The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, Q.
Right arrow Articles by Downey, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, Q.
Right arrow Articles by Downey, G. P.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells
The Journal of Immunology, 1999, 162: 3220-3230.
Copyright © 1999 by The American Association of Immunologists

Negative Regulation of Myeloid Cell Proliferation and Function by the SH2 Domain-Containing Tyrosine Phosphatase-11

Qin Dong*, Katherine A. Siminovitch{dagger},{ddagger}, Lea Fialkow*, Takeyasu Fukushima* and Gregory P. Downey2,*

Departments of * Medicine and {dagger} Immunology and Molecular and Medical Genetics, Division of Respirology, University of Toronto, and {ddagger} The Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Ontario, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The SH2 domain containing tyrosine phosphatase SHP-1 has been implicated in the regulation of a multiplicity of signaling pathways involved in hemopoietic cell growth, differentiation, and activation. A pivotal contribution of SHP-1 in the modulation of myeloid cell signaling cascades has been revealed by the demonstration that SHP-1 gene mutation is responsible for the overexpansion and inappropriate activation of myelomonocytic populations in motheaten mice. To investigate the role of SHP-1 in regulation of myeloid leukocytes, an HA epitope-tagged dominant negative (interfering) SHP-1 (SHP-1C453S) was expressed in the myelo-monocytic cell line U937 using the pcDNA3 vector. Overexpression of this protein in SHP-1C453S transfectants was demonstrated by Western blot analysis and by detection of decreased specific activity. Growth, proliferation, and IL-3-induced proliferative responses were substantially increased in the SHP-1C453S-overexpressing cells relative to those in control cells. The results of cell cycle analysis also revealed that the proportion of cells overexpressing SHP-1C453S in S phase was greater than that of control cells. The SHP-1C453S-expressing cells also displayed diminished rates of apoptosis as detected by flow cytometric analysis of propidium iodide-stained cells and terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling assay. While motility and phagocytosis were not affected by SHP-1C453S overexpression, adhesion and the oxidative burst in response to PMA were enhanced in the SHP-1C453S compared with those in the vector alone transfectants. Taken together, these results suggest that SHP-1 exerts an important negative regulatory influence on cell proliferation and activation while promoting spontaneous cell death in myeloid cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leukocytes of myeloid lineage, including neutrophils, monocytes, and macrophages, contribute to host defense primarily through destruction of pathogenic microorganisms. This functional role is achieved through a series of rapid and coordinated responses that include chemotaxis, phagocytosis, secretion of a variety of granules/vesicles, and production of reactive oxygen intermediates 1, 2 . These responses are initiated by the interaction of cell surface receptors with specific ligands found on microbial targets or in the inflammatory milieu and the consequent induction of intracellular signaling pathways that couple such activating stimuli to physiological responses 1, 2, 3 . Paradoxically, these same cellular and biochemical events may also damage host tissues, as is evident in arthritis, ischemia-reperfusion, sepsis, acute lung injury, and other conditions associated with unregulated activation of the inflammatory response 4, 5, 6, 7 . Thus, to maintain homeostasis and minimize tissue damage, leukocyte microbicidal responses must be tightly regulated by processes including selective triggering and rapid termination of activation cascades once the initial stimulus has been removed.

One of the earliest biochemical events evoked by myeloid cell receptor engagement is the phosphorylation of cellular proteins on serine, threonine, and tyrosine residues 8, 9, 10 . Increases in tyrosine phosphorylation can be elicited by a variety of soluble and particulate stimuli and correlate temporally with the appearance of cellular responses 11, 12, 13 . The importance of tyrosine phosphorylation to leukocyte function is underscored by the observation that inhibitors of protein tyrosine kinases block many microbicidal responses, including adherence 14 , chemotaxis 15 , phagocytosis 16 , and production of reactive oxygen intermediates 13, 17, 18 .

Phosphorylation of tyrosine residues is regulated by the competing activities of protein tyrosine kinases and protein tyrosine phosphatases (PTP).3 In neutrophils, activation of tyrosine kinases occurs following treatment with chemotactic peptides 19 , cytokines 20, 21 , and multiple other ligands 22 and is pivotal to the increased tyrosine phosphorylation observed following stimulation with these agents. Alternatively, decreases in the activity of tyrosine phosphatases may also contribute to an increase in cellular tyrosine phosphorylation following stimulation. Thus, for example, stimulation with the chemoattractant FMLP or with phorbol esters is associated with decreases in global neutrophil phosphotyrosine phosphatase activity, although the identity of the particular phosphatases responsible for this effect has not been determined 23, 24 . Similarly, inhibition of tyrosine phosphatases with vanadate or its peroxides has been shown to potentiate FMLP-induced superoxide production in intact cells 25 and to activate a respiratory burst in electroporated cells 26, 27 , providing additional evidence that a reduction of phosphatase activity may lead to microbicidal responses in neutrophils.

While the importance of PTPs in regulating neutrophil function is widely acknowledged, little is known about the role of specific tyrosine phosphatases in modulating the outcome of myeloid leukocyte signal transduction pathways. Of particular interest in this regard is the SHP-1 cytosolic PTP, an SH2 domain-containing phosphatase expressed in leukocytes of myelo-monocytic lineages including HL-60 cells 28 , THP-1 cells 29 , and human peripheral blood neutrophils 30 . SHP-1 has now been implicated in the negative regulation of a broad spectrum of growth-promoting receptors, including receptor tyrosine kinases such as c-Kit 31, 32 , CSF-1 receptor 33 , TrkA 34 , and epidermal growth factor 35 receptors; cytokine receptors such as IL-3 31 , IFN-{alpha}36 , and erythropoietin 37, 38 receptors; and receptors of the immune system containing the immune receptor tyrosine-based inhibitory motif such as CD22 39 and Fc{gamma}RIIB 39, 40 . SHP-1 inhibitory effects on receptor tyrosine kinases are mediated by direct dephosphorylation of the activated receptors 31, 33, 35, 41 , while its suppression of cytokine receptor signaling is mediated by binding of the phosphatase to noncatalytic subunits of the receptors and dephosphorylation of the associated Janus family tyrosine kinase 36, 37 . In some instances, the negative modulatory effects of SHP-1 on receptor signaling have been linked to its capacity to interact with multiple receptor and cytosolic signaling effectors. For example SHP-1 down-regulates Ag receptor signaling in T cells by interactions and/or dephosphorylation of TCR components, the Lck 42, 43 and ZAP-70 44 protein tyrosine kinases, and the guanine exchange factor, Vav 45 . Similarly, in B cells, SHP-1 binds and probably dephosphorylates the B cell Ag receptor 45 , Fc{gamma}RIIB 46 , Vav 47 , and CD22 39, 48 . While SHP-1 roles in myeloid cell biology are not yet well defined, the pivotal role for SHP-1 in regulatory development and function of this lineage is highlighted by the enormous myelo-monocytic expansion found in motheaten (me/me) and motheaten viable (mev/mev) mice, in which expression of the PTP activity is essentially abrogated 49, 50, 51 .

Accordingly, as a step toward delineating the role of tyrosine phosphatases in initiation and/or modulation of myeloid leukocyte responses, we explored the roles of SHP-1 in myeloid cell signaling by assessing the impact of overexpressing an enzymatically inactive mutant of SHP-1 (SHP-1C453S) on specific functions of the myelo-monocytic cell line U937. In this report we demonstrate that interference with the action of SHP-1 results in enhanced proliferation and diminished apoptosis as well as enhanced adhesion and oxidant production, suggesting that the function of SHP-1 is predominantly signal terminating or down regulating in myeloid cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

HEPES, FMLP, PMA, cytochalasin B, zymozan, scopoletin, horseradish peroxidase, and propidium iodide were obtained from Sigma (St. Louis, MO). Calcein-AM was obtained from Molecular Probes (Eugene, OR). H2O2 was purchased from Caledon Laboratories (Toronto, Canada). Recombinant human IL-3 was obtained from R&D Systems (Minneapolis, MN). [3H]Thymidine was obtained from Amersham (Aylesbury, U.K.). Protein A/G Plus agarose was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Zymosan A BioParticles (Texas Red conjugate) was obtained from Molecular Probes. The in situ cell death detection kit was purchased from Boehringer Mannheim (Mannheim, Germany). Plasmid Mini/Midi/Maxi Prep and PCR purification kits were obtained from Qiagen (Hilden, Germany). Lipofectamine and G418 were obtained from Life Technologies (Burlington, Canada).

Antibodies

A glutathione S-transferase (GST) fusion protein of wild-type murine SHP-1 encompassing its two SH2 domains (amino acids 1–296) was generated as previously described 50 . The recombinant protein was used to generate polyclonal Abs to SHP-1, which were affinity purified and have been shown to be suitable for immunoblotting and immunoprecipitation 37, 40 . An mAb to SHP-1 was obtained from Transduction Laboratories (Lexington. KY). Monoclonal anti-hemagglutinin (anti-HA) was purchased from BABCO (Richmond, CA). Anti-phosphotyrosine Ab 4G10 and the malachite green tyrosine phosphatase kit were purchased from Upstate Biotechnology (Lake Placid, NY). Anti-phospho Erk Abs were obtained from New England Biolabs (Beverly, MA). Abs to the ß-chain of IL-3R (clone 3D7) were obtained from Dr. Angel Lopez, Cytokine Receptor Laboratory, The Hanson Center for Cancer Research, Institute of Medical and Veterinary Science (Adelaide, Australia).

Cell culture

U937 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in RPMI 1640 medium supplemented with 10% heat-inactivated FBS (Life Technologies).

Construction of mutant SHP-1

A catalytically inactive mutant form of SHP-1 (SHP-1C453S), previously shown to act in a dominant negative fashion 52 , was HA tagged using PCR with synthetic oligonucleotides encoding the desired amino acid residues (5' primer, 5'-ATCAAGCTTATGTACCCATACGATGTTCCTGACTATGCGGTGAGGTCGTTTC ACCGG-3'; 3' primer, 3'-CCCTCCAGATATGTGGCCG-5'). The regions of SHP-1C453S that had been subjected to mutagenesis or HA tagging were sequenced in their entirety using the dideoxynucleotide chain termination method (Sequenase, Pharmacia, Baie d’Urfe, Canada). The HindIII/XbaI of fragment the HA-tagged SHP-1C453S was subcloned into the pcDNA3 eukaryotic expression vector for transfection as described below.

Transfection

The pcDNA3 (empty vector) or pcDNA3 containing HA-tagged SHP-1C453S was transfected into monocytic cell line U937 cells using cationic liposomes (Lipofectamine). Two micrograms of plasmid DNA per 5 x 106 cells was used for transfection. Clones were selected in RPMI 1640 medium supplemented with 1 mg/ml G418 using limiting dilution in 96-well plates and were expanded in tissue culture flasks. The expression of the recombinant mRNAs of HA-tagged SHP-1C453S was initially confirmed using RT-PCR with primers bracketing the HA tag sequence and the 5' portion of SHP-1 (see below). Overexpression of HA-tagged SHP-1C453S protein was identified using Western blotting with an anti-HA mAb.

RT-PCR

Total RNA was isolated from the transfected U937 cells using the guanidinium isothiocyanate-cesium chloride protocol 53, 54 . 5' primers (5'-ATCAAGCTTATGTACCCATACGATGTTCCTGACTATGCGGTGAGGTCGTTTCACCGG-3') and 3' primers (3'-CCCTCCAGATATGTGGCCG-5') were used to amplify a 400-bp fragment of mRNA of SHP-1 encoding the HA tag using the Gene Amp RNA PCR kit (Perkin-Elmer/Cetus, Branchburg, NJ). The PCR products were analyzed by electrophoresis using 1% agarose gels and were visualized by ethidium bromide staining. Amplification of a nucleotide sequence encoding IL-1{alpha} (PAW109 RNA, Perkin-Elmer/Cetus) included with the kit, was used as a positive control.

SHP-1 immunoprecipitation and phosphatase assay

Transfected cells were resuspended in 1 ml of ice-cold lysis buffer, (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 x g for 15 min, and supernatants were mixed with 10 µl of polyclonal anti-SHP-1 or anti-HA mAb at 4°C for 2 h and then incubated with 50 µl of protein G/A Plus agarose rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with monoclonal anti-HA or anti-SHP-1 Abs. Tyrosine phosphatase activity was measured in anti-SHP-1 (polyclonal) immunoprecipitates using the malachite green phosphatase assay with phosphopeptide (RRLIEDAEpYAARG, Upstate Biotechnologies). The activity was normalized to the amount of immunoreactive SHP-1 protein as determined by Western blotting of the immunoprecipitates with anti-SHP-1 mAbs followed by densitometric analysis as described below. The intensity of the SHP-1 band in each sample was determined using IP Lab Gel-D10. The latter was calibrated by running varying amounts of recombinant GST-SHP-1 fusion protein on the same blot to ensure that samples were in the linear range of the x-ray film. The specific SHP-1 activities were calculated by dividing the phosphatase activity (OD from malachite green assay) by the intensity of the SHP-1 band from Western blots.

CD45 immunoprecipitation and phosphatase assay

Cells were resuspended in 1 ml of ice-cold lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 x g for 15 min, and supernatants were mixed with 10 µl of anti-CD45 mAb (clone GAP 8.3, American Type Tissue Collection) at 4°C for 2 h and then incubated with 50 µl of protein G/A Plus agarose, with rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with anti-CD45 mAbs. Tyrosine phosphatase activity was measured in anti-CD45 immunoprecipitates using para-nitrophenylphosphate as the substrate as previously described 55 .

Stimulation of cell and assay for tyrosine phosphorylation

The transfected cells were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h, followed by stimulation of 1 x 106 cells with IL-3 (50 ng/ml) at 37°C for 1–10 min. The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM sodium vanadate). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using a bicinchoninic acid protein kit (Pierce, Rockford, IL), and equal amounts of protein were subjected to SDS-PAGE and Western blotting with anti-phosphotyrosine (4G-10) mAb.

Immunoprecipitation of the IL-3R ß subunit and analysis of tyrosine phosphorylation

U937 cells transfected with either empty vector or with HA-SHP-1C453S were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h. Subsequently 2 x 107 cells were stimulated with IL-3 (100 ng/ml) at 37°C for 10 min. The cells were pelleted by centrifugation and resuspended in lysis buffer (50 mM Tris-HCl (pH 7.5), 10% (v/v) glycerol, 1% (v/v) Nonidet P-40, 150 mM NaCl, 5 mM EDTA, 1 mM sodium vanadate, 10 mM sodium fluoride, 1 mM sodium molybdate, 40 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml soybean trypsin inhibitor, 10 µg/ml leupeptin, and 0.7 µg/ml pepstatin) followed by centrifugation at 10,000 x g for 15 min in a microfuge. The amount of protein in supernatant was measured using a BCA protein kit (Pierce), and supernatants containing equal amounts of protein were mixed with 10 µg of an mAb (3D7) against human IL-3 ß subunit (ßc) and incubated with rotation for 2 h at 4°C. Fifty microliters of a slurry of protein G/A Plus agarose was then added to each sample and incubated with rotation overnight at 4°C. The beads were washed four times in lysis buffer, boiled in Laemmli sample buffer, and analyzed by SDS-PAGE and Western blotting with anti-phosphotyrosine mAb (4G-10, Upstate Biotechnology).

SDS-PAGE and Western blotting analysis

The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using bicinchoninic acid protein kit (Pierce). Equal amounts of protein were loaded onto each lane sample and separated by SDS-PAGE using either 4–20% gradient or 8 or 10% linear polyacrylamide gels and subsequently transferred to nitrocellulose membrane (Protran, Schleicher & Schuell, Toronto, Canada). Immunoblots were blocked in PBS (pH 7.4) containing 2% skim milk, 0.5% Tween-20, or 0.1% Tris buffer (pH 9.0) containing 0.25% gelatin and 10% ethanol amine (for tyrosine phosphorylation only) and incubated with mAbs (anti-HA, anti-SHP-1, or anti-phosphotyrosine as indicated) for 2 h at room temperature. The washed membranes were incubated with horseradish peroxidase-conjugated anti-mouse Ig and developed using enhanced chemiluminescence according to the manufacturer’s instructions (Amersham).

Growth kinetics and DNA synthesis

Cells (1 x 105/ml) from each clone were seeded in 12-well tissue culture plates and serum starved for 24 h followed by addition of either 20% FBS or IL-3 (50 ng/ml). [3H]thymidine (1 µCi/ml) was added at the specified times over a 24-h period followed by incubation for an additional 8 h before analysis. Experiments were performed in triplicate. Cell numbers were counted in triplicate at 24-h intervals for a period of 72 h using a hemocytometer.

Cell cycle analysis

Cells (2 x 105) from each clone were serum starved for 24 h followed by addition of 20% FBS for an additional 3 h. The cells were fixed in 75% ethanol for 30 min and stained in propidium iodide buffer containing PBS, 1.2% Nonidet P-40, 50 µg/ml propidium iodide, and 1 mg/ml RNase for 30 min. Cell cycle analysis (G0/G1, S, G2/M) was conduced according to published methods 56 using flow cytometry.

Analysis of apoptosis

For flow cytometric analysis, cells serum starved for 24 h were resuspended in 1.5 ml of hypotonic fluorochrome solution (50 µg/ml propidium iodide, 0.1% sodium citrate, and 0.1% Triton X-100) for 30 min and analyzed by flow cytometry to detect apoptotic cells. For in situ detection of apoptosis, cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 30 min and permeabilized by incubation in permeabilization solution (0.1% sodium citrate and 0.1% Triton X-100) for 2 min on ice. Cells were then incubated with the terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling (TUNEL) reaction mixture (Boehringer Mannheim) at 37°C for 60 min, viewed by fluorescence microscopy using a Leitz OrthoPlan microscope (Leitz, Rockleigh, NJ) and photographed using Elite 100 (Eastman Kodak, Rochester, NY) film.

Measurement of oxidative burst

Cells (1 x 106) were placed in sterile polypropylene microfuge tubes that had been previously coated with FBS and incubated in 2 ml sodium buffer (140 mM NaCl, 4 mM KCl, 10 mM glucose, 10 mM HEPES, 1 mM MgCl2, and 1 mM CaCl2, pH 7.4, at 37°C) containing 10-7 PMA or 0.1% DMSO (vehicle control), 10.4 µM scopoletin, 9.6 U/ml horseradish peroxidase, and 4 mM sodium azide at 37°C for 2 h 57 . A reduction in fluorescence of scopoletin was quantified by a Hitachi F-2000 fluorescence spectrophotometer (Hitachi, Hialeah, FL), using an excitation wavelength of 365 nm and an emission wavelength of 473 nm. Standard curves were generated using known amounts of H2O2.

Phagocytosis

The phagocytic ability of U937 cells was assayed by incubating opsonized zymosan with cells in the presence of the permeant fluid phase marker Lucifer Yellow as previously described 58 . Cells (3 x 105) were allowed to settle on glass coverslips for 30 min at room temperature. To synchronize phagocytosis, the serum-opsonized zymosan (6 x 105 particles) was added to cells and allowed to bind for 10 min at 4°C. The temperature was then rapidly raised to 37°C, and incubation proceeded for 10 min in the presence of 2 mg/ml Lucifer Yellow. The coverslips were cooled in an ice-water bath, and the number of phagosomes was counted using a fluorescence microscope (Nikon, Melville, NY).

Chemotaxis

Chemotaxis was measured using a micro-Boyden chamber (Neuroprobe, Cabin John, MD). The chamber consists of two wells separated from each other by filter paper. The chemoattractant (10-4–10-7 M FMLP in HEPES-buffered RPMI with 1% BSA at pH 7.4) was placed in the bottom well, a 0.45-µm pore size trap filter placed above, followed by a 3-µm chemotaxis filter. The top chamber was secured in place, and the cells were added in HEPES-buffered RPMI with 1% BSA (3 x 105 cells/well). The chamber was incubated at 37°C for 2 h; the trap filter was removed, fixed, and stained with hematoxylin; and the number of cells present was counted.

