|
|
||||||||
,
Departments of
*
Medicine and
Immunology and Molecular and Medical Genetics, Division of Respirology, University of Toronto, and
The Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Ontario, Canada
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One of the earliest biochemical events evoked by myeloid cell receptor engagement is the phosphorylation of cellular proteins on serine, threonine, and tyrosine residues 8, 9, 10 . Increases in tyrosine phosphorylation can be elicited by a variety of soluble and particulate stimuli and correlate temporally with the appearance of cellular responses 11, 12, 13 . The importance of tyrosine phosphorylation to leukocyte function is underscored by the observation that inhibitors of protein tyrosine kinases block many microbicidal responses, including adherence 14 , chemotaxis 15 , phagocytosis 16 , and production of reactive oxygen intermediates 13, 17, 18 .
Phosphorylation of tyrosine residues is regulated by the competing activities of protein tyrosine kinases and protein tyrosine phosphatases (PTP).3 In neutrophils, activation of tyrosine kinases occurs following treatment with chemotactic peptides 19 , cytokines 20, 21 , and multiple other ligands 22 and is pivotal to the increased tyrosine phosphorylation observed following stimulation with these agents. Alternatively, decreases in the activity of tyrosine phosphatases may also contribute to an increase in cellular tyrosine phosphorylation following stimulation. Thus, for example, stimulation with the chemoattractant FMLP or with phorbol esters is associated with decreases in global neutrophil phosphotyrosine phosphatase activity, although the identity of the particular phosphatases responsible for this effect has not been determined 23, 24 . Similarly, inhibition of tyrosine phosphatases with vanadate or its peroxides has been shown to potentiate FMLP-induced superoxide production in intact cells 25 and to activate a respiratory burst in electroporated cells 26, 27 , providing additional evidence that a reduction of phosphatase activity may lead to microbicidal responses in neutrophils.
While the importance of PTPs in regulating neutrophil function is
widely acknowledged, little is known about the role of specific
tyrosine phosphatases in modulating the outcome of myeloid leukocyte
signal transduction pathways. Of particular interest in this regard is
the SHP-1 cytosolic PTP, an SH2 domain-containing phosphatase expressed
in leukocytes of myelo-monocytic lineages including HL-60 cells 28 ,
THP-1 cells 29 , and human peripheral blood neutrophils 30 . SHP-1
has now been implicated in the negative regulation of a broad spectrum
of growth-promoting receptors, including receptor tyrosine kinases such
as c-Kit 31, 32 , CSF-1 receptor 33 , TrkA 34 , and epidermal growth
factor 35 receptors; cytokine receptors such as IL-3 31 ,
IFN-
/ß 36 , and erythropoietin 37, 38 receptors; and receptors
of the immune system containing the immune receptor tyrosine-based
inhibitory motif such as CD22 39 and Fc
RIIB 39, 40 . SHP-1
inhibitory effects on receptor tyrosine kinases are mediated by direct
dephosphorylation of the activated receptors 31, 33, 35, 41 , while
its suppression of cytokine receptor signaling is mediated by binding
of the phosphatase to noncatalytic subunits of the receptors and
dephosphorylation of the associated Janus family tyrosine kinase 36, 37 . In some instances, the negative modulatory effects of SHP-1 on
receptor signaling have been linked to its capacity to interact with
multiple receptor and cytosolic signaling effectors. For example SHP-1
down-regulates Ag receptor signaling in T cells by interactions and/or
dephosphorylation of TCR components, the Lck 42, 43 and ZAP-70 44
protein tyrosine kinases, and the guanine exchange factor, Vav 45 .
Similarly, in B cells, SHP-1 binds and probably dephosphorylates the B
cell Ag receptor 45 , Fc
RIIB 46 , Vav 47 , and CD22 39, 48 .
While SHP-1 roles in myeloid cell biology are not yet well defined, the
pivotal role for SHP-1 in regulatory development and function of this
lineage is highlighted by the enormous myelo-monocytic expansion found
in motheaten (me/me) and motheaten viable
(mev/mev) mice, in which
expression of the PTP activity is essentially abrogated
49, 50, 51 .
Accordingly, as a step toward delineating the role of tyrosine phosphatases in initiation and/or modulation of myeloid leukocyte responses, we explored the roles of SHP-1 in myeloid cell signaling by assessing the impact of overexpressing an enzymatically inactive mutant of SHP-1 (SHP-1C453S) on specific functions of the myelo-monocytic cell line U937. In this report we demonstrate that interference with the action of SHP-1 results in enhanced proliferation and diminished apoptosis as well as enhanced adhesion and oxidant production, suggesting that the function of SHP-1 is predominantly signal terminating or down regulating in myeloid cells.
| Materials and Methods |
|---|
|
|
|---|
HEPES, FMLP, PMA, cytochalasin B, zymozan, scopoletin, horseradish peroxidase, and propidium iodide were obtained from Sigma (St. Louis, MO). Calcein-AM was obtained from Molecular Probes (Eugene, OR). H2O2 was purchased from Caledon Laboratories (Toronto, Canada). Recombinant human IL-3 was obtained from R&D Systems (Minneapolis, MN). [3H]Thymidine was obtained from Amersham (Aylesbury, U.K.). Protein A/G Plus agarose was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Zymosan A BioParticles (Texas Red conjugate) was obtained from Molecular Probes. The in situ cell death detection kit was purchased from Boehringer Mannheim (Mannheim, Germany). Plasmid Mini/Midi/Maxi Prep and PCR purification kits were obtained from Qiagen (Hilden, Germany). Lipofectamine and G418 were obtained from Life Technologies (Burlington, Canada).
Antibodies
A glutathione S-transferase (GST) fusion protein of wild-type murine SHP-1 encompassing its two SH2 domains (amino acids 1296) was generated as previously described 50 . The recombinant protein was used to generate polyclonal Abs to SHP-1, which were affinity purified and have been shown to be suitable for immunoblotting and immunoprecipitation 37, 40 . An mAb to SHP-1 was obtained from Transduction Laboratories (Lexington. KY). Monoclonal anti-hemagglutinin (anti-HA) was purchased from BABCO (Richmond, CA). Anti-phosphotyrosine Ab 4G10 and the malachite green tyrosine phosphatase kit were purchased from Upstate Biotechnology (Lake Placid, NY). Anti-phospho Erk Abs were obtained from New England Biolabs (Beverly, MA). Abs to the ß-chain of IL-3R (clone 3D7) were obtained from Dr. Angel Lopez, Cytokine Receptor Laboratory, The Hanson Center for Cancer Research, Institute of Medical and Veterinary Science (Adelaide, Australia).
Cell culture
U937 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in RPMI 1640 medium supplemented with 10% heat-inactivated FBS (Life Technologies).
Construction of mutant SHP-1
A catalytically inactive mutant form of SHP-1 (SHP-1C453S), previously shown to act in a dominant negative fashion 52 , was HA tagged using PCR with synthetic oligonucleotides encoding the desired amino acid residues (5' primer, 5'-ATCAAGCTTATGTACCCATACGATGTTCCTGACTATGCGGTGAGGTCGTTTC ACCGG-3'; 3' primer, 3'-CCCTCCAGATATGTGGCCG-5'). The regions of SHP-1C453S that had been subjected to mutagenesis or HA tagging were sequenced in their entirety using the dideoxynucleotide chain termination method (Sequenase, Pharmacia, Baie dUrfe, Canada). The HindIII/XbaI of fragment the HA-tagged SHP-1C453S was subcloned into the pcDNA3 eukaryotic expression vector for transfection as described below.
Transfection
The pcDNA3 (empty vector) or pcDNA3 containing HA-tagged SHP-1C453S was transfected into monocytic cell line U937 cells using cationic liposomes (Lipofectamine). Two micrograms of plasmid DNA per 5 x 106 cells was used for transfection. Clones were selected in RPMI 1640 medium supplemented with 1 mg/ml G418 using limiting dilution in 96-well plates and were expanded in tissue culture flasks. The expression of the recombinant mRNAs of HA-tagged SHP-1C453S was initially confirmed using RT-PCR with primers bracketing the HA tag sequence and the 5' portion of SHP-1 (see below). Overexpression of HA-tagged SHP-1C453S protein was identified using Western blotting with an anti-HA mAb.
RT-PCR
Total RNA was isolated from the transfected U937 cells using the
guanidinium isothiocyanate-cesium chloride protocol 53, 54 . 5'
primers
(5'-ATCAAGCTTATGTACCCATACGATGTTCCTGACTATGCGGTGAGGTCGTTTCACCGG-3')
and 3' primers (3'-CCCTCCAGATATGTGGCCG-5') were
used to amplify a 400-bp fragment of mRNA of SHP-1 encoding the HA tag
using the Gene Amp RNA PCR kit (Perkin-Elmer/Cetus, Branchburg, NJ).
The PCR products were analyzed by electrophoresis using 1% agarose
gels and were visualized by ethidium bromide staining. Amplification of
a nucleotide sequence encoding IL-1
(PAW109 RNA, Perkin-Elmer/Cetus)
included with the kit, was used as a positive control.
SHP-1 immunoprecipitation and phosphatase assay
Transfected cells were resuspended in 1 ml of ice-cold lysis buffer, (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 x g for 15 min, and supernatants were mixed with 10 µl of polyclonal anti-SHP-1 or anti-HA mAb at 4°C for 2 h and then incubated with 50 µl of protein G/A Plus agarose rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with monoclonal anti-HA or anti-SHP-1 Abs. Tyrosine phosphatase activity was measured in anti-SHP-1 (polyclonal) immunoprecipitates using the malachite green phosphatase assay with phosphopeptide (RRLIEDAEpYAARG, Upstate Biotechnologies). The activity was normalized to the amount of immunoreactive SHP-1 protein as determined by Western blotting of the immunoprecipitates with anti-SHP-1 mAbs followed by densitometric analysis as described below. The intensity of the SHP-1 band in each sample was determined using IP Lab Gel-D10. The latter was calibrated by running varying amounts of recombinant GST-SHP-1 fusion protein on the same blot to ensure that samples were in the linear range of the x-ray film. The specific SHP-1 activities were calculated by dividing the phosphatase activity (OD from malachite green assay) by the intensity of the SHP-1 band from Western blots.
CD45 immunoprecipitation and phosphatase assay
Cells were resuspended in 1 ml of ice-cold lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 x g for 15 min, and supernatants were mixed with 10 µl of anti-CD45 mAb (clone GAP 8.3, American Type Tissue Collection) at 4°C for 2 h and then incubated with 50 µl of protein G/A Plus agarose, with rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with anti-CD45 mAbs. Tyrosine phosphatase activity was measured in anti-CD45 immunoprecipitates using para-nitrophenylphosphate as the substrate as previously described 55 .
Stimulation of cell and assay for tyrosine phosphorylation
The transfected cells were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h, followed by stimulation of 1 x 106 cells with IL-3 (50 ng/ml) at 37°C for 110 min. The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM sodium vanadate). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using a bicinchoninic acid protein kit (Pierce, Rockford, IL), and equal amounts of protein were subjected to SDS-PAGE and Western blotting with anti-phosphotyrosine (4G-10) mAb.
Immunoprecipitation of the IL-3R ß subunit and analysis of tyrosine phosphorylation
U937 cells transfected with either empty vector or with HA-SHP-1C453S were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h. Subsequently 2 x 107 cells were stimulated with IL-3 (100 ng/ml) at 37°C for 10 min. The cells were pelleted by centrifugation and resuspended in lysis buffer (50 mM Tris-HCl (pH 7.5), 10% (v/v) glycerol, 1% (v/v) Nonidet P-40, 150 mM NaCl, 5 mM EDTA, 1 mM sodium vanadate, 10 mM sodium fluoride, 1 mM sodium molybdate, 40 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml soybean trypsin inhibitor, 10 µg/ml leupeptin, and 0.7 µg/ml pepstatin) followed by centrifugation at 10,000 x g for 15 min in a microfuge. The amount of protein in supernatant was measured using a BCA protein kit (Pierce), and supernatants containing equal amounts of protein were mixed with 10 µg of an mAb (3D7) against human IL-3 ß subunit (ßc) and incubated with rotation for 2 h at 4°C. Fifty microliters of a slurry of protein G/A Plus agarose was then added to each sample and incubated with rotation overnight at 4°C. The beads were washed four times in lysis buffer, boiled in Laemmli sample buffer, and analyzed by SDS-PAGE and Western blotting with anti-phosphotyrosine mAb (4G-10, Upstate Biotechnology).
SDS-PAGE and Western blotting analysis
The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using bicinchoninic acid protein kit (Pierce). Equal amounts of protein were loaded onto each lane sample and separated by SDS-PAGE using either 420% gradient or 8 or 10% linear polyacrylamide gels and subsequently transferred to nitrocellulose membrane (Protran, Schleicher & Schuell, Toronto, Canada). Immunoblots were blocked in PBS (pH 7.4) containing 2% skim milk, 0.5% Tween-20, or 0.1% Tris buffer (pH 9.0) containing 0.25% gelatin and 10% ethanol amine (for tyrosine phosphorylation only) and incubated with mAbs (anti-HA, anti-SHP-1, or anti-phosphotyrosine as indicated) for 2 h at room temperature. The washed membranes were incubated with horseradish peroxidase-conjugated anti-mouse Ig and developed using enhanced chemiluminescence according to the manufacturers instructions (Amersham).
Growth kinetics and DNA synthesis
Cells (1 x 105/ml) from each clone were seeded in 12-well tissue culture plates and serum starved for 24 h followed by addition of either 20% FBS or IL-3 (50 ng/ml). [3H]thymidine (1 µCi/ml) was added at the specified times over a 24-h period followed by incubation for an additional 8 h before analysis. Experiments were performed in triplicate. Cell numbers were counted in triplicate at 24-h intervals for a period of 72 h using a hemocytometer.
Cell cycle analysis
Cells (2 x 105) from each clone were serum starved for 24 h followed by addition of 20% FBS for an additional 3 h. The cells were fixed in 75% ethanol for 30 min and stained in propidium iodide buffer containing PBS, 1.2% Nonidet P-40, 50 µg/ml propidium iodide, and 1 mg/ml RNase for 30 min. Cell cycle analysis (G0/G1, S, G2/M) was conduced according to published methods 56 using flow cytometry.
Analysis of apoptosis
For flow cytometric analysis, cells serum starved for 24 h were resuspended in 1.5 ml of hypotonic fluorochrome solution (50 µg/ml propidium iodide, 0.1% sodium citrate, and 0.1% Triton X-100) for 30 min and analyzed by flow cytometry to detect apoptotic cells. For in situ detection of apoptosis, cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 30 min and permeabilized by incubation in permeabilization solution (0.1% sodium citrate and 0.1% Triton X-100) for 2 min on ice. Cells were then incubated with the terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling (TUNEL) reaction mixture (Boehringer Mannheim) at 37°C for 60 min, viewed by fluorescence microscopy using a Leitz OrthoPlan microscope (Leitz, Rockleigh, NJ) and photographed using Elite 100 (Eastman Kodak, Rochester, NY) film.
Measurement of oxidative burst
Cells (1 x 106) were placed in sterile polypropylene microfuge tubes that had been previously coated with FBS and incubated in 2 ml sodium buffer (140 mM NaCl, 4 mM KCl, 10 mM glucose, 10 mM HEPES, 1 mM MgCl2, and 1 mM CaCl2, pH 7.4, at 37°C) containing 10-7 PMA or 0.1% DMSO (vehicle control), 10.4 µM scopoletin, 9.6 U/ml horseradish peroxidase, and 4 mM sodium azide at 37°C for 2 h 57 . A reduction in fluorescence of scopoletin was quantified by a Hitachi F-2000 fluorescence spectrophotometer (Hitachi, Hialeah, FL), using an excitation wavelength of 365 nm and an emission wavelength of 473 nm. Standard curves were generated using known amounts of H2O2.
Phagocytosis
The phagocytic ability of U937 cells was assayed by incubating opsonized zymosan with cells in the presence of the permeant fluid phase marker Lucifer Yellow as previously described 58 . Cells (3 x 105) were allowed to settle on glass coverslips for 30 min at room temperature. To synchronize phagocytosis, the serum-opsonized zymosan (6 x 105 particles) was added to cells and allowed to bind for 10 min at 4°C. The temperature was then rapidly raised to 37°C, and incubation proceeded for 10 min in the presence of 2 mg/ml Lucifer Yellow. The coverslips were cooled in an ice-water bath, and the number of phagosomes was counted using a fluorescence microscope (Nikon, Melville, NY).
Chemotaxis
Chemotaxis was measured using a micro-Boyden chamber (Neuroprobe, Cabin John, MD). The chamber consists of two wells separated from each other by filter paper. The chemoattractant (10-410-7 M FMLP in HEPES-buffered RPMI with 1% BSA at pH 7.4) was placed in the bottom well, a 0.45-µm pore size trap filter placed above, followed by a 3-µm chemotaxis filter. The top chamber was secured in place, and the cells were added in HEPES-buffered RPMI with 1% BSA (3 x 105 cells/well). The chamber was incubated at 37°C for 2 h; the trap filter was removed, fixed, and stained with hematoxylin; and the number of cells present was counted.
Flow cytometric analysis of CD18 expression
Cells (1 x 106) were fixed with 1.6% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20% goat serum for 30 min to block nonspecific binding. Cells were washed and then incubated with 10 µg/ml anti-CD18 Ab (IB4) for 1 h at 4°C, washed, and incubated with FITC-labeled goat anti-mouse IgG Ab. Cells were washed, resuspended in PBS, and analyzed by flow cytometry (FACStar, Becton Dickinson, Mountain View, CA). The geometric mean of the FL-1 channel was recorded.
Flow cytometric analysis of Fc
receptor expression
Cells (1 x 106) were fixed with 1.6%
paraformaldehyde for 15 min at room temperature, washed, and then
incubated with 20% goat serum for 30 min to block nonspecific binding.
Cells were washed twice; then incubated with mouse anti-human
Fc
RI (32.2 (Fab')2, Medarex, Lebanon, NH), mouse
anti-human Fc
RII (IV.3, Medarex) or mouse anti-human
Fc
RIII (3G8, F(ab')2, Medarex) for 2 h at 4°C,
washed, and incubated with secondary FITC-labeled goat anti-mouse
Ab. Cells were washed twice, resuspended in PBS, and analyzed by flow
cytometry (FACStar, Becton Dickinson) as described above. The geometric
mean of the FL-1 channel was recorded.
Adhesion assay
U937 cells (2 x 107) were labeled with 1.5 µM calcein-AM for 20 min at 37°C with gentle agitation followed by washing and resuspension in sodium buffer. Subsequently cells were pretreated with or without blocking anti-CD18 Abs (IB4; 44 µg/ml) for 1 h at 4°C, then added to 24-well tissue culture plates (5 x 105 cells/well) precoated with FBS and incubated for an additional 2 h at 37°C in 5% CO2 in a humidified incubator. Each assay was performed in quadruplicate. After incubation, cells were fixed with paraformaldehyde (1.6%) for 40 min at room temperature and then wells were washed twice with PBS using a gravity washing device. Calcein was extracted by adding methanol to the remaining adherent cells followed by vigorous pipetting. Fluorescence was detected using a Hitachi F-2000 fluorescence spectrophotometer with an excitation wavelength of 490 nm and an emission wavelength of 520 nm. All values were normalized to the number of cells added determined by measuring the mean fluorescence of three separate aliquots of 5 x 105 calcein-AM-labeled cells by methanol extraction.
| Results |
|---|
|
|
|---|
The tyrosine phosphatase SHP-1 has been implicated in the
regulation of signaling pathways involved in growth, differentiation,
and activation of cells of hemopoietic lineage. To investigate the
functional importance of SHP-1 in myeloid leukocytes, we derived stable
clones of a myelo-monocytic cell line U937 expressing recombinant
SHP-1, enzymatically inactivated by substitution of the highly
conserved cysteine residue in the catalytic domain for serine
(SHP-1C453S). To distinguish recombinant from endogenous
SHP-1, the protein was tagged with an HA epitope at the NH2
terminus. The construct was ligated into the pcDNA3 vector and
transfected into U937 cells, and a total of 21 G418-resistant clones
were isolated and expanded. Clones expressing HA-SHP-1C453S
were identified by RT-PCR using primers bracketing a 400-bp fragment
encompassing the HA tag and NH2 terminus of SHP-1. As
illustrated in Fig. 1
, this analysis
revealed a PCR product of the predicted size to be present in clones
transfected with pcDNA3 containing the HA- SHP-1C453S
insert but absent in clones transfected with vector alone. However, as
estimated by the amount of amplification product detectable, the levels
of HA-SHP-1C453S mRNA expression were variable among the
transfectants.
|
|
|
As SHP-1 has been shown to play key roles in the regulation
of signaling pathways involved in cell growth, the impact of expressing
catalytically inactive SHP-1 on the growth of U937 cells was assessed
by comparing the growth kinetics of two clones overexpressing
HA-SHP-1C453S and those of two clones transfected with
vector alone. As illustrated in Fig. 4
,
a and b, following 24-h serum starvation followed
by reintroduction of serum, both proliferation and thymidine
incorporation were substantially increased in clones expressing
HA-SHP-1C453S compared with those in control cells. Cell
cycle analysis by flow cytometry using propidium iodide staining
demonstrated that a higher proportion of cells in clones overexpressing
HA-SHP-1C453S were in S phase after serum stimulation
compared with control cells (Fig. 4
, df). As serum
contains a plethora of factors that potentially promote cell
proliferation, it was of interest to study the effects of a single
stimulating agent to ascertain whether reduction of SHP-1 activity
would still be associated with enhanced proliferation. As SHP-1 has
been shown to bind to the ß-chain of IL-3R 59 and to suppress
IL-3-dependent cell growth in other cell types 31 , the effects of
HA-SHP-1C453S overexpression on IL-3-induced proliferation
were also investigated. For these experiments, cells were serum starved
for 24 h followed by incubation in serum-free medium containing 50
ng/ml IL-3 and 1 µCi/ml [3H]thymidine for 8 h.
As illustrated in Fig. 4
c, [3H]thymidine
incorporation in response to IL-3 stimulation was again increased in
clones overexpressing HA-SHP-1C453S relative to that in
control clones.
|
Expansions of cell populations following various growth stimuli
are known to reflect the net effects of both proliferation and death
rate. Accordingly, the possible relevance of SHP-1 to regulation of
cell death was studied by comparing rates of apoptosis in clones
overexpressing HA-SHP-1C453S and control clones. Apoptosis
was examined after 24 h of serum starvation by both flow cytometry
using propidium iodide staining and terminal deoxynucleotidyl
transferase in situ labeling. As shown in Fig. 5
, a and b, the
results of both assays revealed diminished rates of apoptosis in clones
overexpressing HA-SHP-1C453S compared with control cells,
suggesting that reduced rates of death might contribute to enhanced
growth of the HA-SHP-1C453S cell population.
|
The microbicidal function of myeloid cells is dependent on
their ability to produce reactive oxygen intermediates such as
O2zbe- and H2O2 and to secrete
lytic enzymes. The production of reactive oxygen intermediates is, in
turn, mediated by a multicomponent enzyme complex, termed the NADPH
oxidase, that is known to be functional in U937 cells 60 . To
determine the importance of SHP-1 in the regulation of this important
effector function, the production of H2O2 was
compared in clones overexpressing HA-SHP-1C453S and in
controls. As illustrated in Fig. 6
,
clones overexpressing HA-SHP-1C453S displayed increased
oxidant production compared with controls after treatment with the
phorbol ester PMA, a direct activator of protein kinase C and a potent
agonist of the NADPH oxidase 58 . The effects on oxidant production of
other agonists including the formyl peptide FMLP, the phagocytic
stimulus-opsonized zymosan, and cross-linking of Fc
RI receptors 61
were also studied in these cells, but none of these agents induced a
significant increase in oxidant production in either the control or
HA-SHP-1C453S-overexpressing clones (not illustrated).
|
Adhesive interactions between leukocytes and endothelial cells are
paramount in the emigration of circulating PMN from the blood into
inflamed tissues 62, 63 . To determine the importance of SHP-1 in
regulation of this important leukocyte function,
HA-SHP-1C453S-overexpressing and control cells were
compared with respect to their adhesion to serum-coated plastic
following treatment with the phorbol ester PMA, FMLP, or C5a, known
stimuli for leukocyte adhesion 64, 65, 66 . Fig. 7
, a and b,
illustrate that clones overexpressing HA-SHP-1C453S
displayed increased adhesion to serum-coated plastic compared with
controls. As adhesion of myeloid leukocytes to extracellular matrix
proteins is mediated predominantly by ß2 integrins 67, 68 , the HA-SHP-1C453S-overexpressing cells and control
clones were also evaluated for surface expression of CD18 by flow
cytometry using IB4, a mAb that recognizes the common ß-chain (CD18)
69 . As illustrated in Fig. 7
c, this analysis revealed CD18
expression to be relatively increased in the clones overexpressing
HA-SHP-1C453S. To ensure that the enhanced adhesion of the
HA-SHP-1C453S-overexpressing clones was, in fact,
ß2 integrin mediated, adhesion was assayed in the
presence of the blocking anti-CD18 Ab, IB4. As shown in Fig. 7
b, this analysis revealed adhesiveness of
HA-SHP-1C453S-overexpressing cells to be diminished in the
presence of IB4 to a level indistinguishable from that detected in
clones transfected with vector alone. In addition, the basal adhesion
of the clones transfected with vector alone was diminished by this Ab,
suggesting that a portion of the basal adhesion of these U937 cells was
mediated by ß2 integrins.
|
RI, -RII, and -RIII, which are known to be expressed on
myeloid cells. Fig. 8
RII but no alteration in
the level of expression of Fc
RI or -RIII. This enhanced surface
expression of Fc
RII had no effect on phagocytosis of serum-opsonized
zymosan (not shown).
|
| Discussion |
|---|
|
|
|---|
by the alveolar macrophages 72, 73 . Our recent
data revealing high levels of SHP-1 expression in human peripheral
blood neutrophils 30 also emphasizes the potential importance of this
signal terminating molecule to the regulation of neutrophil-mediated
tissue inflammation and damage. Together these observations support the
contention that unregulated leukocyte activation plays a fundamental
etiological role in the pathogenesis of human diseases characterized by
pulmonary inflammation and underscore the importance of signaling
effectors and pathways that constrain the inflammatory process. For the purposes of this study, an enzymatically inactive dominant negative form of recombinant SHP-1 was expressed in U937 cells, a myelomonocytic cell line that exhibits some of the functional attributes of human peripheral blood leukocytes. We also attempted to express wild-type SHP-1 in these cells, but were unable to isolate stable overexpressing transfectants, possibly because of detrimental effects to cell growth/viability. To address the issue of specificity, clones overexpressing HA-SHP-1C453S and wild-type controls cells were also compared with respect to the activity of another tyrosine phosphatase, CD45, but this PTP activity was found to be comparable in the mutant and wild-type cell populations (data not shown). We have also recently observed that bone marrow-derived neutrophils from motheaten and viable motheaten mice are hyperadhesive compared with cells from congenic controls wild-type mice (G. P. Downey and K. A. Siminovitch, manuscript in preparation). Together these data suggest that the phenotypic alterations observed in the HA-SHP-1C453S-transfected U937 cell lines also occur in vivo in conjunction with loss of SHP-1 function and are thus relevant to the normal regulation of myeloid cell function.
The capacity of SHP-1 to down-regulate mitogenic signaling cascades has been demonstrated in many cellular systems and involves modulation of a diversity of receptors. Enhanced expression of SHP-1 has been shown, for example, to attenuate IL-3-induced tyrosine phosphorylation in DA-3 cells 31 , a finding that appears to reflect IL-3-induced SHP-1 binding to the IL-3R ß-chain and consequent ß-chain dephosphorylation 31 . Similarly, impaired SHP-1 activity is associated with hyperproliferative responses to IL-3 and erythropoietin in DA3 cells 74 and with IL-2-independent growth of transformed T cells 75 . This latter effect again appears to reflect the capacity of SHP-1 to associate with a cytokine receptor (i.e., the IL-2R) and to dephosphorylate the ß-chain of the activated receptor, leading, in turn, to diminished phosphorylation of the associated Janus family tyrosine kinases JAK1 and JAK3 75 . These observations thus indicate a pivotal role for SHP-1 in down-regulating activation signals transduced through the IL-2 and IL-3 receptors, as is again consistent with the profound expansion of granulocytes and macrophages found in SHP-1-deficient motheaten mice. The motheaten phenotype appears to also reflect the capacity of SHP-1 to inhibit proliferative signals evoked through a number of other growth factor receptors. These include, for example, the c-Kit tyrosine kinase receptor, which transduces a hyperproliferative response to Kit ligand in motheaten bone marrow progenitor cells and appears subject to SHP-1-mediated suppression in relation to its role in promoting macrophage and granulocyte development 32, 43 . Along similar lines, macrophages from motheaten mice show enhanced proliferative responses to granulocyte-macrophage CSF 76 and CSF-1 and display CSF-1R hyperphosphorylation in response to CSF-1 stimulation 33 . These effects appear to reflect the capacity of SHP-1 to directly dephosphorylate activated receptors 31, 33, 35, 41 and/or dephosphorylate the associated Janus tyrosine kinases 36, 37 , or other components of receptor signaling complexes 39, 40, 42, 43, 44, 45, 47, 48, 77 . Based on these findings, the effects of HA-SHP-1C453S overexpression on protein tyrosine phosphorylation were directly investigated in the current study. However, no differences were detected between the HA-SHP-1C453S transfectants and wild-type cells with respect to either IL-3-induced global or IL-3R ß-chain tyrosine phosphorylation (data not shown). Thus, the biochemical basis for the altered physiologic properties of the HA-SHP-1C453S cells remain unclear. However, SHP-1 has been shown to bind to a plethora of other signaling effectors, including, for example, Grb-2 33 , Cbl, STAT3, STAT5a, STAT5b, Shc, the p85 subunit of phosphoinositide 3-kinase, Vav, and the Ras-GTPase-activating protein 78 . SHP-1 has also been recently shown to associate with a 130-kDa tyrosyl-phosphorylated species (P130) in macrophages that is comprised of two transmembrane glycoproteins, PIR-B/p91A and the signal regulator protein family member brain Ig-like molecule with tyrosine-based activation motifs 79 . These latter proteins may be substrates for SHP-1 because they are hyperphosphorylated in macrophages from motheaten viable mice. However, further investigations are currently underway to determine which of these various SHP-1-protein interactions accounts for the effects of SHP-1 on myeloid cell behavior.
The association of impaired SHP-1 function with a diminution in cell death rate, as observed in the current study, has important implications for the regulation of the inflammatory process. In an inflammatory response evoked by bacterial infection, for example, prolongation of phagocytic cell survival might be expected to facilitate the killing of invading microbes. By contrast, in the context of inflammatory-mediated tissue damage such as the systemic inflammatory response syndrome 80 , the persistence of tissue neutrophilia might be deleterious. Accordingly, regulation of the survival/death rates of inflammatory cells is likely to have significant physiologic ramifications 81 . Involvement of SHP-1 in the regulation of myeloid cell apoptosis also raises the possibility that a reduction in spontaneous apoptosis contributes to the granulocyte and macrophage expansion observed in motheaten mice. A role for SHP-1 in the regulation of lymphocyte apoptosis also appears likely in view of the pivotal role for SHP-1 in regulating signaling through the Ag receptors and various Ag receptor comodulators. This possibility is supported by recent data from our group linking SHP-1 to the regulation of activation-induced cell death of peripheral T cells 82 . At present, however, the mechanisms by which SHP-1 realizes its effects on spontaneous or induced apoptotic signaling cascades remain unclear.
The hyperadhesiveness of the HA-SHP-1C453S-overexpressing clones suggests that SHP-1 is also involved in regulating the adherence properties of leukocytes. The enhanced surface expression of the ß2 integrin common ß-chain in concert with the blocking effects of an anti-CD18 mAb suggest that the enhanced adhesiveness of these clones is mediated by effects on the ß2 integrins. Myeloid cell hyperadhesiveness might also contribute to the massive accumulation of myeloid cells in the tissues of motheaten mice 49, 50, 51 , particularly since the inflammatory infiltration in these mice can be partially ameliorated by treatment with anti-CD11b (5C6) Ab 83 . However, the mechanism(s) by which SHP-1 influences CD11/CD18 function and cell adhesion remain to be elucidated, particularly since the role of tyrosine phosphorylation in modulating ß2 integrin functions remains uncertain 84, 85 . In this regard, it is noteworthy that SHP-1 has recently been shown to associate with tyrosine-phosphorylated PECAM-1 86 and with several molecules found in adhesion complexes, including paxillin, vimentin, and filamentous actin in CSF-1-stimulated macrophages 78 . The relevance of these observations in relation to the role of SHP-1 in cell adhesion, however, are not clear. Interestingly, several other protein tyrosine phosphatases have also been implicated in the regulation of cell-cell and cell-substrate adhesion 87, 88 . For example, the closely related PTP SHP-2 appears to play an important role in ß1 integrin-mediated activation of mitogen-activated protein kinase 89 , and the leukocyte tyrosine phosphatase CD45 is required for the maintenance of integrin-mediated adhesion in murine bone marrow macrophages 90 . Together, these data suggest that modulation of cell adhesion represents another mechanism by which SHP-1 influences myeloid cell behavior.
In addition to the other functional changes associated with HA-SHP-1C453S overexpression, oxidant production was increased in the transfected cells. This observation suggests the involvement of SHP-1 in regulating leukocyte NADPH oxidase, a multicomponent enzyme complex that transfers a single electron from NADPH to molecular oxygen, resulting in the production of superoxide (O2-) 91 . Although the signaling pathways leading to activation of NADPH oxidase remain to be clarified, tyrosine phosphorylation appears to be relevant to the process, as increases in tyrosine phosphorylation correlate temporally with activation of the oxidase 13 . Additionally, inhibitors of protein tyrosine kinases block the production of reactive oxygen intermediates 13, 18 . There is also evidence that PTPs negatively regulate activation of NADPH oxidase; inhibition of tyrosine phosphatases with vanadate or its peroxides has been shown to potentiate FMLP-induced superoxide production in whole cells and to activate a respiratory burst in electroporated cells 25, 26, 27 . Taken together, these observations indicate that tyrosine phosphatases, including SHP-1, are likely to play important roles in regulation of the leukocyte NADPH oxidase.
In conclusion, our studies demonstrate that the SH2 domain containing tyrosine phosphatase SHP-1 plays a pivotal role in the regulation of a multiplicity of signaling pathways regulating the growth, differentiation, and activation of myeloid leukocytes. Unregulated release of leukocyte-derived cytotoxic compounds has been implicated in a variety of disorders characterized by inflammatory tissue injury such as arthritis, ischemia reperfusion injury, and acute lung injury 4, 5, 6, 7 , and the potential for SHP-1 to limit leukocyte activation in these circumstances therefore suggests pivotal roles for SHP-1 in relation to a broad spectrum of disease pathophysiology. By extension, reduced activity of signal-terminating molecules such as SHP-1 may result in an imbalance of inflammatory cascades so as to predispose to potentially catastrophic consequences, such as the systemic inflammatory response syndrome and acute lung injury.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Gregory P. Downey, Clinical Sciences Division, Room 6264 Medical Sciences Building, University of Toronto, 1 Kings College Circle, Toronto, Ontario, Canada M5S 1A8. E-mail address: ![]()
3 Abbreviations used in this paper: PTP, protein tyrosine phosphatase; SHP-1, SH2-containing phosphatase-1; HA, hemagglutinin; TUNEL, terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling. ![]()
Received for publication July 30, 1998. Accepted for publication December 11, 1998.
| References |
|---|
|
|
|---|
2 is involved in the activation of phosphoinositide hydrolysis by Fc receptors in human neutrophils. Biochem. Biophys. Res. Commun. 201:1100.[Medline]
-receptor-mediated phagocytosis of human neutrophils. J. Biochem. 117:1156.
/ß interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 15:7050.[Abstract]
(1) upon B cell activation. J. Exp. Med. 183:547.
RIIB-mediated inhibition of B cell antigen receptor activation. J. Biol. Chem. 272:20038.
RIIB1. Science 268:293.
on the induction of NADPH oxidase by retinoic acid or 1,25(OH)2-vitamin D3 in monocytic U937 cells. Biochim. Biophys. Acta 1269:25.[Medline]
RI receptor signals through the activation of hck and MAP kinase. J. Immunol. 154:4039.[Abstract]
in the spontaneous development of pulmonary fibrosis in viable motheaten mutant mice. Am. J. Pathol. 151:1303.[Abstract]
This article has been cited by other articles:
![]() |
Y. Wu, K. Tworkoski, M. Michaud, and J. A. Madri Bone Marrow Monocyte PECAM-1 Deficiency Elicits Increased Osteoclastogenesis Resulting in Trabecular Bone Loss J. Immunol., March 1, 2009; 182(5): 2672 - 2679. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lindsey, W. Huang, H. Wang, E. Horvath, C. Zhu, and E. A. Eklund Activation of SHP2 Protein-tyrosine Phosphatase Increases HoxA10-induced Repression of the Genes Encoding gp91PHOX and p67PHOX J. Biol. Chem., January 26, 2007; 282(4): 2237 - 2249. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Huang, G. Saberwal, E. Horvath, C. Zhu, S. Lindsey, and E. A. Eklund Leukemia-Associated, Constitutively Active Mutants of SHP2 Protein Tyrosine Phosphatase Inhibit NF1 Transcriptional Activation by the Interferon Consensus Sequence Binding Protein. Mol. Cell. Biol., September 1, 2006; 26(17): 6311 - 6332. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Q. Liu, P. K. Alkema, C. Tieche, B. J. Tefft, D. Z. Liu, Y. C. Li, B. E. Sumpio, J. A. Caprini, and M. Paniagua Negative Regulation of Monocyte Adhesion to Arterial Elastic Laminae by Signal Regulatory Protein {alpha} and Src Homology 2 Domain-containing Protein-Tyrosine Phosphatase-1 J. Biol. Chem., November 25, 2005; 280(47): 39294 - 39301. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. von Gunten, S. Yousefi, M. Seitz, S. M. Jakob, T. Schaffner, R. Seger, J. Takala, P. M. Villiger, and H.-U. Simon Siglec-9 transduces apoptotic and nonapoptotic death signals into neutrophils depending on the proinflammatory cytokine environment Blood, August 15, 2005; 106(4): 1423 - 1431. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Krotz, B. Engelbrecht, M. A. Buerkle, F. Bassermann, H. Bridell, T. Gloe, J. Duyster, U. Pohl, and H.-Y. Sohn The Tyrosine Phosphatase, SHP-1, Is a Negative Regulator of Endothelial Superoxide Formation J. Am. Coll. Cardiol., May 17, 2005; 45(10): 1700 - 1706. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, E. Jimi, and A. L. M. Bothwell Receptor Activator of NF-{kappa}B Ligand Stimulates Recruitment of SHP-1 to the Complex Containing TNFR-Associated Factor 6 That Regulates Osteoclastogenesis J. Immunol., October 1, 2003; 171(7): 3620 - 3626. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. Cayabyab, F. W. L. Tsui, and L. C. Schlichter Modulation of the ERG K+ Current by the Tyrosine Phosphatase, SHP-1 J. Biol. Chem., December 6, 2002; 277(50): 48130 - 48138. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Eklund, I. Goldenberg, Y. Lu, J. Andrejic, and R. Kakar SHP1 Protein-tyrosine Phosphatase Regulates HoxA10 DNA Binding and Transcriptional Repression Activity in Undifferentiated Myeloid Cells J. Biol. Chem., September 20, 2002; 277(39): 36878 - 36888. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vitale, C. Romagnani, A. Puccetti, D. Olive, R. Costello, L. Chiossone, A. Pitto, A. Bacigalupo, L. Moretta, and M. C. Mingari Surface expression and function of p75/AIRM-1 or CD33 in acute myeloid leukemias: Engagement of CD33 induces apoptosis of leukemic cells PNAS, April 18, 2001; (2001) 91097198. [Abstract] [Full Text] |
||||
![]() |
R. D. Chernock, R. P. Cherla, and R. K. Ganju SHP2 and cbl participate in {alpha}-chemokine receptor CXCR4-mediated signaling pathways Blood, February 1, 2001; 97(3): 608 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kruger, J. R. Butler, V. Cherapanov, Q. Dong, H. Ginzberg, A. Govindarajan, S. Grinstein, K. A. Siminovitch, and G. P. Downey Deficiency of Src Homology 2-Containing Phosphatase 1 Results in Abnormalities in Murine Neutrophil Function: Studies in Motheaten Mice J. Immunol., November 15, 2000; 165(10): 5847 - 5859. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Beghini, C. B. Ripamonti, P. Peterlongo, G. Roversi, R. Cairoli, E. Morra, and L. Larizza RNA hyperediting and alternative splicing of hematopoietic cell phosphatase (PTPN6) gene in acute myeloid leukemia Hum. Mol. Genet., September 1, 2000; 9(15): 2297 - 2304. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Berg, K. A. Siminovitch, and E. R. Stanley SHP-1 Regulation of p62DOK Tyrosine Phosphorylation in Macrophages J. Biol. Chem., December 10, 1999; 274(50): 35855 - 35865. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, A.-K. Somani, D. Yuen, Y. Yang, P. E. Love, and K. A. Siminovitch Involvement of the SHP-1 Tyrosine Phosphatase in Regulation of T Cell Selection J. Immunol., September 15, 1999; 163(6): 3012 - 3021. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Ganju, S. A. Brubaker, R. D. Chernock, S. Avraham, and J. E. Groopman beta -Chemokine Receptor CCR5 Signals through SHP1, SHP2, and Syk J. Biol. Chem., June 2, 2000; 275(23): 17263 - 17268. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kautz, R. Kakar, E. David, and E. A. Eklund SHP1 Protein-tyrosine Phosphatase Inhibits gp91PHOX and p67PHOX Expression by Inhibiting Interaction of PU.1, IRF1, Interferon Consensus Sequence-binding Protein, and CREB-binding Protein with Homologous Cis Elements in the CYBB and NCF2 Genes J. Biol. Chem., October 5, 2001; 276(41): 37868 - 37878. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Kruger, T. Fukushima, V. Cherepanov, N. Borregaard, C. Loeve, C. Shek, K. Sharma, A. K. Tanswell, C.-W. Chow, and G. P. Downey Protein-tyrosine Phosphatase MEG2 Is Expressed by Human Neutrophils. LOCALIZATION TO THE PHAGOSOME AND ACTIVATION BY POLYPHOSPHOINOSITIDES J. Biol. Chem., January 18, 2002; 277(4): 2620 - 2628. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vitale, C. Romagnani, A. Puccetti, D. Olive, R. Costello, L. Chiossone, A. Pitto, A. Bacigalupo, L. Moretta, and M. C. Mingari Surface expression and function of p75/AIRM-1 or CD33 in acute myeloid leukemias: Engagement of CD33 induces apoptosis of leukemic cells PNAS, May 8, 2001; 98(10): 5764 - 5769. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |