. Katlama, P. Debre, J. Leibowitch. 1997. Positive effects of combined antiretroviral therapy on CD4⁺ T cell homeostasis and function in advanced HIV disease. Science 277:112.[Abstract/Free Full Text]
22. Hamann, D., P. A. Baars, M. H. Rep, B. Hooibrink, S. R. Kerkhof-Garde, M. R. Klein, R. A. van Lier. 1997. Phenotypic and functional separation of memory and effector human CD8⁺ T cells. J. Exp. Med. 186:1407.[Abstract/Free Full Text]
23. Wang, E. C., P. J. Lehner, S. Graham, L. K. Borysiewicz. 1994. CD8^high (CD57⁺) T cells in normal, healthy individuals specifically suppress the generation of cytotoxic T lymphocytes to Epstein-Barr virus-transformed B cell lines. Eur. J. Immunol. 24:2903.[Medline]
24. Azuma, M., J. H. Phillips, L. L. Lanier. 1993. CD28^- T lymphocytes: antigenic and functional properties. J. Immunol. 150:1147.[Abstract]
25. Montagna, D., M. Arico, E. Montini, F. De Benedetti, R. Maccario. 1995. Identification of HLA-unrestricted CD8⁺/CD28^- cytotoxic T-cell clones specific for leukemic blasts in children with acute leukemia. Cancer Res. 55:3835.[Abstract/Free Full Text]
26. Kammerer, R., A. Iten, P. C. Frei, P. Burgisser. 1996. Expansion of T cells negative for CD28 expression in HIV infection: relation to activation markers and cell adhesion molecules, and correlation with prognostic markers. Med. Microbiol. Immunol. 185:19.[Medline]
27. Latthe, M., L. Terry, T. T. MacDonald. 1994. High frequency of CD8 homodimer-bearing T cells in human fetal intestine. Eur. J. Immunol. 24:1703.[Medline]
28. Ohteki, T., H. R. MacDonald. 1993. Expression of the CD28 costimulatory molecule on subsets of murine intestinal intraepithelial lymphocytes correlates with lineage and responsiveness. Eur. J. Immunol. 23:1251.[Medline]
29. Couedel-Courteille, A., R. Le Grand, M. Tulliez, J. G. Guillet, A. Venet. 1997. Direct ex vivo simian immunodeficiency virus (SIV)-specific cytotoxic activity detected from small intestine intraepithelial lymphocytes of SIV-infected macaques at an advanced stage of infection. J. Virol. 71:1052.[Abstract]
30. Rosenberg, Y. J., A. Cafaro, T. Brennan, J. G. Greenhouse, K. McKinnon, S. Bellah, J. Yalley-Ogunro, S. Gartner, M. G. Lewis. 1997. Characteristics of the CD8⁺ lymphocytosis during primary simian immunodeficiency virus infections. AIDS 11:959.[Medline]
31. Effros, R. B., R. Allsopp, C. P. Chiu, M. A. Hausner, K. Hirji, L. Wang, C. B. Harley, B. Villeponteau, M. D. West, J. V. Giorgi. 1996. Shortened telomeres in the expanded CD28^-CD8⁺ cell subset in HIV disease implicate replicative senescence in HIV pathogenesis. AIDS 10:F17.[Medline]
32. Monteiro, J., F. Batliwalla, H. Ostrer, P. K. Gregersen. 1996. Shortened telomeres in clonally expanded CD28^-CD8⁺ T cells imply a replicative history that is distinct from their CD28⁺CD8⁺ counterparts. J. Immunol. 156:3587.[Abstract]
33. Effros, R. B., G. Pawelec. 1997. Replicative senescence of T cells: does the Hayflick Limit lead to immune exhaustion?. Immunol. Today 18:450.[Medline]
34. Pawelec, G., M. Adibzadeh, R. Solana, I. Beckman. 1997. The T cell in the ageing individual. Mech. Ageing Dev. 93:35.[Medline]
35. Wolthers, K. C., F. Miedema. 1998. Telomeres and HIV-1 infection: in search of exhaustion. Trends Microbiol. 6:144.[Medline]
36. Coligan, J. E., A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, and W. Strover. 1991. Current Protocols in Immunology, Vol. 2. J. W. Sons, ed. Greene Publishing Associates and Wiley Interscience, New York, p. 7.2.1.
37. Carter, L. L., S. L. Swain. 1997. Single cell analyses of cytokine production. Curr. Opin. Immunol. 9:177.[Medline]
38. Meyaard, L., E. Hovenkamp, I. P. Keet, B. Hooibrink, I. H. de Jong, S. A. Otto, F. Miedema. 1996. Single cell analysis of IL-4 and IFN- production by T cells from HIV-infected individuals: decreased IFN- in the presence of preserved IL-4 production. J. Immunol. 157:2712.[Abstract]
39. Bryant, J. E., K. G. Hutchings, R. K. Moyzis, J. K. Griffith. 1997. Measurement of telomeric DNA content in human tissues. BioTechniques 23:476.[Medline]
40. Matthews, D. E., V. T. Farewell. 1988. Using and Understanding Medical Statistics Karger, Basel.
41. Caruso, A., S. Licenziati, A. D. Canaris, A. Cantalamessa, S. Fiorentini, S. Ausenda, D. Ricotta, F. Dima, F. Malacarne, A. Balsari, A. Turano. 1998. Contribution of CD4⁺, CD8⁺, CD28⁺, and CD8⁺CD28^- T cells to CD3⁺ lymphocyte homeostasis during the natural course of HIV-1 infection. J. Clin. Invest. 101:137.[Medline]
42. Palmer, L. D., N. Weng, B. L. Levine, C. H. June, H. C. Lane, R. J. Hodes. 1997. Telomere length, telomerase activity, and replicative potential in HIV infection: analysis of CD4⁺ and CD8⁺ T cells from HIV-discordant monozygotic twins. J. Exp. Med. 185:1381.[Abstract/Free Full Text]
43. Weng, N. P., B. L. Levine, C. H. June, R. J. Hodes. 1995. Human naive and memory T lymphocytes differ in telomeric length and replicative potential. Proc. Natl. Acad. Sci. USA 92:11091.[Abstract/Free Full Text]
44. Allsopp, R. C., E. Chang, M. Kashefi-Aazam, E. I. Rogaev, M. A. Piatyszek, J. W. Shay, C. B. Harley. 1995. Telomere shortening is associated with cell division in vitro and in vivo. Exp. Cell Res. 220:194.[Medline]
45. Morin, G. B.. 1997. Telomere control of replicative lifespan. Exp. Gerontol. 32:375.[Medline]
46. Bendelac, A., M. N. Rivera, S. H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
47. Arosa, F. A., C. Irwin, M. De Sousa, D. N. Posnett. 1998. Interactions between peripheral blood CD8 T lymphocytes and intestinal epithelial cells (iEC). Clin. Exp. Immunol. 112:226.[Medline]
48. Kim, S. K., D. S. Reed, W. R. Heath, F. Carbone, L. Lefrancois. 1997. Activation and migration of CD8 T cells in the intestinal mucosa. J. Immunol. 159:4295.[Abstract]
49. Li, Y., X. Y. Yio, L. Mayer. 1995. Human intestinal epithelial cell-induced CD8⁺ T cell activation is mediated through CD8 and the activation of CD8-associated p56^lck. J. Exp. Med. 182:1079.[Abstract/Free Full Text]
50. Okada, T., T. Iiai, Y. Kawachi, T. Moroda, Y. Takii, K. Hatakeyama, T. Abo. 1995. Origin of CD57⁺ T cells which increase at tumour sites in patients with colorectal cancer. Clin. Exp. Immunol. 102:159.[Medline]
51. Tsukahara, A., S. Seki, T. Iiai, T. Moroda, H. Watanabe, S. Suzuki, T. Tada, H. Hiraide, K. Hatakeyama, T. Abo. 1997. Mouse liver T cells: their change with aging and in comparison with peripheral T cells. Hepatology 26:301.[Medline]
52. Okumura, M., Y. Fujii, Y. Takeuchi, K. Inada, K. Nakahara, H. Matsuda. 1993. Age-related accumulation of LFA-1^high cells in a CD8⁺ CD45RA^high T cell population. Eur. J. Immunol. 23:1057.[Medline]
53. Bell, E. B., S. M. Sparshott. 1990. Interconversion of CD45R subsets of CD4 T cells in vivo. Nature 348:163.[Medline]
54. Bunce, C., E. B. Bell. 1997. CD45RC isoforms define two types of CD4 memory T cells, one of which depends on persisting antigen. J. Exp. Med. 185:767.[Abstract/Free Full Text]
55. Michie, C. A., A. McLean, C. Alcock, P. C. Beverley. 1992. Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature 360:264.[Medline]
56. Roederer, M., P. A. Raju, D. K. Mitra, L. A. Herzenberg, L. A. Herzenberg. 1997. HIV does not replicate in naive CD4 T cells stimulated with CD3/CD28. J. Clin. Invest. 99:1555.[Medline]
57. Sprent, J.. 1997. Immunological memory. Curr. Opin. Immunol. 9:371.[Medline]
58. Hamann, D., P. A. Baars, B. Hooibrink, R. W. van Lier. 1996. Heterogeneity of the human CD4⁺ T-cell population: two distinct CD4⁺ T-cell subsets characterized by coexpression of CD45RA and CD45RO isoforms. Blood 88:3513.[Abstract/Free Full Text]
59. Lewis, D. B., C. C. Yu, J. Meyer, B. K. English, S. J. Kahn, C. B. Wilson. 1991. Cellular and molecular mechanisms for reduced interleukin 4 and interferon- production by neonatal T cells. J. Clin. Invest. 87:194.
60. Salmon, M., G. D. Kitas, P. A. Bacon. 1989. Production of lymphokine mRNA by CD45R⁺ and CD45R^- helper T cells from human peripheral blood and by human CD4⁺ T cell clones. J. Immunol. 143:907.[Abstract]
61. Saltini, C., M. Kirby, B. C. Trapnell, N. Tamura, R. G. Crystal. 1990. Biased accumulation of T lymphocytes with "memory"-type CD45 leukocyte common antigen gene expression on the epithelial surface of the human lung. J. Exp. Med. 171:1123.[Abstract/Free Full Text]
62. Schweighoffer, T., Y. Tanaka, M. Tidswell, D. J. Erle, K. J. Horgan, G. E. Luce, A. I. Lazarovits, D. Buck, S. Shaw. 1993. Selective expression of integrin 4 ß7 on a subset of human CD4⁺ memory T cells with Hallmarks of gut-trophism. J. Immunol. 151:717.[Abstract]
63. d’Angeac, A. D., S. Monier, D. Pilling, A. Travaglio-Encinoza, T. Reme, M. Salmon. 1994. CD57⁺ T lymphocytes are derived from CD57^- precursors by differentiation occurring in late immune responses. Eur. J. Immunol. 24:1503.[Medline]
64. Mugnaini, E. N., A. Spurkland, T. Egeland, M. Sannes, J. E. Brinchmann. 1998. Demonstration of identical expanded clones within both CD8⁺CD28⁺ and CD8⁺CD28^- T cell subsets in HIV type 1-infected individuals. Eur. J. Immunol. 28:1738.[Medline]
65. Ernst, D. N., W. O. Weigle, M. V. Hobbs. 1993. Aging and lymphokine production by T cell subsets. Stem Cells (Dayton) 11:487.[Medline]
66. Kubo, M., B. Cinader. 1990. Polymorphism of age-related changes in interleukin (IL) production: differential changes of T helper subpopulations, synthesizing IL 2, IL 3 and IL 4. Eur. J. Immunol. 20:1289.[Medline]
67. Thoman, M. L., W. O. Weigle. 1989. The cellular and subcellular bases of immunosenescence. Adv. Immunol. 46:221.[Medline]
68. Inoue, T., Y. Asano, S. Matsuoka, M. Furutani-Seiki, S. Aizawa, H. Nishimura, T. Shirai, T. Tada. 1993. Distinction of mouse CD8⁺ suppressor effector T cell clones from cytotoxic T cell clones by cytokine production and CD45 isoforms. J. Immunol. 150:2121.[Abstract]
69. Erard, F., M. T. Wild, J. A. Garcia-Sanz, G. Le Gros. 1993. Switch of CD8 T cells to noncytolytic CD8^-CD4^- cells that make TH2 cytokines and help B cells. Science 260:1802.[Abstract/Free Full Text]
70. Groux, H., M. Bigler, J. E. de Vries, M. G. Roncarolo. 1996. Interleukin-10 induces a long-term antigen-specific anergic state in human CD4⁺ T cells. J. Exp. Med. 184:19.[Abstract/Free Full Text]
71. Levy, J.. 1997. Cell-mediated immune responses in HIV infection. HIV and the Pathogenesis of AIDS 253. American Society of Microbiology Press, Herndon.

This article has been cited by other articles:

				A Tulunay, S Yavuz, H Direskeneli, and E Eksioglu-Demiralp CD8+CD28-, suppressive T cells in systemic lupus erythematosus Lupus, July 1, 2008; 17(7): 630 - 637. [Abstract] [PDF]

				R. J. Simpson, G. D. Florida-James, C. Cosgrove, G. P. Whyte, S. Macrae, H. Pircher, and K. Guy High-intensity exercise elicits the mobilization of senescent T lymphocytes into the peripheral blood compartment in human subjects J Appl Physiol, July 1, 2007; 103(1): 396 - 401. [Abstract] [Full Text] [PDF]

				W. K. Chiu, M. Fann, and N.-p. Weng Generation and Growth of CD28nullCD8+ Memory T Cells Mediated by IL-15 and Its Induced Cytokines J. Immunol., December 1, 2006; 177(11): 7802 - 7810. [Abstract] [Full Text] [PDF]

				A. Aviv, A. M Valdes, and T. D Spector Human telomere biology: pitfalls of moving from the laboratory to epidemiology Int. J. Epidemiol., December 1, 2006; 35(6): 1424 - 1429. [Abstract] [Full Text] [PDF]

				N. Kobayashi, T. Kondo, H. Takata, S. Yokota, and M. Takiguchi Functional and phenotypic analysis of human memory CD8+ T cells expressing CXCR3. J. Leukoc. Biol., August 1, 2006; 80(2): 320 - 329. [Abstract] [Full Text] [PDF]

				J. S. Sutherland, G. L. Goldberg, M. V. Hammett, A. P. Uldrich, S. P. Berzins, T. S. Heng, B. R. Blazar, J. L. Millar, M. A. Malin, A. P. Chidgey, et al. Activation of Thymic Regeneration in Mice and Humans following Androgen Blockade J. Immunol., August 15, 2005; 175(4): 2741 - 2753. [Abstract] [Full Text] [PDF]

				L. A. Norian and P. M. Allen No Intrinsic Deficiencies in CD8+ T Cell-Mediated Antitumor Immunity with Aging J. Immunol., July 15, 2004; 173(2): 835 - 844. [Abstract] [Full Text] [PDF]

				V. Jankovic, I. Messaoudi, and J. Nikolich-Zugich Phenotypic and functional T-cell aging in rhesus macaques (Macaca mulatta): differential behavior of CD4 and CD8 subsets Blood, November 1, 2003; 102(9): 3244 - 3251. [Abstract] [Full Text] [PDF]

				D. Voehringer, M. Koschella, and H. Pircher Lack of proliferative capacity of human effector and memory T cells expressing killer cell lectinlike receptor G1 (KLRG1) Blood, November 15, 2002; 100(10): 3698 - 3702. [Abstract] [Full Text] [PDF]

				P. Bansal-Pakala and M. Croft Defective T Cell Priming Associated with Aging Can Be Rescued by Signaling Through 4-1BB (CD137) J. Immunol., November 1, 2002; 169(9): 5005 - 5009. [Abstract] [Full Text] [PDF]

				J. Turner, A. A. Frank, and I. M. Orme Old Mice Express a Transient Early Resistance to Pulmonary Tuberculosis That Is Mediated by CD8 T Cells Infect. Immun., August 1, 2002; 70(8): 4628 - 4637. [Abstract] [Full Text] [PDF]

				M. Saurwein-Teissl, T. L. Lung, F. Marx, C. Gschosser, E. Asch, I. Blasko, W. Parson, G. Bock, D. Schonitzer, E. Trannoy, et al. Lack of Antibody Production Following Immunization in Old Age: Association with CD8+CD28- T Cell Clonal Expansions and an Imbalance in the Production of Th1 and Th2 Cytokines J. Immunol., June 1, 2002; 168(11): 5893 - 5899. [Abstract] [Full Text] [PDF]

				C. J. Pitcher, S. I. Hagen, J. M. Walker, R. Lum, B. L. Mitchell, V. C. Maino, M. K. Axthelm, and L. J. Picker Development and Homeostasis of T Cell Memory in Rhesus Macaque J. Immunol., January 1, 2002; 168(1): 29 - 43. [Abstract] [Full Text] [PDF]

				C. Pignata, L. Gaetaniello, A. M. Masci, J. Frank, A. Christiano, E. Matrecano, and L. Racioppi Human equivalent of the mouse Nude/SCID phenotype: long-term evaluation of immunologic reconstitution after bone marrow transplantation Blood, February 15, 2001; 97(4): 880 - 885. [Abstract] [Full Text] [PDF]

				M. Migliaccio, M. Amacker, T. Just, P. Reichenbach, D. Valmori, J.-C. Cerottini, P. Romero, and M. Nabholz Ectopic Human Telomerase Catalytic Subunit Expression Maintains Telomere Length But Is Not Sufficient for CD8+ T Lymphocyte Immortalization J. Immunol., November 1, 2000; 165(9): 4978 - 4984. [Abstract] [Full Text] [PDF]

				K. Wu, N. Higashi, E. R. Hansen, M. Lund, K. Bang, and K. Thestrup-Pedersen Telomerase Activity Is Increased and Telomere Length Shortened in T Cells from Blood of Patients with Atopic Dermatitis and Psoriasis J. Immunol., October 15, 2000; 165(8): 4742 - 4747. [Abstract] [Full Text] [PDF]

				F. F. Fagnoni, R. Vescovini, G. Passeri, G. Bologna, M. Pedrazzoni, G. Lavagetto, A. Casti, C. Franceschi, M. Passeri, and P. Sansoni Shortage of circulating naive CD8+ T cells provides new insights on immunodeficiency in aging Blood, May 1, 2000; 95(9): 2860 - 2868. [Abstract] [Full Text] [PDF]

				J. Zujewski, I. D. Horak, C. J. Bol, R. Woestenborghs, C. Bowden, D. W. End, V. K. Piotrovsky, J. Chiao, R. T. Belly, A. Todd, et al. Phase I and Pharmacokinetic Study of Farnesyl Protein Transferase Inhibitor R115777 in Advanced Cancer J. Clin. Oncol., February 14, 2000; 18(4): 927 - 927. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nociari, M. M. Articles by Russo, C. Search for Related Content PubMed PubMed Citation Articles by Nociari, M. M. Articles by Russo, C.