Flow cytometric analysis of CD18 expression

Cells (1 x 106) were fixed with 1.6% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20% goat serum for 30 min to block nonspecific binding. Cells were washed and then incubated with 10 µg/ml anti-CD18 Ab (IB4) for 1 h at 4°C, washed, and incubated with FITC-labeled goat anti-mouse IgG Ab. Cells were washed, resuspended in PBS, and analyzed by flow cytometry (FACStar, Becton Dickinson, Mountain View, CA). The geometric mean of the FL-1 channel was recorded.

Flow cytometric analysis of Fc{gamma} receptor expression

Cells (1 x 106) were fixed with 1.6% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20% goat serum for 30 min to block nonspecific binding. Cells were washed twice; then incubated with mouse anti-human Fc{gamma}RI (32.2 (Fab')2, Medarex, Lebanon, NH), mouse anti-human Fc{gamma}RII (IV.3, Medarex) or mouse anti-human Fc{gamma}RIII (3G8, F(ab')2, Medarex) for 2 h at 4°C, washed, and incubated with secondary FITC-labeled goat anti-mouse Ab. Cells were washed twice, resuspended in PBS, and analyzed by flow cytometry (FACStar, Becton Dickinson) as described above. The geometric mean of the FL-1 channel was recorded.

Adhesion assay

U937 cells (2 x 107) were labeled with 1.5 µM calcein-AM for 20 min at 37°C with gentle agitation followed by washing and resuspension in sodium buffer. Subsequently cells were pretreated with or without blocking anti-CD18 Abs (IB4; 44 µg/ml) for 1 h at 4°C, then added to 24-well tissue culture plates (5 x 105 cells/well) precoated with FBS and incubated for an additional 2 h at 37°C in 5% CO2 in a humidified incubator. Each assay was performed in quadruplicate. After incubation, cells were fixed with paraformaldehyde (1.6%) for 40 min at room temperature and then wells were washed twice with PBS using a gravity washing device. Calcein was extracted by adding methanol to the remaining adherent cells followed by vigorous pipetting. Fluorescence was detected using a Hitachi F-2000 fluorescence spectrophotometer with an excitation wavelength of 490 nm and an emission wavelength of 520 nm. All values were normalized to the number of cells added determined by measuring the mean fluorescence of three separate aliquots of 5 x 105 calcein-AM-labeled cells by methanol extraction.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stable overexpression of HA-SHP-1C453S in U937 cells

The tyrosine phosphatase SHP-1 has been implicated in the regulation of signaling pathways involved in growth, differentiation, and activation of cells of hemopoietic lineage. To investigate the functional importance of SHP-1 in myeloid leukocytes, we derived stable clones of a myelo-monocytic cell line U937 expressing recombinant SHP-1, enzymatically inactivated by substitution of the highly conserved cysteine residue in the catalytic domain for serine (SHP-1C453S). To distinguish recombinant from endogenous SHP-1, the protein was tagged with an HA epitope at the NH2 terminus. The construct was ligated into the pcDNA3 vector and transfected into U937 cells, and a total of 21 G418-resistant clones were isolated and expanded. Clones expressing HA-SHP-1C453S were identified by RT-PCR using primers bracketing a 400-bp fragment encompassing the HA tag and NH2 terminus of SHP-1. As illustrated in Fig. 1Go, this analysis revealed a PCR product of the predicted size to be present in clones transfected with pcDNA3 containing the HA- SHP-1C453S insert but absent in clones transfected with vector alone. However, as estimated by the amount of amplification product detectable, the levels of HA-SHP-1C453S mRNA expression were variable among the transfectants.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 1. Identification of HA-SHP-1C453S mRNA in U937 cells. Total RNA was obtained from transfected U937 cells, reverse transcribed into cDNA, and amplified using RT-PCR using primers designed to amplify a 400-bp fragment of HA-SHP-1C453S or a 300-bp fragment of IL-1{alpha} (positive control). Samples of the final reaction mixture were analyzed by electrophoresis through 1% agarose gels with ethidium bromide staining. Lane 1, Negative control (no RNA). Lane 2, No reverse transcriptase. Lane 3, PAW109 RNA (positive control). Lanes 4–8, U937 cells transfected with pcDNA3 vector containing HA-SHP-1C453S. Lane 9, U937 cells transfected with pcDNA3 vector alone.

 
The presence and quantity of recombinant HA-SHP-1C453S in the various G418-resistant clones were next evaluated by Western blotting with anti-HA Ab. This analysis revealed HA-SHP-1C453S expression in 16 of 21 clones, but, as for mRNA, expression of recombinant protein varied among clones (data not shown). The three clones showing highest levels of HA-SHP-1C453S protein, designated C453S-2, C453S-9, and C453S-10 respectively, were selected for further study (Fig. 2Goa). As shown in Fig. 2Gob, expression of HA-SHP-1C453S led to an increase in the total amount of immunoreactive SHP-1 as determined by immunoblotting whole cell lysates using polyclonal anti-SHP-1 Abs that recognize both endogenous and recombinant (HA-SHP-1C453S) protein. To ensure that incorporation of an HA tag on the amino terminus of SHP-1 did not alter its immunoreactivity, the protein was purified by immunoprecipitation with an anti-HA Ab, and its reactivity with anti-SHP-1 Ab was assessed by Western blotting. As illustrated in Fig. 2Goc, the results of this analysis confirmed that the recombinant protein was recognized by anti-SHP-1 Abs and also that immunoprecipitation using anti-HA Ab did not nonspecifically purify endogenous SHP-1.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Identification of HA-SHP-1C453S protein in U937 cells. a and b, Equal amounts of protein from whole cell lysates of U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10) or empty vector (vector) were separated by SDS-PAGE gels and subjected to immunoblotting with anti-HA Abs (a) or affinity-purified anti-SHP-1 Abs (b). c and d, U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10) or empty vector (vector) were resuspended in lysis buffer (PBS (pH 7.4) containing 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 µg/ml aprotinin, and 10 µg/ml leupeptin) and subjected to immunoprecipitation with anti-SHP-1 (c) or anti-HA (d) Abs. The immunoprecipitates were analyzed by SDS-PAGE gels and subjected to immunoblotting with anti-HA Abs (c) or affinity purified anti-SHP-1 Abs (d).

 
To estimate the proportion of total (i.e., endogenous plus recombinant) SHP-1 protein represented by the catalytically inactive HA-SHP-1C453S, the amount of total immunoreactive SHP-1, as determined by densitometric analysis of anti-SHP-1 immunoblots was compared in cells transfected with the HA-SHP-1C453S construct vs vector alone. As shown in Fig. 2Gob, this analysis revealed levels of SHP-1 expression to be between 1.5- and 2-fold higher in the HA-SHP-1C453S-transfected compared with vector alone-transfected cells. The HA-SHP-1C453S-overexpressing and control clones were also compared with respect to levels of SHP-1 phosphatase activity. To this end, aliquots of anti-SHP-1 immunoprecipitated proteins were first quantified by immunoblotting analysis with anti-SHP-1 mAb (Fig. 3Goa), and the capacity of the immunoprecipitated proteins to dephosphorylate a phosphopeptide substrate in vitro was evaluated. As shown in Fig. 3Gob, the activity of SHP-1 was diminished by approximately 50% in each of the three HA-SHP-1C453S-overexpressing clones studied compared with activity detected in vector alone and untransfected clones (wild-type). In addition, estimations of the sp. act. of SHP-1 (obtained by correcting the enzymatic activity for the amount of immunoreactive SHP-1 protein) revealed overexpression of HA-SHP-1C453S to be associated with an almost 50% decrease in SHP-1 sp. act. compared with that detected in clones transfected with vector alone (Fig. 3Goc).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. Interference with SHP-1 function in U937 cells transfected with HA-SHP-1C453S. Total immunoreactive SHP-1 was purified from U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10), empty vector (vector), or untransfected controls by immunoprecipitation with polyclonal anti-SHP-1 Abs as described in Materials and Methods. a, The immunoprecipitates were analyzed by SDS-PAGE gels and immunoblotting with anti-SHP-1 mAbs. Note that equal amounts of immunoreactive SHP-1 (endogenous wild-type and HA-SHP-1C453S recombinant) in each of the immunoprecipitates. b, In vitro phosphatase assay using anti-SHP-1 immunoprecipitates from each of the clones as indicated using a phosphopeptide (RRLIEDAEpYAARG) as the substrate and the malachite green phosphatase assay kit (Upstate Biotechnology). c, In vitro phosphatase assay as described above with anti-SHP-1 immunoprecipitates normalized for the amount of SHP-1 protein present in each of the immunoprecipitates (i.e., sp. act.). SHP-1 phosphatase activity (OD) was divided by the intensity of the corresponding SHP-1 band in immunoblots quantitated using IPLab Gel-D10.

 
Expression of HA-SHP-1C453S enhances cell proliferation and DNA synthesis

As SHP-1 has been shown to play key roles in the regulation of signaling pathways involved in cell growth, the impact of expressing catalytically inactive SHP-1 on the growth of U937 cells was assessed by comparing the growth kinetics of two clones overexpressing HA-SHP-1C453S and those of two clones transfected with vector alone. As illustrated in Fig. 4Go, a and b, following 24-h serum starvation followed by reintroduction of serum, both proliferation and thymidine incorporation were substantially increased in clones expressing HA-SHP-1C453S compared with those in control cells. Cell cycle analysis by flow cytometry using propidium iodide staining demonstrated that a higher proportion of cells in clones overexpressing HA-SHP-1C453S were in S phase after serum stimulation compared with control cells (Fig. 4Go, d–f). As serum contains a plethora of factors that potentially promote cell proliferation, it was of interest to study the effects of a single stimulating agent to ascertain whether reduction of SHP-1 activity would still be associated with enhanced proliferation. As SHP-1 has been shown to bind to the ß-chain of IL-3R 59 and to suppress IL-3-dependent cell growth in other cell types 31 , the effects of HA-SHP-1C453S overexpression on IL-3-induced proliferation were also investigated. For these experiments, cells were serum starved for 24 h followed by incubation in serum-free medium containing 50 ng/ml IL-3 and 1 µCi/ml [3H]thymidine for 8 h. As illustrated in Fig. 4Goc, [3H]thymidine incorporation in response to IL-3 stimulation was again increased in clones overexpressing HA-SHP-1C453S relative to that in control clones.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of HA-SHP-1C453S in U937 cells enhances cell proliferation. a, Cells (1 x 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. Cell number was counted in triplicate using a hemocytometer at 24-h intervals over a period of 72 h. b, Cells (1 x 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. The amount of [3H]thymidine incorporation was measured during 8-h epochs over a period of 24 h (i.e., from 0–8, 8–16, and 16–24 h) by addition of 1 µCi/ml [3H]thymidine to the appropriate wells at the beginning of the epoch. c, Cells (1 x 105) from each clone were serum starved for 24 h followed by the addition of 50 ng/ml rIL-3 and incubated for and additional 24 h. Finally, thymidine incorporation was measured during the ensuing 8 h by addition of 1 µCi/ml of [3H]thymidine. d–f, Cells (2 x 105) were serum starved for 24 h followed by the addition of 20% FBS for 3 h. The cells were fixed and stained in a buffer containing 1.2% Nonidet P-40, 50 µg/ml propidium iodide, and 1 mg/ml RNase followed by cell cycle analysis using flow cytometry. The values for the peaks corresponding to G0/G1, S, and G2/M are indicated.

 
Expression of HA-SHP-1C453S decreases apoptosis

Expansions of cell populations following various growth stimuli are known to reflect the net effects of both proliferation and death rate. Accordingly, the possible relevance of SHP-1 to regulation of cell death was studied by comparing rates of apoptosis in clones overexpressing HA-SHP-1C453S and control clones. Apoptosis was examined after 24 h of serum starvation by both flow cytometry using propidium iodide staining and terminal deoxynucleotidyl transferase in situ labeling. As shown in Fig. 5Go, a and b, the results of both assays revealed diminished rates of apoptosis in clones overexpressing HA-SHP-1C453S compared with control cells, suggesting that reduced rates of death might contribute to enhanced growth of the HA-SHP-1C453S cell population.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 5. Expression of HA-SHP-1C453S in U937 cells diminishes apoptosis. a, Cells (1 x 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. After an additional 24 h, cells were fixed and stained using propidium iodide, and the apoptotic cells (hypodiploid) were quantified by flow cytometry. b, In situ detection of apoptosis using the TUNEL reaction. Cells treated as outlined above were fixed in 4% paraformaldehyde, permeabilized, and stained using the TUNEL reaction. The samples were visualized by fluorescence microscopy using a Leica Orthoplan fluorescence microscope with a 63 Plan-Apo objective and photographed using Tri-X pan film. The photograph in the upper panels was intentionally overexposed to allow the visualization of the (weak) autofluorescence of the U937 cells to ensure that cells were present in the photographic field.

 
Expression of HA-SHP-1C453S potentiates the oxidative burst

The microbicidal function of myeloid cells is dependent on their ability to produce reactive oxygen intermediates such as O2zbe- and H2O2 and to secrete lytic enzymes. The production of reactive oxygen intermediates is, in turn, mediated by a multicomponent enzyme complex, termed the NADPH oxidase, that is known to be functional in U937 cells 60 . To determine the importance of SHP-1 in the regulation of this important effector function, the production of H2O2 was compared in clones overexpressing HA-SHP-1C453S and in controls. As illustrated in Fig. 6Go, clones overexpressing HA-SHP-1C453S displayed increased oxidant production compared with controls after treatment with the phorbol ester PMA, a direct activator of protein kinase C and a potent agonist of the NADPH oxidase 58 . The effects on oxidant production of other agonists including the formyl peptide FMLP, the phagocytic stimulus-opsonized zymosan, and cross-linking of Fc{gamma}RI receptors 61 were also studied in these cells, but none of these agents induced a significant increase in oxidant production in either the control or HA-SHP-1C453S-overexpressing clones (not illustrated).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Expression of HA-SHP-1C453S in U937 cells increases oxidant production in U937 cells. Equal numbers of U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10) or empty vector (vector) were stimulated with 10-7 M PMA for 2 h at 37°C in buffer containing 10.4 mM scopoletin, 9.6 U/ml horseradish peroxidase, and 4 mM sodium azide for 2 h. A reduction in fluorescence of scopoletin was measured by a fluorescence spectrophotometer (Hitachi F-2000) with an excitation wavelength of 365 nm and an emission wavelength of 473 nm. Standard curves were generated using known amounts of H2O2.

 
Expression of HA-SHP-1C453S enhances cell adhesion

Adhesive interactions between leukocytes and endothelial cells are paramount in the emigration of circulating PMN from the blood into inflamed tissues 62, 63 . To determine the importance of SHP-1 in regulation of this important leukocyte function, HA-SHP-1C453S-overexpressing and control cells were compared with respect to their adhesion to serum-coated plastic following treatment with the phorbol ester PMA, FMLP, or C5a, known stimuli for leukocyte adhesion 64, 65, 66 . Fig. 7Go, a and b, illustrate that clones overexpressing HA-SHP-1C453S displayed increased adhesion to serum-coated plastic compared with controls. As adhesion of myeloid leukocytes to extracellular matrix proteins is mediated predominantly by ß2 integrins 67, 68 , the HA-SHP-1C453S-overexpressing cells and control clones were also evaluated for surface expression of CD18 by flow cytometry using IB4, a mAb that recognizes the common ß-chain (CD18) 69 . As illustrated in Fig. 7Goc, this analysis revealed CD18 expression to be relatively increased in the clones overexpressing HA-SHP-1C453S. To ensure that the enhanced adhesion of the HA-SHP-1C453S-overexpressing clones was, in fact, ß2 integrin mediated, adhesion was assayed in the presence of the blocking anti-CD18 Ab, IB4. As shown in Fig. 7Gob, this analysis revealed adhesiveness of HA-SHP-1C453S-overexpressing cells to be diminished in the presence of IB4 to a level indistinguishable from that detected in clones transfected with vector alone. In addition, the basal adhesion of the clones transfected with vector alone was diminished by this Ab, suggesting that a portion of the basal adhesion of these U937 cells was mediated by ß2 integrins.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. Expression of HA-SHP-1C453S in U937 cells increases adhesion and surface expression of CD18. a and b, The adhesion of U937 cells transfected with HA-SHP-1C453S (clone C453S-10) or empty vector (vector) to serum-coated plastic was assayed as described in Materials and Methods in the absence (a) or the presence of blocking concentrations (44 µg/ml) of the anti-CD18 Ab IB4. In a, adhesion in the absence or the presence of 10-6 M FMLP, 10-7 M PMA, and 10-6 M C5a is illustrated. c, Surface expression of CD18 as determined by flow cytometry using an anti-CD18 Ab and indirect immunofluorescence. The geometric mean of fluorescence was calculated for each group and compared statistically. *, p < 0.05 for vector vs cells from the C453S-9 clone.

 
Given these alterations in surface expression of ß2 integrins, which function in both adhesion and phagocytosis, we next sought to determine whether overexpression of HA-SHP-1C453S induced alterations in the expression of other phagocytic receptors, including Fc{gamma}RI, -RII, and -RIII, which are known to be expressed on myeloid cells. Fig. 8Go illustrates that in clones overexpressing HA-SHP-1C453S there was a small, but significant, increase in expression of Fc{gamma} RII but no alteration in the level of expression of Fc{gamma}RI or -RIII. This enhanced surface expression of Fc{gamma}RII had no effect on phagocytosis of serum-opsonized zymosan (not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 8. Effects of expression of HA-SHP-1C453S on surface expression of Fc{gamma} receptors in U937 cells. Surface expression of Fc{gamma}RI, Fc{gamma}RII, and Fc{gamma}RIII was quantified using subtype-specific mAbs and flow cytometry as described in Materials and Methods. The level of expression of each of the Fc receptors was compared between the overexpressing HA-SHP-1C453S clone 10 and clones transfected with vector alone and with untransfected cells. *, p < 0.05, compared between vector and clone C453S-10 and between untransfected cells and clone C453S-10.

 
The effect of HA-SHP-1C453S overexpression on cell motility as assayed by chemotaxis through methylcellulose/nitrocellulose filters in response to FMLP, recombinant C5a, and zymosan-activated serum, was also studied. However, no significant difference was observed between clones overexpressing HA-SHP-1C453S and controls with respect to this important functional property (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The primary purpose of the current study was to delineate the relevance of the SHP-1 tyrosine phosphatase to the regulation of myeloid cell function. Our results indicate that SHP-1 plays an important role in the negative regulation of myeloid cell proliferation and programmed cell death. Additionally, SHP-1 participates in the modulation of cell adhesion and the production of reactive oxygen intermediates, two properties key to the microbicidal functioning of mature myeloid cells. These observations suggest that SHP-1 facilitates the down-regulation and/or termination of myeloid cell activation cascades and imply a role for SHP-1 in minimizing microvascular sequestration of leukocytes and unregulated release of leukocyte-derived cytotoxic compounds that may occur in pathological contexts. Although on first consideration the magnitude of some of these individual effects may appear to be small (e.g., adhesion and oxidant production), their cumulative physiological effect may be much larger when exerted in vivo over prolonged periods of time. This conclusion is consistent with the clinical sequelae of SHP-1 deficiency as evidenced by the phenotype of motheaten and viable motheaten mice in which SHP-1 activity is essentially absent 49, 50, 51, 70 . These animals die prematurely as a consequence of a hemorrhagic interstitial pneumonitis associated with intraalveolar accumulation of macrophages and neutrophils in the distal lung units 71, 72 and with enhanced production of TNF-{alpha} by the alveolar macrophages 72, 73 . Our recent data revealing high levels of SHP-1 expression in human peripheral blood neutrophils 30 also emphasizes the potential importance of this signal terminating molecule to the regulation of neutrophil-mediated tissue inflammation and damage. Together these observations support the contention that unregulated leukocyte activation plays a fundamental etiological role in the pathogenesis of human diseases characterized by pulmonary inflammation and underscore the importance of signaling effectors and pathways that constrain the inflammatory process.

For the purposes of this study, an enzymatically inactive dominant negative form of recombinant SHP-1 was expressed in U937 cells, a myelomonocytic cell line that exhibits some of the functional attributes of human peripheral blood leukocytes. We also attempted to express wild-type SHP-1 in these cells, but were unable to isolate stable overexpressing transfectants, possibly because of detrimental effects to cell growth/viability. To address the issue of specificity, clones overexpressing HA-SHP-1C453S and wild-type controls cells were also compared with respect to the activity of another tyrosine phosphatase, CD45, but this PTP activity was found to be comparable in the mutant and wild-type cell populations (data not shown). We have also recently observed that bone marrow-derived neutrophils from motheaten and viable motheaten mice are hyperadhesive compared with cells from congenic controls wild-type mice (G. P. Downey and K. A. Siminovitch, manuscript in preparation). Together these data suggest that the phenotypic alterations observed in the HA-SHP-1C453S-transfected U937 cell lines also occur in vivo in conjunction with loss of SHP-1 function and are thus relevant to the normal regulation of myeloid cell function.

The capacity of SHP-1 to down-regulate mitogenic signaling cascades has been demonstrated in many cellular systems and involves modulation of a diversity of receptors. Enhanced expression of SHP-1 has been shown, for example, to attenuate IL-3-induced tyrosine phosphorylation in DA-3 cells 31 , a finding that appears to reflect IL-3-induced SHP-1 binding to the IL-3R ß-chain and consequent ß-chain dephosphorylation 31 . Similarly, impaired SHP-1 activity is associated with hyperproliferative responses to IL-3 and erythropoietin in DA3 cells 74 and with IL-2-independent growth of transformed T cells 75 . This latter effect again appears to reflect the capacity of SHP-1 to associate with a cytokine receptor (i.e., the IL-2R) and to dephosphorylate the ß-chain of the activated receptor, leading, in turn, to diminished phosphorylation of the associated Janus family tyrosine kinases JAK1 and JAK3 75 . These observations thus indicate a pivotal role for SHP-1 in down-regulating activation signals transduced through the IL-2 and IL-3 receptors, as is again consistent with the profound expansion of granulocytes and macrophages found in SHP-1-deficient motheaten mice. The motheaten phenotype appears to also reflect the capacity of SHP-1 to inhibit proliferative signals evoked through a number of other growth factor receptors. These include, for example, the c-Kit tyrosine kinase receptor, which transduces a hyperproliferative response to Kit ligand in motheaten bone marrow progenitor cells and appears subject to SHP-1-mediated suppression in relation to its role in promoting macrophage and granulocyte development 32, 43 . Along similar lines, macrophages from motheaten mice show enhanced proliferative responses to granulocyte-macrophage CSF 76 and CSF-1 and display CSF-1R hyperphosphorylation in response to CSF-1 stimulation 33 . These effects appear to reflect the capacity of SHP-1 to directly dephosphorylate activated receptors 31, 33, 35, 41 and/or dephosphorylate the associated Janus tyrosine kinases 36, 37 , or other components of receptor signaling complexes 39, 40, 42, 43, 44, 45, 47, 48, 77 . Based on these findings, the effects of HA-SHP-1C453S overexpression on protein tyrosine phosphorylation were directly investigated in the current study. However, no differences were detected between the HA-SHP-1C453S transfectants and wild-type cells with respect to either IL-3-induced global or IL-3R ß-chain tyrosine phosphorylation (data not shown). Thus, the biochemical basis for the altered physiologic properties of the HA-SHP-1C453S cells remain unclear. However, SHP-1 has been shown to bind to a plethora of other signaling effectors, including, for example, Grb-2 33 , Cbl, STAT3, STAT5a, STAT5b, Shc, the p85 subunit of phosphoinositide 3-kinase, Vav, and the Ras-GTPase-activating protein 78 . SHP-1 has also been recently shown to associate with a 130-kDa tyrosyl-phosphorylated species (P130) in macrophages that is comprised of two transmembrane glycoproteins, PIR-B/p91A and the signal regulator protein family member brain Ig-like molecule with tyrosine-based activation motifs 79 . These latter proteins may be substrates for SHP-1 because they are hyperphosphorylated in macrophages from motheaten viable mice. However, further investigations are currently underway to determine which of these various SHP-1-protein interactions accounts for the effects of SHP-1 on myeloid cell behavior.

The association of impaired SHP-1 function with a diminution in cell death rate, as observed in the current study, has important implications for the regulation of the inflammatory process. In an inflammatory response evoked by bacterial infection, for example, prolongation of phagocytic cell survival might be expected to facilitate the killing of invading microbes. By contrast, in the context of inflammatory-mediated tissue damage such as the systemic inflammatory response syndrome 80 , the persistence of tissue neutrophilia might be deleterious. Accordingly, regulation of the survival/death rates of inflammatory cells is likely to have significant physiologic ramifications 81 . Involvement of SHP-1 in the regulation of myeloid cell apoptosis also raises the possibility that a reduction in spontaneous apoptosis contributes to the granulocyte and macrophage expansion observed in motheaten mice. A role for SHP-1 in the regulation of lymphocyte apoptosis also appears likely in view of the pivotal role for SHP-1 in regulating signaling through the Ag receptors and various Ag receptor comodulators. This possibility is supported by recent data from our group linking SHP-1 to the regulation of activation-induced cell death of peripheral T cells 82 . At present, however, the mechanisms by which SHP-1 realizes its effects on spontaneous or induced apoptotic signaling cascades remain unclear.

The hyperadhesiveness of the HA-SHP-1C453S-overexpressing clones suggests that SHP-1 is also involved in regulating the adherence properties of leukocytes. The enhanced surface expression of the ß2 integrin common ß-chain in concert with the blocking effects of an anti-CD18 mAb suggest that the enhanced adhesiveness of these clones is mediated by effects on the ß2 integrins. Myeloid cell hyperadhesiveness might also contribute to the massive accumulation of myeloid cells in the tissues of motheaten mice 49, 50, 51 , particularly since the inflammatory infiltration in these mice can be partially ameliorated by treatment with anti-CD11b (5C6) Ab 83 . However, the mechanism(s) by which SHP-1 influences CD11/CD18 function and cell adhesion remain to be elucidated, particularly since the role of tyrosine phosphorylation in modulating ß2 integrin functions remains uncertain 84, 85 . In this regard, it is noteworthy that SHP-1 has recently been shown to associate with tyrosine-phosphorylated PECAM-1 86 and with several molecules found in adhesion complexes, including paxillin, vimentin, and filamentous actin in CSF-1-stimulated macrophages 78 . The relevance of these observations in relation to the role of SHP-1 in cell adhesion, however, are not clear. Interestingly, several other protein tyrosine phosphatases have also been implicated in the regulation of cell-cell and cell-substrate adhesion 87, 88 . For example, the closely related PTP SHP-2 appears to play an important role in ß1 integrin-mediated activation of mitogen-activated protein kinase 89 , and the leukocyte tyrosine phosphatase CD45 is required for the maintenance of integrin-mediated adhesion in murine bone marrow macrophages 90 . Together, these data suggest that modulation of cell adhesion represents another mechanism by which SHP-1 influences myeloid cell behavior.

In addition to the other functional changes associated with HA-SHP-1C453S overexpression, oxidant production was increased in the transfected cells. This observation suggests the involvement of SHP-1 in regulating leukocyte NADPH oxidase, a multicomponent enzyme complex that transfers a single electron from NADPH to molecular oxygen, resulting in the production of superoxide (O2-) 91 . Although the signaling pathways leading to activation of NADPH oxidase remain to be clarified, tyrosine phosphorylation appears to be relevant to the process, as increases in tyrosine phosphorylation correlate temporally with activation of the oxidase 13 . Additionally, inhibitors of protein tyrosine kinases block the production of reactive oxygen intermediates 13, 18 . There is also evidence that PTPs negatively regulate activation of NADPH oxidase; inhibition of tyrosine phosphatases with vanadate or its peroxides has been shown to potentiate FMLP-induced superoxide production in whole cells and to activate a respiratory burst in electroporated cells 25, 26, 27 . Taken together, these observations indicate that tyrosine phosphatases, including SHP-1, are likely to play important roles in regulation of the leukocyte NADPH oxidase.

In conclusion, our studies demonstrate that the SH2 domain containing tyrosine phosphatase SHP-1 plays a pivotal role in the regulation of a multiplicity of signaling pathways regulating the growth, differentiation, and activation of myeloid leukocytes. Unregulated release of leukocyte-derived cytotoxic compounds has been implicated in a variety of disorders characterized by inflammatory tissue injury such as arthritis, ischemia reperfusion injury, and acute lung injury 4, 5, 6, 7 , and the potential for SHP-1 to limit leukocyte activation in these circumstances therefore suggests pivotal roles for SHP-1 in relation to a broad spectrum of disease pathophysiology. By extension, reduced activity of signal-terminating molecules such as SHP-1 may result in an imbalance of inflammatory cascades so as to predispose to potentially catastrophic consequences, such as the systemic inflammatory response syndrome and acute lung injury.


    Footnotes
 
1 This work was supported by operating grants from the Medical Research Council of Canada (to G.P.D. and K.A.S.) and by the Ontario Thoracic Society (to G.P.D.). G.P.D. is the recipient of a Career Scientist Award from the Ontario Ministry of Health, K.A.S. is a Research Scientist of the Arthritis Society of Canada, and L.F. is the recipient of a Scientist Award from the National Council of Scientific and Technological Development, Brazil. Back

2 Address correspondence and reprint requests to Dr. Gregory P. Downey, Clinical Sciences Division, Room 6264 Medical Sciences Building, University of Toronto, 1 Kings College Circle, Toronto, Ontario, Canada M5S 1A8. E-mail address: Back

3 Abbreviations used in this paper: PTP, protein tyrosine phosphatase; SHP-1, SH2-containing phosphatase-1; HA, hemagglutinin; TUNEL, terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling. Back

Received for publication July 30, 1998. Accepted for publication December 11, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sha’afi, R., T. Molski. 1988. Activation of the neutrophils. E. L. Becker, ed. In Progress in Allergy Vol. 42:1.-64. Karger, Basel.
  2. Downey, G. P., T. Fukushima, L. Fialkow, T. K. Waddell. 1995. Intracellular signaling in neutrophil priming and activation. Semin. Cell Biol. 6:345.[Medline]
  3. Gerard, C., N. P. Gerard. 1994. The pro-inflammatory seven-transmembrane segment receptors of the leukocyte. Curr. Opin. Immunol. 6:140.[Medline]
  4. Parrillo, J. E.. 1993. Pathogenic mechanisms of septic shock. N. Engl. J. Med. 328:1471.[Free Full Text]
  5. Fujishima, S., N. Aikawa. 1995. Neutrophil-mediated tissue injury and its modulation. Intensive Care Med. 21:277.[Medline]
  6. Kurose, I., L. W. Argenbright, R. Wolf, L. Lianxi, D. N. Granger. 1997. Ischemia/reperfusion-induced microvascular dysfunction: role of oxidants and lipid mediators. Am. J. Physiol. 272:H2976.[Abstract/Free Full Text]
  7. Hawkins, C. L., M. J. Davies. 1997. Oxidative damage to collagen and related substrates by metal ion/hydrogen peroxide systems: random attack or site-specific damage. Biochim. Biophys. Acta 1360:84.[Medline]
  8. Babior, B. M.. 1988. Protein phosphorylation and the respiratory burst. Arch. Biochem. Biophys. 264:361.[Medline]
  9. Dusi, S., M. Donini, V. Della Bianca, F. Rossi. 1994. Tyrosine phosphorylation of phospholipase C-{gamma}2 is involved in the activation of phosphoinositide hydrolysis by Fc receptors in human neutrophils. Biochem. Biophys. Res. Commun. 201:1100.[Medline]
  10. Greenberg, S., P. Chang, S. C. Silverstein. 1993. Tyrosine phosphorylation is required for Fc receptor-mediated phagocytosis in mouse macrophages. J. Exp. Med. 177:529.[Abstract/Free Full Text]
  11. Huang, C., G. Laramee, J. Casnellie. 1988. Chemotactic factor induced tyrosine phosphorylation of membrane associated proteins in rabbit peritoneal neutrophils. Biochem. Biophys. Res. Commun. 151:794.[Medline]
  12. Gomez-Cambronero, J., C. Huang, V. Bonak, E. Wang, J. Casnellie. 1989. Tyrosine phosphorylation in human neutrophil. Biochem. Biophys. Res. Commun. 162:1478.[Medline]
  13. Berkow, R. L., R. W. Dodson, A. S. Kraft. 1989. Human neutrophils contain distinct cytosolic and particulate tyrosine kinase activities: possible role in neutrophil activation. Biochim. Biophys. Acta 997:292.[Medline]
  14. McGregor, P. E., D. K. Agrawal, J. D. Edwards. 1994. Attenuation of human leukocyte adherence to endothelial cell monolayers by tyrosine kinase inhibitors. Biochem. Biophys. Res. Commun. 198:359.[Medline]
  15. Gaudry, M., A. C. Caon, C. Gilbert, S. Lille, P. H. Naccache. 1992. Evidence for the involvement of tyrosine kinases in the locomotory responses of human neutrophils. J. Leukocyte Biol. 51:103.[Abstract]
  16. Kobayashi, K., K. Takahashi, S. Nagasawa. 1995. The role of tyrosine phosphorylation and Ca2+ accumulation in Fc{gamma}-receptor-mediated phagocytosis of human neutrophils. J. Biochem. 117:1156.[Abstract/Free Full Text]
  17. Grinstein, S., W. Furuya. 1991. Tyrosine phosphorylation and oxygen consumption induced by G proteins in neutrophils. Am. J. Physiol. 260:C1019.[Abstract/Free Full Text]
  18. Kusunoki, T., H. Higashi, S. Hosoi, D. Hata, K. Sugie, M. Mayumi, H. Mikawa. 1992. Tyrosine phosphorylation and its possible role in superoxide production by human neutrophils stimulated with FMLP and IgG. Biochem. Biophys. Res. Commun. 183:789.[Medline]
  19. Ptasznik, A., E. R. Prossnitz, D. Yoshikawa, A. Smrcka, A. E. Traynor-Kaplan, G. M. Bokoch. 1996. A tyrosine kinase signaling pathway accounts for the majority of phosphatidylinositol 3,4,5-trisphosphate formation in chemoattractant-stimulated human neutrophils. J. Biol. Chem. 271:25204.[Abstract/Free Full Text]
  20. Berton, G., L. Fumagalli, C. Laudanna, C. Sorio. 1994. ß2 integrin-dependent protein tyrosine phosphorylation and activation of the FGR protein tyrosine kinase in human neutrophils. J. Cell Biol. 126:1111.[Abstract/Free Full Text]
  21. Corey, S., A. Eguinoa, K. Puyana-Theall, J. Bolen, L. Cantley, F. Mollinedo, T. Jackson, P. Hawkins, L. R. Stephens. 1993. Granulocyte macrophage-colony stimulating factor stimulates both association and activation of phosphoinositide 3OH-kinase and Src-related tyrosine kinase(s) in human myeloid derived cells. EMBO J. 12:2681.[Medline]
  22. Asahi, M., T. Taniguchi, E. Hashimoto, T. Inazu, H. Maeda, H. Yamamura. 1993. Activation of protein-tyrosine kinase p72syk with concanavalin A in polymorphonuclear neutrophils. J. Biol. Chem. 268:23334.[Abstract/Free Full Text]
  23. Kraft, A. S., R. L. Berkow. 1987. Tyrosine kinase and phosphotyrosine phosphatase activity in human promyelocytic leukemia cells and human polymorphonuclear leukocytes. Blood 70:356.[Abstract/Free Full Text]
  24. Kansha, M., K. Takeshige, S. Minakami. 1993. Decrease in the phosphotyrosine phosphatase activity in the plasma membrane of human neutrophils on stimulation by phorbol 12-myristate 13-acetate. Biochim. Biophys. Acta 1179:189.[Medline]
  25. Lloyds, D., M. B. Hallett. 1994. Neutrophil "priming" induced by orthovanadate: evidence of a role for tyrosine phosphorylation. Biochem. Pharmacol. 48:15.[Medline]
  26. Grinstein, S., W. Furuya, D. J. Lu, G. B. Mills. 1990. Vanadate stimulates oxygen consumption and tyrosine phosphorylation in electropermeabilized human neutrophils. J. Biol. Chem. 265:318.[Abstract/Free Full Text]
  27. Mitsuyama, T., K. Takeshige, S. Minakami. 1993. Tyrosine phosphorylation is involved in the respiratory burst of electropermeabilized human neutrophils at a step before diacylglycerol formation by phospholipase C. FEBS Lett. 322:280.[Medline]
  28. Uchida, T., T. Matozaki, K. Matsuda, T. Suzuki, S. Matozaki, O. Nakano, K. Wada, Y. Konda, C. Sakamoto, M. Kasuga. 1993. Phorbol ester stimulates the activity of a protein tyrosine phosphatase containing SH2 domains (PTP1C) in HL-60 leukemia cells by increasing gene expression. J. Biol. Chem. 268:11845.[Abstract/Free Full Text]
  29. Knutson, K. L., Z. Hmama, P. Herrera-Velit, R. Rochford, N. E. Reiner. 1998. Lipoarabinomannan of Mycobacterium tuberculosis promotes protein tyrosine dephosphorylation and inhibition of mitogen-activated protein kinase in human mononuclear phagocytes; role of the Src homology 2 containing tyrosine phosphatase 1. J. Biol. Chem. 273:645.[Abstract/Free Full Text]
  30. Brumell, J., C. K. Chan, J. Butler, N. Borregaard, K. Siminovitch, S. Grinstein, G. P. Downey. 1997. Regulation of SHP-1 during activation of human neutrophils: role of protein kinase C. J. Biol. Chem. 272:875.[Abstract/Free Full Text]
  31. Yi, T., J. Ihle. 1993. Association of hematopoietic cell phosphatase with c-Kit after stimulation with c-Kit ligand. Mol. Cell. Biol. 13:3350.[Abstract/Free Full Text]
  32. Paulson, R. F., S. Vesely, K. A. Siminovitch, A. Bernstein. 1996. Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1. Nat. Genet. 13:309.[Medline]
  33. Chen, H. E., S. Chang, T. Trub, B. G. Neel. 1996. Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 16:3685.[Abstract]
  34. Vambutas, V., D. R. Kaplan, M. A. Sells, J. Chernoff. 1995. Nerve growth factor stimulates tyrosine phosphorylation and activation of Src homology-containing protein-tyrosine phosphatase 1 in PC12 cells. J. Biol. Chem. 270:25629.[Abstract/Free Full Text]
  35. Tomic, S., R. U. Greise, R. Lammers, A. Kharitonenkov, E. Imyanitov, A. Ullrich, F. Bohmer. 1995. Association of SH2 domain protein tyrosine phosphatases with the epidermal growth factor receptor in human tumor cells: phosphatidic acid activates receptor dephosphorylation by PTP1C. J. Biol. Chem. 270:21277.[Abstract/Free Full Text]
  36. David, M., H. E. Chen, S. Goelz, A. C. Larner, B. G. Neel. 1995. Differential regulation of the {alpha}/ß interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 15:7050.[Abstract]
  37. Klingmüller, U., U. Lorenz, L. C. Cantley, B. G. Neel, H. F. Lodish. 1995. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 80:729.[Medline]
  38. Klingmüller, U.. 1997. The role of tyrosine phosphorylation in proliferation and maturation of erythroid progenitor cells-signals emanating from the erythropoietin receptor. Eur. J. Biochem. 249:637.[Medline]
  39. Law, C. L., S. P. Sidorenko, K. A. Chandran, Z. Zhao, S. H. Shen, E. H. Fischer, E. A. Clark. 1996. CD22 associates with protein tyrosine phosphatase 1C, Syk, and phospholipase C-{gamma}(1) upon B cell activation. J. Exp. Med. 183:547.[Abstract/Free Full Text]
  40. Nadler, M. J. S., B. Chen, J. S. Anderson, H. H. Wortis, B. G. Neel. 1997. Protein-tyrosine phosphatase SHP-1 is dispensable for Fc{gamma}RIIB-mediated inhibition of B cell antigen receptor activation. J. Biol. Chem. 272:20038.[Abstract/Free Full Text]
  41. Vogel, W., R. Lammers, J. Huang, A. Ullrich. 1993. Activation of a phosphotyrosine phosphatase by tyrosine phosphorylation. Science 259:1611.[Abstract/Free Full Text]
  42. Binstadt, B. A., K. M. Brumbaugh, C. J. Dick, A. M. Scharenberg, B. L. Williams, M. Colonna, L. L. Lanier, J. P. Kinet, R. T. Abraham, P. J. Leibson. 1996. Sequential involvement of Lck and SHP-1 with MHC-recognizing receptors on NK cells inhibits FcR-initiated tyrosine kinase activation. Immunity 5:629.[Medline]
  43. Lorenz, U., A. D. Bergemann, H. N. Steinberg, J. G. Flanagan, X. Li, S. J. Galli, B. G. Neel. 1996. Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1. J. Exp. Med. 184:1111.[Abstract/Free Full Text]
  44. Plas, D. R., R. Johnson, J. T. Pingel, R. J. Matthews, M. Dalton, G. Roy, A. C. Chan, M. L. Thomas. 1996. Direct regulation of ZAP-70 by SHP-1 in T cell antigen receptor signaling. Science 272:1173.[Abstract]
  45. Pani, G., M. Kozlowski, J. C. Cambier, G. B. Mills, K. A. Siminovitch. 1995. Identification of the tyrosine phosphatase PTP1C as a B cell antigen receptor-associated protein involved in the regulation of B cell signaling. J. Exp. Med. 181:2077.[Abstract/Free Full Text]
  46. D’Ambrosio, D., K. L. Hippen, S. A. Minskoff, I. Mellman, G. Pani, K. A. Siminovitch, J. C. Cambier. 1995. Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by Fc{gamma}RIIB1. Science 268:293.[Abstract/Free Full Text]
  47. Kon-Kozlowski, M., G. Pani, T. Pawson, K. A. Siminovitch. 1996. The tyrosine phosphatase PTP1C associates with Vav, Grb2, and mSos1 in hematopoietic cells. J. Biol. Chem. 271:3856.[Abstract/Free Full Text]
  48. Doody, G. M., L. B. Justement, C. C. Delibrias, R. J. Matthews, J. Lin, M. L. Thomas, D. T. Fearon. 1995. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science 269:242.[Abstract/Free Full Text]
  49. Tsui, H. W., K. A. Siminovitch, L. de Souza, F. W. Tsui. 1993. Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat. Genet. 4:124.[Medline]
  50. Kozlowski, M., I. Mlinaric-Rascan, G. S. Feng, R. Shen, T. Pawson, K. A. Siminovitch. 1993. Expression and catalytic activity of the tyrosine phosphatase PTP1C is severely impaired in motheaten and viable motheaten mice. J. Exp. Med. 178:2157.[Abstract/Free Full Text]
  51. Bignon, J. S., K. A. Siminovitch. 1994. Identification of PTP1C mutation as the genetic defect in motheaten and viable motheaten mice: a step toward defining the roles of protein tyrosine phosphatases in the regulation of hemopoietic cell differentiation and function. Clin. Immunol. Immunopathol. 73:168.[Medline]
  52. Somani, A. K., J. S. Bignon, G. B. Mills, K. A. Siminovitch, D. R. Branch. 1997. Src kinase activity is regulated by the SHP-1 protein-tyrosine phosphatase. J. Biol. Chem. 272:21113.[Abstract/Free Full Text]
  53. MacDonald, R. J., G. H. Swift, A. E. Przybyla, J. M. Chirgwin. 1987. Isolation of RNA using guanidinium salts. Methods Enzymol. 152:219.[Medline]
  54. Groppe, J. C., D. E. Morse. 1993. Isolation of full-length RNA templates for reverse transcription from tissues rich in RNase and proteoglycans. Anal. Biochem. 210:337.[Medline]
  55. Fialkow, L., C. K. Chan, G. Downey. 1997. Regulation of protein tyrosine phosphatase activity in neutrophils: modulation by oxidants. J. Immunol. 158:5409.[Abstract]
  56. Hogg, D., C. Guidos, D. Bailey, A. Amendola, T. Groves, J. Davidson, R. Schmandt, G. Mills. 1994. Cell cycle dependent regulation of the protein kinase TTK. Oncogene 9:89.[Medline]
  57. Waddell, T. K., L. Fialkow, C. K. Chan, T. K. Kishimoto, G. P. Downey. 1994. Potentiation of the oxidative burst of human neutrophils. A signaling role for L-selectin. J. Biol. Chem. 269:18485.[Abstract/Free Full Text]
  58. Downey, G. P., J. R. Butler, H. Tapper, L. Fialkow, A. Salteil, B. Rubin, S. Grinstein. 1998. Importance of the MEK/MAP kinase pathway in neutrophil microbicidal responsiveness. J. Immunol. 160:434.[Abstract/Free Full Text]
  59. Bone, H., U. Dechert, F. Jirik, J. W. Schrader, M. J. Welham. 1997. SHP1 and SHP2 protein-tyrosine phosphatases associate with ßc after interleukin-3-induced receptor tyrosine phosphorylation. Identification of potential binding sites and substrates. J. Biol. Chem. 272:14470.[Abstract/Free Full Text]
  60. Obermeier, H., A. Sellmayer, U. Danesch, M. Aepfelbacher. 1995. Cooperative effects of interferon-{gamma} on the induction of NADPH oxidase by retinoic acid or 1,25(OH)2-vitamin D3 in monocytic U937 cells. Biochim. Biophys. Acta 1269:25.[Medline]
  61. Durden, D. L., H. M. Kim, B. Calore, Y. Liu. 1995. The Fc{gamma}RI receptor signals through the activation of hck and MAP kinase. J. Immunol. 154:4039.[Abstract]
  62. Granger, D. N., P. Kubes. 1994. The microcirculation and inflammation: modulation of leukocyte-endothelial cell adhesion. J. Leukocyte Biol. 55:662.[Abstract]
  63. Springer, T. A.. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301.[Medline]
  64. Lundgren-Akerlund, E., E. Berger, K.-E. Arfors. 1992. Effect of divalent cations on adhesion of polymorphonuclear leukocytes to matrix molecules in vitro. J. Leukocyte Biol. 51:603.[Abstract]
  65. Albelda, S. M., C. W. Smith, P. A. Ward. 1994. Adhesion molecules and inflammatory injury. FASEB J. 8:504.[Abstract]
  66. Firestein, G. S., D. A. Bullough, M. D. Erion, R. Jimenez, M. Ramirez-Weinhouse, J. Barankiewicz, C. W. Smith, H. E. Gruber, K. M. Mullane. 1995. Inhibition of neutrophil adhesion by adenosine and an adenosine kinase inhibitor: the role of selectins. J. Immunol. 154:326.[Abstract]
  67. Brown, E. J., F. P. Lindberg. 1996. Leucocyte adhesion molecules in host defence against infection. Ann. Med. 28:201.[Medline]
  68. Bevilacqua, M. P., R. M. Nelson, G. Mannori, O. Cecconi. 1994. Endothelial-leukocyte adhesion molecules in human disease. Annu. Rev. Med. 45:361.[Medline]
  69. Wright, S. D., P. E. Rao, W. C. Van Voorhis, L. S. Craigmyle, K. Iida, M. A. Talle, E. F. Westberg, G. Goldstein, S. C. Silverstein. 1983. Identification of the C3bi receptor of human monocytes and macrophages by using monoclonal antibodies. Proc. Natl. Acad. Sci. USA 80:5699.[Abstract/Free Full Text]
  70. Shultz, L. D., P. A. Schweitzer, T. V. Rajan, T. Yi, J. N. Ihle, R. J. Matthews, M. L. Thomas, D. R. Beier. 1993. Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 73:1445.[Medline]
  71. Shultz, L. D., C. L. Sidman. 1987. Genetically determined murine models of immunodeficiency. Annu. Rev. Immunol. 5:367.[Medline]
  72. Thrall, R. S., S. N. Vogel, R. Evans, L. D. Shultz. 1997. Role of tumor necrosis factor-{alpha} in the spontaneous development of pulmonary fibrosis in viable motheaten mutant mice. Am. J. Pathol. 151:1303.[Abstract]
  73. Shultz, L. D., D. R. Coman, C. L. Bailey, W. G. Beamer, C. L. Sidman. 1984. "Viable motheaten," a new allele at the motheaten locus. I. Pathology. Am. J. Pathol. 116:179.[Abstract]
  74. Yang, W., M. Tabrizi, K. Berrada, T. Yi. 1998. SHP-1 phosphatase C-terminus interacts with novel substrates p32/p30 during erythropoietin and interleukin-3 mitogenic responses. Blood 91:3746.[Abstract/Free Full Text]
  75. Migone, T. S., N. A. Cacalano, N. Taylor, T. Yi, T. A. Waldmann, J. A. Johnston. 1998. Recruitment of SH2-containing protein tyrosine phosphatase SHP-1 to the interleukin 2 receptor; loss of SHP-1 expression in human T-lymphotropic virus type I-transformed T cells. Proc. Natl. Acad. Sci. USA 95:3845.[Abstract/Free Full Text]
  76. Jiao, H., W. Yang, K. Berrada, M. Tabrizi, L. Shultz, T. Yi. 1997. Macrophages from motheaten and viable motheaten mutant mice show increased proliferative responses to GM-CSF: detection of potential HCP substrates in GM-CSF signal transduction. Exp. Hematol. 25:592.[Medline]
  77. Smith, K. G. C., D. M. Tarlinton, G. M. Doody, M. L. Hibbs, D. T. Fearon. 1998. Inhibition of the B Cell by CD22: a requirement for Lyn. J. Exp. Med. 187:807.[Abstract/Free Full Text]
  78. Yeung, Y. G., Y. Wang, D. B. Einstein, P. S. W. Lee, E. R. Stanley. 1998. Formation of multimeric cytosolic complexes of signaling proteins and cytoskeletal components in macrophages. J. Biol. Chem. 273:17128.[Abstract/Free Full Text]
  79. Timms, J. F., K. Carlberg, H. Gu, H. Chen, S. Kamatkar, M. J. S. Nadler, L. R. Rohrschneider, B. G. Neel. 1998. Identification of major binding proteins and substrates for the SH2-containing protein tyrosine phosphatase SHP-1 in macrophages. Mol. Cell. Biol. 18:3838.[Abstract/Free Full Text]
  80. Rinaldo, J. E., J. W. Christman. 1990. Mechanisms and mediators of the adult respiratory distress syndrome. Clin. Chest Med. 11:621.[Medline]
  81. Savill, J., C. Haslett. 1995. Granulocyte clearance by apoptosis in the resolution of inflammation. Semin. Cell. Biol. 6:385.[Medline]
  82. Zhang, J., A.-K. Somani, S. Watt, G. Mills, and K. A. Siminovitch. 1999. The SHP-1 tyrosine phosphatase inhibits antigen receptor-induced apoptosis of activated peripheral T cells. J. Immunol. In press.
  83. Koo, G. C., H. Rosen, A. Sirotina, X. D. Ma, L. D. Shultz. 1993. Anti-CD11b antibody prevents immunopathologic changes in viable motheaten bone marrow chimeric mice. J. Immunol. 151:6733.[Abstract]
  84. Valmu, L., C. G. Gahmberg. 1995. Treatment with okadaic acid reveals strong threonine phosphorylation of CD18 after activation of CD11/CD18 leukocyte integrins with phorbol esters or CD3 antibodies. J. Immunol. 155:1175.[Abstract]
  85. Hellberg, C., D. Eierman, A. Sjölander, T. Andersson. 1995. The Ca2+ signaling capacity of the ß2-integrin on HL60-granulocytic cells is abrogated following phosphorylation of its CD18-chain: relation to impaired protein tyrosine phosphorylation. Exp. Cell Res. 217:140.[Medline]
  86. Cao, M. Y., M. Huber, N. Beauchemin, J. Famiglietti, S. M. Albelda, A. Veillette. 1998. Regulation of mouse PECAM-1 tyrosine phosphorylation by the Src and Csk families of protein-tyrosine kinases. J. Biol. Chem. 273:15765.[Abstract/Free Full Text]
  87. Fashena, S. J., K. Zinn. 1995. Cell-cell signaling: the ins and outs of receptor tyrosine phosphatases. Curr. Biol. 5:1367.[Medline]
  88. Barford, D., Z. Jia, N. K. Tonks. 1995. Protein tyrosine phosphatases take off. Nat. Struct. Biol. 2:1043.[Medline]
  89. Tsuda, M., T. Matozaki, K. Fukunaga, Y. Fujioka, A. Imamoto, T. Noguchi, T. Takada, T. Yamao, H. Takeda, F. Ochi, et al 1998. Integrin-mediated tyrosine phosphorylation of SHPS-1 and its association with SHP-2: roles of Fak and Src family kinases. J. Biol. Chem. 273:13223.[Abstract/Free Full Text]
  90. Roach, T., S. Slater, M. Koval, L. White, E. C. McFarland, M. Okumura, M. Thomas, E. Brown. 1997. CD45 regulates Src family member kinase activity associated with macrophage integrin-mediated adhesion. Curr. Biol. 7:408.[Medline]
  91. Smith, R. M., J. T. Curnette. 1991. Molecular basis of chronic granulomatous disease. Blood 77:673.[Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y. Wu, K. Tworkoski, M. Michaud, and J. A. Madri
Bone Marrow Monocyte PECAM-1 Deficiency Elicits Increased Osteoclastogenesis Resulting in Trabecular Bone Loss
J. Immunol., March 1, 2009; 182(5): 2672 - 2679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Lindsey, W. Huang, H. Wang, E. Horvath, C. Zhu, and E. A. Eklund
Activation of SHP2 Protein-tyrosine Phosphatase Increases HoxA10-induced Repression of the Genes Encoding gp91PHOX and p67PHOX
J. Biol. Chem., January 26, 2007; 282(4): 2237 - 2249.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Huang, G. Saberwal, E. Horvath, C. Zhu, S. Lindsey, and E. A. Eklund
Leukemia-Associated, Constitutively Active Mutants of SHP2 Protein Tyrosine Phosphatase Inhibit NF1 Transcriptional Activation by the Interferon Consensus Sequence Binding Protein.
Mol. Cell. Biol., September 1, 2006; 26(17): 6311 - 6332.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Q. Liu, P. K. Alkema, C. Tieche, B. J. Tefft, D. Z. Liu, Y. C. Li, B. E. Sumpio, J. A. Caprini, and M. Paniagua
Negative Regulation of Monocyte Adhesion to Arterial Elastic Laminae by Signal Regulatory Protein {alpha} and Src Homology 2 Domain-containing Protein-Tyrosine Phosphatase-1
J. Biol. Chem., November 25, 2005; 280(47): 39294 - 39301.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. von Gunten, S. Yousefi, M. Seitz, S. M. Jakob, T. Schaffner, R. Seger, J. Takala, P. M. Villiger, and H.-U. Simon
Siglec-9 transduces apoptotic and nonapoptotic death signals into neutrophils depending on the proinflammatory cytokine environment
Blood, August 15, 2005; 106(4): 1423 - 1431.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
F. Krotz, B. Engelbrecht, M. A. Buerkle, F. Bassermann, H. Bridell, T. Gloe, J. Duyster, U. Pohl, and H.-Y. Sohn
The Tyrosine Phosphatase, SHP-1, Is a Negative Regulator of Endothelial Superoxide Formation
J. Am. Coll. Cardiol., May 17, 2005; 45(10): 1700 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. Zhang, E. Jimi, and A. L. M. Bothwell
Receptor Activator of NF-{kappa}B Ligand Stimulates Recruitment of SHP-1 to the Complex Containing TNFR-Associated Factor 6 That Regulates Osteoclastogenesis
J. Immunol., October 1, 2003; 171(7): 3620 - 3626.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. S. Cayabyab, F. W. L. Tsui, and L. C. Schlichter
Modulation of the ERG K+ Current by the Tyrosine Phosphatase, SHP-1
J. Biol. Chem., December 6, 2002; 277(50): 48130 - 48138.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Eklund, I. Goldenberg, Y. Lu, J. Andrejic, and R. Kakar
SHP1 Protein-tyrosine Phosphatase Regulates HoxA10 DNA Binding and Transcriptional Repression Activity in Undifferentiated Myeloid Cells
J. Biol. Chem., September 20, 2002; 277(39): 36878 - 36888.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. D. Chernock, R. P. Cherla, and R. K. Ganju
SHP2 and cbl participate in {alpha}-chemokine receptor CXCR4-mediated signaling pathways
Blood, February 1, 2001; 97(3): 608 - 615.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kruger, J. R. Butler, V. Cherapanov, Q. Dong, H. Ginzberg, A. Govindarajan, S. Grinstein, K. A. Siminovitch, and G. P. Downey
Deficiency of Src Homology 2-Containing Phosphatase 1 Results in Abnormalities in Murine Neutrophil Function: Studies in Motheaten Mice
J. Immunol., November 15, 2000; 165(10): 5847 - 5859.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Beghini, C. B. Ripamonti, P. Peterlongo, G. Roversi, R. Cairoli, E. Morra, and L. Larizza
RNA hyperediting and alternative splicing of hematopoietic cell phosphatase (PTPN6) gene in acute myeloid leukemia
Hum. Mol. Genet., September 1, 2000; 9(15): 2297 - 2304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. Berg, K. A. Siminovitch, and E. R. Stanley
SHP-1 Regulation of p62DOK Tyrosine Phosphorylation in Macrophages
J. Biol. Chem., December 10, 1999; 274(50): 35855 - 35865.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Zhang, A.-K. Somani, D. Yuen, Y. Yang, P. E. Love, and K. A. Siminovitch
Involvement of the SHP-1 Tyrosine Phosphatase in Regulation of T Cell Selection
J. Immunol., September 15, 1999; 163(6): 3012 - 3021.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. K. Ganju, S. A. Brubaker, R. D. Chernock, S. Avraham, and J. E. Groopman
beta -Chemokine Receptor CCR5 Signals through SHP1, SHP2, and Syk
J. Biol. Chem., June 2, 2000; 275(23): 17263 - 17268.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Kautz, R. Kakar, E. David, and E. A. Eklund
SHP1 Protein-tyrosine Phosphatase Inhibits gp91PHOX and p67PHOX Expression by Inhibiting Interaction of PU.1, IRF1, Interferon Consensus Sequence-binding Protein, and CREB-binding Protein with Homologous Cis Elements in the CYBB and NCF2 Genes
J. Biol. Chem., October 5, 2001; 276(41): 37868 - 37878.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Kruger, T. Fukushima, V. Cherepanov, N. Borregaard, C. Loeve, C. Shek, K. Sharma, A. K. Tanswell, C.-W. Chow, and G. P. Downey
Protein-tyrosine Phosphatase MEG2 Is Expressed by Human Neutrophils. LOCALIZATION TO THE PHAGOSOME AND ACTIVATION BY POLYPHOSPHOINOSITIDES
J. Biol. Chem., January 18, 2002; 277(4): 2620 - 2628.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Vitale, C. Romagnani, A. Puccetti, D. Olive, R. Costello, L. Chiossone, A. Pitto, A. Bacigalupo, L. Moretta, and M. C. Mingari
Surface expression and function of p75/AIRM-1 or CD33 in acute myeloid leukemias: Engagement of CD33 induces apoptosis of leukemic cells
PNAS, May 8, 2001; 98(10): 5764 - 5769.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, Q.
Right arrow Articles by Downey, G. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, Q.
Right arrow Articles by Downey, G. P.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Stem Cells


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS