| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Deutsches Rheuma ForschungsZentrum, Berlin, Germany; and
Institut für Pathologie, Universität Würzburg, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and lymphotoxin , which play
a central role in joint inflammation 2 , may help to promote the
development of ectopic lymphoid tissue 3, 4 . Immunohistochemical
examination of the ST shows that lymphocytic aggregates are relatively
infrequent in the early stages of the disease; however, they form as
the disease progresses 5, 6 . The cellular composition of the
lymphocyte clusters seems to vary depending on the size. Small
aggregates consist mainly of T cells with only few B cells, while large
ones contain substantially more B cells 7 . Synovial lymphocytic
infiltrates often reveal a structure and cellular composition
reminiscent of that seen in germinal centers (GC) of the peripheral
lymphoid organs 8, 9 . Classical GC arise transiently in the primary B cell follicles of secondary lymphoid organs during immune responses and provide a microenvironment for B cell differentiation 10, 11 . Well-studied GCs in human tissue are those found in the tonsil 12, 13 . Immunohistochemistry shows that they are composed of a dark and a light zone 14 . B cells in the dark zone, which are referred to as centroblasts, undergo massive clonal expansion. Concomitantly, they activate a mechanism that introduces somatic mutations into the rearranged Ig V genes and, thus, can lead to changes in the B cell receptor affinity for its Ag. The light zone of the GC contains a network of follicular dendritic cells (FDC) that have the capacity to retain Ag and present it in the form of immune complexes. B cell variants generated in the dark zone move into the light zone where they are believed to compete for the Ag. Those B cells with receptors of high affinity may receive signals provided by T cells that ensure their survival. The high-affinity B cells selected in this way subsequently differentiate into memory B cells and plasma cells, which have the potential to secrete Abs of high affinity and specificity.
Recent work suggested that an Ag-dependent immune reaction takes place in the ST of patients with RA 15, 16, 17, 18 . An analysis in which single lymphocytic infiltrates from frozen sections of the ST of patients with RA or with chronic reactive arthritis (ReA) were analyzed has demonstrated that a GC reaction may occur in the ST 19, 20, 21 . The analysis of the V gene repertoire showed that B cells can proliferate and accumulate somatic mutations in the chronically inflamed ST. The stepwise introduction of somatic point mutations into the rearranged Ig V genes may result in variants that have acquired high affinity to local Ags. In the case of patients with RA, this might be an autoantigen. For example, the analysis of rheumatoid factor-secreting cell lines has suggested that high-affinity B cells with specificity for self-Ig develop in the ST 18 . In the case of patients with ReA, it has been suggested that bacterial Ags may drive the chronic immune response 22 .
Immunohistological analysis of the lymphocytic infiltrates in the ST showed that plasma cells are organized in concentric rings around the large cellular clusters of CD20+ B and T cells 20 . These characteristic histological features of the affected tissue have led us to ask whether B cell variants generated in synovial GC are selected to differentiate into plasma cells. If this hypothesis is correct, then it would seem that local Ag in the ST may drive both the diversification of the V gene repertoire and the differentiation of plasma cells.
To address this question, a methodology was employed that allows us to combine immunohistological information with a biochemical analysis. Previous work has demonstrated that through micromanipulation single cells can be isolated from frozen tissue sections and their V gene repertoire can be determined 12 . Control experiments have shown that this technique yields specific and reproducible results. For example, it has been of great value for the analysis of tumor cell development 23, 24 .
To examine whether differentiation of B cells into plasma cells takes place in the ST, both CD20+ B cells and plasma cells were isolated directly from single infiltrates by micromanipulation, and their V(D)J rearrangements were analyzed. The results show a stepwise accumulation of somatic mutations in the V genes expressed in B cells proliferating in a network of FDC. In addition, V gene sequences were isolated from plasma cells. We were unable to find clonal relationships between the central CD20+ B cells and the surrounding plasma cells. Nevertheless, the data suggest that hypermutation and terminal B cell differentiation take place in the synovial GC-like structures. It seems that the ST supports longevity of plasma cells, leading to their accumulation in the chronically inflamed tissue.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ST was obtained from two patients who fulfilled the Arthritis
and Rheumatism Association criteria for RA 25 (patient EK 20 , a
72-year-old seronegative female, from which ST was derived from the
wrist, where a vilo-nodular synovitis was diagnosed; and patient PS, a
47-year-old seropositive female with a highly progressive form of
definitive RA involving tendon sheath from where the examined ST was
derived). In addition, ST was used from one patient with presumptive RA
(patient AR, a 18-year-old male) and one patient with established
chronic ReA (patient TS 21 , a 30-year-old male, who developed ReA
after a urethral infection with Chlamydia trachomatis; the
biopsy was taken 4 years after onset of the disease) (Table I
). Frozen tissue was cut into 6-µm
sections, which were dried at room temperature and subsequently treated
with acetone.
|
To identify cell types and their location in the ST, tissue sections were labeled with anti-CD20, anti-CD4, anti-FDC, and anti-plasma cell Abs and visualized using the alkaline phosphatase-anti-alkaline phosphatase (APAAP) technique. Monoclonal mouse anti-human Abs were used as primary Abs (anti-CD20, Dako (High Wycombe, U.K.); anti-CD4, Dako; anti-FDC, Wue 2 20 ; anti-plasma cells, Wue 1 20). Bridge Abs were rabbit anti-mouse IgG (Dako). Sections were subsequently incubated with APAAP-conjugated-Ab (Dako) using neufuchsin as the substrate. In addition, some of the sections were labeled with an affinity-purified rabbit Ab specific for the nuclear Ag Ki-67 (Dako). Haematoxylin (Merck, Darmstadt, Germany) staining was used to enhance the contrast between labeled and nonlabeled cells.
Isolation of CD20+ B cells and DNA extraction
To define the different areas of the lymphocytic infiltrates,
tissue sections were double labeled with Abs specific for FDC and for
plasma cells. Small groups of 
50 cells were isolated directly from
immunochemically labeled tissue sections using a micromanipulator
(Nikon, Tokyo, Japan). Isolated cells were transferred to
500-µl tubes, and DNA was prepared by incubation at 50°C for 1
h with proteinase K (16.4 mg/ml; Boehringer Mannheim, Mannheim,
Germany). Proteinase K was inactivated by heating at 95°C for 10 min.
Isolation of plasma cells
To avoid contamination with CD20+ B cells, single plasma cells were microdissected from tissue sections labeled with the mAb Wue 1. Approximately 50 cells were pooled, and DNA was extracted as described for CD20+ B cells. In only one of the experiments was DNA prepared from single cells. In this case, individual CD20+ B cells and plasma cells were microdissected and their expressed V gene repertoire was analyzed. DNA was prepared from single cells in the same way as described for groups of cells.
Amplification of Ig V genes
Rearranged Ig V genes were amplified from CD20+ B
cells or from plasma cells by PCR. Two steps of amplification were used
to obtain appropriate amounts of PCR product. To improve the
specificity of the second amplification step, seminested PCR reactions
were conducted. In the first step, 35 cycles of amplification with
Taq polymerase were performed with VH 20 , V
20 , and V
5' primers (V1, 5'-
CAGTCTGTGTTGACGCAGCCGCC; V2a, 5'-CAGTCTGCCCTGACTCAGCCTGC;
V2b, 5'-CAGTCTGCCCTGATTCAGCCTCC; V3a,
TCCTATGTGCTGACTCAGCCACC; V3b, 5'-TCTTCTGAGCTGACTCAGGACCC; V4,
5'-CACGTTATACTGACTCAACCGCC; V5, 5'-CAGGCTGTGCTCACTCAGCCGTC;
V6, 5'-AATTTTATGCTGACTCAGCCCCA; and V7/8,
5'-CAGACTGTGGTGACGCAGGAGCC) and external JH
(5'-CTCACCTGAGGAGACGGTGACC), J (J1–4,
5'-TACTTACGTTTGATCTCCASCTTG; and J5,
5'-GCTTACGTTTAATCTCCAGTCGTG), and J region (J1,
5'-GAGAGCCACTTACCTAGGACGG; J2, 5'-AGAAGAGACTCACCTAGGACGG) specific
3' primers. In the second round, aliquots were specifically amplified
for 39 cycles for either heavy, -, or -chain genes separately
using the same 5' VH, V, and V primers but internal
JH, J, and J 3' primers 20 . The final concentrations of the
reagents were 50 mM KCl, 10 mM Tris-HCl, ph 9.0, 0.1% Triton X-100,
0.1 mM MgCl2, 200 µM of each deoxynucleoside
triphosphate, 10 pM of each primer, and 2 U Taq DNA
polymerase. Two different polymerases were used; Taq
polymerase from Promega (Madison, WI) for the tissue from patients EK,
AR, and TS and Ampli Taq Gold (Perkin-Elmer, Norwalk,
CT) for patient PS. The cycle program consisted of a
denaturation step at 95°C for 2 min followed by 35 or 39 cycles, at
95°C for 1 min, 70°C (for heavy chain genes) or 65°C (for light
chain genes) for 1 min 30 s, and 72°C for 2 min. The cycles were
followed by a final 15 min incubation at 72°C. Aliquots of the final
PCR products were separated by electrophoresis using a 2% low-melting
agarose gel, and DNA bands in the range of 350 bp were purified from
the agarose gel using Jet sorb DNA extraction (Genomed, Bad Oeynhausen,
Germany).
The PCR error rate is negligible under these conditions as shown by the
high frequency of unmutated sequences. For example, when
CD20+ B cells were isolated from the network of FDC, 16 of
36 sequences carried no nucleotide substitution. The average frequency
of exchanges introduced by the amplification is less than one
exchange/V sequence. Furthermore, to demonstrate the stepwise
accumulation of single somatic mutations, two independent PCR reactions
were performed with cells isolated from the same synovial infiltrate
(see Results and Fig. 2).
|
PCR products were cloned into the TA cloning vector
(Invitrogen, San Diego, CA). Randomly picked clones were
screened for inserts of 350 bp and sequenced by the dideoxy chain
termination method using Taq polymerase for DNA
amplification. Standard sequencing primers were digoxigenin labeled.
Sequencing reactions were analyzed as described previously 20 .
Briefly, DNA bands were blotted directly onto a nylon transfer membrane
(Serva, Heidelberg, Germany) and labeled with
anti-digoxigenin-Fab coupled to phosphatase (Boehringer Mannheim).
Using the DNA plot program (Müller and Althaus, Köln,
Germany), putative germline sequences were identified in the VBASE
sequence directory (I. Tomlinson, Cambridge, U.K.) and in the IMGT data
base (M.-P. Lefranc, Montpellier, France). In addition, searches were
performed using GenBank information.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Some reports have suggested that lymphocytic infiltrates in the ST
resemble tonsillar GCs and that they are compartmentalized in the same
way 8, 9 . However, in general one does not see a typical dark and
light zone 20 . The synovial GC is made up of macrophages, T, and B
cells and in only about 30% of the cases are FDC found 9 . FDC, when
present are found in the center of the aggregates (Fig. 1, A, D, and
E), and, in contrast to the typical tonsillar light zone,
few T cells (Fig. 1, C and G) and no plasma cells
are detected in the FDC network (Fig. 1F). Plasma cells are
generally found as a halo surrounding the lymphocytic infiltrate (Fig. 1, B and F).
|
The ST of patient PS is extensively infiltrated by lymphocytes.
Multiple large follicle-like structures have developed so that the
synovial membrane seems to resemble lymphoid tissue (Fig. 1
, A and B). Labeling of tissue sections with Abs
specific for the nuclear Ag Ki-67 reveals dense clusters of dividing B
cells within the central network of FDC (Fig. 1, A and
B), suggesting that B cells are activated by Ag presented on
the surface of these cells. To analyze B cell development in the ST of
this RA patient, consecutive tissue sections were labeled with mAbs
specific for FDC, B cells, and the nuclear Ag Ki-67. Two regions of
25 Ki-67+ B cells were microdissected from the FDC
network seen in the right hand infiltrate of Fig. 1A. DNA
was extracted and the rearranged V(D)J regions amplified. In the two
independent PCR reactions, a total of three different VH
and five different V functional rearrangements were isolated,
suggesting an oligoclonal population in this lymphoid infiltrate (Table II). A VH (VH3–8 (according
to Matsuda et al. 26 gene 3–11)/JH4b) and a
V (DPL23/J1) gene rearrangement was
recovered several times from both groups of cells, demonstrating
expansion of a single B cell clone (Table II). These sequences differ
from the putative germline genes by 3–10 nucleotides. The pattern of
somatic mutations demonstrates a stepwise accumulation of single
nucleotide substitutions into the V genes introduced during B cell
proliferation in the ST (Fig. 2).
|
In general, lymphocytic cell clusters in the ST are
surrounded by a ring of plasma cells (Fig. 1, B and
F). This characteristic distribution suggests that these
plasma cells develop from B cells activated in the synovial network of
FDC, which then differentiate in the adjacent T cell-rich zone. To
demonstrate the process of local plasma cell differentiation, B cell
subpopulations were analyzed from three different regions of a single
infiltrate: 1) the network of FDC (Fig. 1E), 2) the T
cell-rich zone (Fig. 1G), and 3) the ring of plasma cells
(Fig. 1F). To distinguish the different B cell
subpopulations, tissue sections were double labeled with mAbs specific
for FDC and for plasma cells. First, individual plasma cells were
microdissected from the tissue section and combined only after
isolation. In this way contamination by CD20+ B cells could
be excluded. In addition, groups of 50 B cells were taken from
the labeled network of FDC and from the unlabeled area where B cells
are in contact with T cells. DNA was extracted from the three isolated
B cell subpopulations and the rearranged VH and
VL genes were amplified by PCR, cloned, and sequenced.
The V gene repertoire expressed in CD20+ B cells was
comparable to that seen in peripheral blood B cells (Fig. 3, A and B) 27, 28 . The majority of H chain sequences belonged to the VH-3
gene family, and rearrangements of the VH genes 3–23
(DP47) and 3–30 (COS8, DP46, and DP49) were found frequently (Fig. 3).
In contrast, plasma cells seemed to express a more selected repertoire
(Fig. 3C). Though the number of different functional
VH gene sequences isolated was rather small
(n = 7), a shift toward rearrangements of the
VH-4 gene family was evident. Taking only the functional
rearrangements into account, 4 of 7 plasma cell sequences (57%) and 3
of 23 CD20+ B cell sequences (13%) belonged to the
VH-4 gene family. Thus, CD20+ B cells and
plasma cells seem to be two distinct cell populations.
|
, some CD20+ B cells and plasma cells used the same germline
V segments for their V genes; the heavy chain genes 1–18 (DP14), 3–30
(COS8), and 4–59 (DP71) were present in both populations (Fig. 3), as
were DPK9 (O2) and DPK24 (B3) (data not shown). However, in each case
the heavy and light chain genes were rearranged with different (D)J
segments or showed different junctional diversity, demonstrating that
they originate from different clones. Thus, there was no evidence of
identical VH and VL gene rearrangements in the
two B cell subsets.
In addition, these B cell subpopulations could be distinguished by
their degree of somatic diversity. V region sequences isolated from the
CD20+ B cells in the network of FDC were almost all
unmutated (80% of the sequences), indicating that these B cells were
recent immigrants from the peripheral blood (Fig. 3D). In
the few sequences isolated from the T cell area, only 50% of the
sequences were unmutated (Fig. 3E). This frequency was
further reduced to 12.5% in VH and VL
rearrangements expressed in plasma cells (Fig. 3F).
Sequences were ranked according to their degree of somatic diversity.
Using a variance analysis (Kruskal-Wallis Test), it was found that B
cells taken from the different regions of the synovial GC represent
distinct stages of B cell differentiation (p =
0.002). Interestingly, plasma cells differ significantly in their
frequency of somatic mutations from the CD20+ B cells
isolated from the network of FDC (Mann-Whitney test, p
= 0.001) but not from the CD20+ B cells taken from the T
cell area (p = 0.136). These results support
the interpretation that CD20+ B cells are diversified
within the network of FDC and then differentiate in the T cell area
into plasma cells.
The analysis of a cellular infiltrate in the ST of a patient with ReA
The immunohistochemical analysis of the ST of patients with ReA
has shown that lymphocytic infiltrates have a similar structure to
those seen in the ST of RA patients. In addition, a GC reaction takes
place in the inflamed tissue 18 . To study B cell differentiation in
the ST from an established ReA patient, a V gene analysis was performed
by isolating CD20+ B and plasma cells of a single
lymphocytic cell cluster (infiltrate II from the ST of patient TS,
Table I). Fig. 1C shows that the central part of this
infiltrate was practically free of T cells. Here, a dense network of
FDC was seen (Fig. 1D). From this part of the infiltrate,
CD20+ B cells were isolated and their V gene repertoire was
compared with that of the surrounding plasma cells.
The repertoire of VH genes expressed in both the
CD20+ B cells and in the synovial plasma cell population is
shown in Fig. 4. Approximately 50
CD20+ B cells from each of two consecutive sections yielded
15 different VH and 19 VL rearrangements (13
V and 6 V genes) of which 13
VH (Fig. 4A), 7 V, and 4
V sequences were productively rearranged. Thus, in this
small area there are a minimum of 13 different B cell clones. Plasma
cells also showed a high degree of diversity. Here, from the two
consecutive sections a total of 14 different VH (Fig. 4B), 11 different V, and 23 different
V genes were isolated.
|
). For both CD20+ B cells and plasma cells, genes
from the largest family, VH-3, were found most often,
followed by genes from the VH-4 and then VH-1
and VH-2 family. However, as described for cluster I from
the RA patient PS, a greater use of the VH-4 family was
seen in plasma cells. The only VH-4 family member isolated
from the CD20+ B cells was the VH gene 4–59
(DP71). In contrast, the VH-4 genes 4–34 (DP63), 4-OR15–8
(DP69), and 4–39 (DP79) have been found in plasma cells. In addition,
differences between the two B cell subsets were seen when the length of
the complementarity determining region III (CDRIII) was compared
(data not shown). Most of the CD20+ B cells expressed
VH/D/J rearrangements with a CDRIII of 10–12 amino acids,
whereas plasma cells showed a tendency toward longer CDRIII regions (an
average length of 13–15 amino acids). The JH usage was the
same for both populations; most frequently rearrangements to
JH-4 were seen.
Fig. 4, C and D shows the frequency of somatic
mutations in CD20+ B cells and in plasma cells. A total of
50% of the V gene sequences isolated from CD20+ B cells in
the network of FDC were unmutated. The other sequences carried low
numbers of somatic mutations (Fig. 4C). In the V region
sequences isolated from plasma cells, only 12% of the isolated V(D)J
rearrangements were unmutated. Using the nonparametric Mann-Withney
test, sequences were ranked according to their degree of somatic
diversity. The analysis showed that there is a highly significant
difference when the frequency of somatic mutations in the
CD20+ B cells and plasma cells are compared
(p 
0.001).
The development of plasma cells within the microenvironment of the synovial GC
Altogether from six different cellular infiltrates derived from
both patients with RA and ReA, the V gene repertoire of
CD20+ B cells and plasma cells was compared (Table I). In
no case were identical rearrangements seen in the two B cell
populations. However, the examination of groups of plasma cells derived
from various cell clusters suggests that in the ST CD20+ B
cells differentiate into plasma cells. From the ST of both, patients
with RA and the patient with ReA plasma cell sequences with identical
V(D)J rearrangement but different patterns of somatic mutation were
isolated. Fig. 4D shows that five sequences derived from
plasma cells of ReA patient TS carried no more than two somatic
mutations. One of these rearrangements, a joining of a V DPK4 (A20)
to J4, showed intraclonal diversity (Fig. 5A). These V genes have one
somatic mutation in common but differ by two to seven nucleotides from
each other. A genealogical tree shows the accumulation of somatic
mutations (Fig. 5A). This result is most readily explained
as the consequence of a B cell becoming locally activated and
accumulating somatic mutations during proliferation in the ST. In Fig. 5B, sequences from a V DPK21 (L2)/J1 rearrangement are
shown. These three sequences have 13 somatic mutations in common and
differ by two to six nucleotides from each other. In this case, it
seems that a memory B cells became reactivated in the ST and further
diversified during proliferation. Further examples are shown in Fig. 5, C and D. The finding of intraclonal diversity in
sequences derived from plasma cells of close physical proximity makes
it unlikely that diversification of B cells took place outside of the
ST and that descendants of the same B cell clone settled within the
same lymphoid structure. Thus, both diversification of the V gene
repertoire and differentiation into plasma cells seem to take place
within the microenvironment of the ST.
|
Only the examination of V genes at a single-cell level allows us
to show whether sequences with identical rearrangements found in the
PCR were in fact amplified from the DNA of distinct cells. For this
reason, single cells were isolated from a GC-like cluster in the ST of
patient RA-EK. The rearranged V genes were amplified from individual
cells and sequenced. Of the 9 single CD20+ B cells and 13
plasma cells examined, we isolated 9 V genes (data not shown); 2
from CD20+ B cells and 7 from plasma cells. Among the seven
sequences isolated from single plasma cells, two showed identical
VJ rearrangements as well as nearly identical patterns of somatic
mutation (Fig. 5E). Both rearrangements used the DPK1 (O18)
V gene and the J4 gene and contained the same joining pattern. The
sequences have 12 somatic mutations in common. In one of the V
regions, two additional somatic mutations were seen. These two
mutations are not introduced during PCR amplification, as they were
seen in all clones sequenced. These results demonstrate that within the
ST a plasma precursor cell not only divided, but in addition
accumulated somatic mutations.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The analysis provided no direct evidence for a clonal relationship
between differentiating CD20+ B cells in the GC-like
structures and the surrounding plasma cells. However, sequences with an
identical rearrangement but a different pattern of somatic mutations
were isolated from neighboring plasma cells of single lymphocytic
infiltrates (Fig. 5). Thus, we are left with the puzzling observation
that within these infiltrates we find sets of clonally related
CD20+ B cells and sets of related plasma cells, but there
is no detectable lineage relationship between the CD20+ B
cell and plasma cell populations.
Clearly, the V gene repertoire of CD20+ B cells is
diversified in the ST, but do they then differentiate into plasma cells
in these ectopic GC structures? Both immunohistology and the molecular
analysis suggest that indeed they do. The increasing somatic diversity
seen in V genes expressed in B cells from the network of FDC, from the
T cell-rich zone, and from the ring of plasma cells suggests a stepwise
differentiation of B cells in the ST (Fig. 3, D–F). We
would like to speculate that, in analogy to the GC in the peripheral
lymphoid organs, a range of somatic variants are generated from which
only a few are selected to differentiate into plasma cells.
In tonsillar GC, B cell proliferation is concentrated in the dark zone
and only a few dividing centroblasts are observed in the network of the
FDC in the light zone 12 . The situation is different in the synovial
GC, where B cell proliferation is mainly seen within the network of FDC
(Fig. 1B). The analysis of GC in mouse spleen has
demonstrated that GC have a dynamic architecture that changes over the
course of an immune response, and B cell proliferation in the network
of FDC is observed only in the early stages 30 . In view of this, the
GC isolated from the ST of the RA patient PS probably represent newly
induced GC. This interpretation is supported by the repertoire
analysis. B cells taken from the network of FDC expressed a random
repertoire characteristic of the peripheral blood B cells, and, as one
might expect for naive cells, the majority of V genes were unmutated
(Fig. 3D).
If an Ag-dependent diversification of the repertoire and selective
differentiation of B cells take place in the ST, why then is it so
difficult to find sequences with identical rearrangements in the B
cells of different developmental stages? Two factors probably explain
this point. The first is the high degree of B cell diversity in the
synovial GC. When a single section from the infiltrate I of RA-PS was
analyzed, 13 different functional VH rearrangements were
found in the CD20+ B cell population (Fig. 3A).
It is likely that only a few of these cells are activated to take part
in a GC reaction. For example, the V gene analysis of proliferating B
cells isolated from the network of FDC (Fig. 1, A and
B and Table II) showed expansion of a single B cell clone
(Table II). In addition, only few of the activated B cells will be
selected to differentiate into plasma cells. Second, the B cell
population that influxes to the ST may turn over rapidly. In contrast,
plasma cells may well be long-lived in the ST and accumulate here 31 .
This means that the plasma cells and the CD20+ B cells
within a synovial GC are not only spatially but also temporally
distinct populations. Taken together, these two points explain the fact
that we fail to recover CD20+ B cells and plasma cells of
the same clonal origin.
In the murine system, it has been shown that in the T cell-dependent immune response early plasma cell development takes place extrafollicularly. These plasma cells secrete mainly low-affinity Abs of the IgM class, and V genes expressed in these plasma cells are unmutated 32 . In contrast, high-affinity plasma cells expressing mutated V gene sequences develop in GC. Interestingly, the majority of plasma cells isolated from the ST V genes carried multiple somatic mutations. To which extent these plasma cells were generated in synovial GC-like structures cannot be answered. However, it is most likely that those rearrangements, which showed intraclonal diversity, developed within the same infiltrate.
Plasma blasts developing in GC of the human tonsil or murine splenic tissue are believed to leave this microenvironment and to accumulate in the bone marrow 33, 34, 35, 36 . The ST may, like bone marrow, provide an environment that supports longevity of plasma cells 31, 37 . Thus, in contrast to the lymphoid tissue, plasma cells may stay in the ST and accumulate in the vicinity of the GC microenvironment. This may explain the high numbers of plasma cells often seen in the ST of patients with a long-term chronic synovitis.
While it is certainly possible that synovial plasma blasts are still dividing, there is no evidence so far available that somatic mutations accumulate once plasma blasts have left the microenvironment of the GC 38 . However, even in the absence of hypermutation affinity maturation through selection may continue. Recent data suggest that the bone marrow supports a long-term protective high-affinity humoral immune response 38 . If the same is true for the ST the consequences for autoimmune diseases may be considerable.
The analysis of plasma cells in the cluster I from the ST of the RA
patient PS indicated a prevalence of rearrangements of the
VH-4 gene family (Fig. 3). When we pool the data from six
different infiltrates together (62 different rearrangements isolated
from CD20+ B cells and 41 different rearrangements isolated
from plasma cells), the shift toward VH-4 in the plasma
cell population is confirmed (Fig. 6)
(
2 test, p = 0.076). These results may
point to selection by Ags, self or foreign, that preferentially
interact with VH-4 gene products or alternatively to the
activation of B cells through superantigens, which have been shown to
play a role in shaping the B cell repertoire. For example,
staphylococcal enterotoxin D specifically activates B cells expressing
rearrangements of the VH-4 gene family 39 . Ags other than
superantigens may be involved in the selective differentiation of
synovial plasma cells because we see both a shift toward
VH-4 and in addition a selection for longer CDRIIIs.
Interestingly, the tendency toward rearrangements of the
VH-4 gene family is seen in plasma cells from patients with
different rheumatic diseases. However, the sample size is rather
limited as only two patients with defined RA and one with ReA were
examined.
|
We do not know why B cells migrate into the ST. Multiple factors, like
the cytokine milieu, chemokine pattern, or the presence of activated
CD4 Th cells, may support B cell immigration. Proinflammatory cytokines
like TNF- and lymphotoxin may support the development of a
network of FDC, and this may be the first step in the development of
GC-like structures 3 . Thus, in the ST a microenvironment may build up
that allows a GC reaction to take place. Microdissection makes it
possible to identify those B cells in the ST that go through an
Ag-dependent process of affinity maturation. Thus, we have a tool to
analyze the V genes expressed in B cells that are selected in the ST to
differentiate into plasma cells. Through the expression of heavy and
light chain V genes it should be possible to determine the specificity
of those cells which take part in the local immune response.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hye-Jung Kim, Deutsches Rheuma ForschungsZentrum, Berlin, Monbijoustrasse 2, 10117 Berlin, Germany. E-mail address:
3 Abbreviations used in this paper: RA, rheumatoid arthritis; FDC, follicular dendritic cell; GC, germinal center; ReA, reactive arthritis; ST, synovial tissue.
Received for publication August 11, 1998. Accepted for publication November 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
therapy of rheumatoid arthritis. Adv. Immunol. 64:283.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. D. Pescovitz, C. J. Greenbaum, H. Krause-Steinrauf, D. J. Becker, S. E. Gitelman, R. Goland, P. A. Gottlieb, J. B. Marks, P. F. McGee, A. M. Moran, et al. Rituximab, B-Lymphocyte Depletion, and Preservation of Beta-Cell Function N. Engl. J. Med., November 26, 2009; 361(22): 2143 - 2152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J D Canete, R Celis, C Moll, E Izquierdo, S Marsal, R Sanmarti, A Palacin, D Lora, J de la Cruz, and J L Pablos Clinical significance of synovial lymphoid neogenesis and its reversal after anti-tumour necrosis factor {alpha} therapy in rheumatoid arthritis Ann Rheum Dis, May 1, 2009; 68(5): 751 - 756. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Cantaert, J. Kolln, T. Timmer, T. C. van der Pouw Kraan, B. Vandooren, R. M. Thurlings, J. D. Canete, A. I. Catrina, T. Out, C. L. Verweij, et al. B Lymphocyte Autoimmunity in Rheumatoid Synovitis Is Independent of Ectopic Lymphoid Neogenesis J. Immunol., July 1, 2008; 181(1): 785 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. R. Withers, C. Fiorini, R. T. Fischer, R. Ettinger, P. E. Lipsky, and A. C. Grammer T cell dependent survival of CD20+ and CD20 plasma cells in human secondary lymphoid tissue Blood, June 1, 2007; 109(11): 4856 - 4864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Genton, Y. Wang, S. Izui, B. Malissen, G. Delsol, G. J. Fournie, M. Malissen, and H. Acha-Orbea The Th2 Lymphoproliferation Developing in LatY136F Mutant Mice Triggers Polyclonal B Cell Activation and Systemic Autoimmunity J. Immunol., August 15, 2006; 177(4): 2285 - 2293. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Munoz-Fernandez, F. J. Blanco, C. Frecha, F. Martin, M. Kimatrai, A. C. Abadia-Molina, J. M. Garcia-Pacheco, and E. G. Olivares Follicular Dendritic Cells Are Related to Bone Marrow Stromal Cell Progenitors and to Myofibroblasts J. Immunol., July 1, 2006; 177(1): 280 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nakamura-Kikuoka, K. Takahi, H. Tsuboi, T. Toyosaki-Maeda, M. Maeda-Tanimura, C. Wakasa, N. Kikuchi, S. Norioka, M. Iwasaki, T. Matsutani, et al. Limited VH gene usage in B-cell clones established with nurse-like cells from patients with rheumatoid arthritis Rheumatology, May 1, 2006; 45(5): 549 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. Carter B Cells in Health and Disease Mayo Clin. Proc., March 1, 2006; 81(3): 377 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Jimenez-Boj, K. Redlich, B. Turk, B. Hanslik-Schnabel, A. Wanivenhaus, A. Chott, J. S. Smolen, and G. Schett Interaction between Synovial Inflammatory Tissue and Bone Marrow in Rheumatoid Arthritis J. Immunol., August 15, 2005; 175(4): 2579 - 2588. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, K.-H. Ko, Q. L. K. Lam, C. K. C. Lo, G. Srivastava, B. Zheng, Y.-L. Lau, and L. Lu Expression and function of TNF family member B cell-activating factor in the development of autoimmune arthritis Int. Immunol., August 1, 2005; 17(8): 1081 - 1092. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Takhar, L. Smurthwaite, H. A. Coker, D. J. Fear, G. K. Banfield, V. A. Carr, S. R. Durham, and H. J. Gould Allergen Drives Class Switching to IgE in the Nasal Mucosa in Allergic Rhinitis J. Immunol., April 15, 2005; 174(8): 5024 - 5032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ghosh, A. C. Steere, B. D. Stollar, and B. T. Huber In Situ Diversification of the Antibody Repertoire in Chronic Lyme Arthritis Synovium J. Immunol., March 1, 2005; 174(5): 2860 - 2869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Ritchie, D. H. Gilden, R. A. Williamson, M. P. Burgoon, X. Yu, K. Helm, J. R. Corboy, and G. P. Owens Comparative Analysis of the CD19+ and CD138+ Cell Antibody Repertoires in the Cerebrospinal Fluid of Patients with Multiple Sclerosis J. Immunol., July 1, 2004; 173(1): 649 - 656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Kim, T. Kammertoens, M. Janke, O. Schmetzer, Z. Qin, C. Berek, and T. Blankenstein Establishment of Early Lymphoid Organ Infrastructure in Transplanted Tumors Mediated by Local Production of Lymphotoxin {alpha} and in the Combined Absence of Functional B and T Cells J. Immunol., April 1, 2004; 172(7): 4037 - 4047. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Buckley Why do leucocytes accumulate within chronically inflamed joints? Rheumatology, December 1, 2003; 42(12): 1433 - 1444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Nandakumar, L. Svensson, and R. Holmdahl Collagen Type II-Specific Monoclonal Antibody-Induced Arthritis in Mice: Description of the Disease and the Influence of Age, Sex, and Genes Am. J. Pathol., November 1, 2003; 163(5): 1827 - 1837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Galli, S. Nuti, S. Tavarini, L. Galli-Stampino, C. De Lalla, G. Casorati, P. Dellabona, and S. Abrignani CD1d-restricted Help To B Cells By Human Invariant Natural Killer T Lymphocytes J. Exp. Med., April 21, 2003; 197(8): 1051 - 1057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yu, G. C. Sharp, and H. Braley-Mullen Dual Roles for IFN-{gamma}, But Not for IL-4, in Spontaneous Autoimmune Thyroiditis in NOD.H-2h4 Mice J. Immunol., October 1, 2002; 169(7): 3999 - 4007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P A Klimiuk, S Sierakowski, R Latosiewicz, J P Cylwik, B Cylwik, J Skowronski, and J Chwiecko Soluble adhesion molecules (ICAM-1, VCAM-1, and E-selectin) and vascular endothelial growth factor (VEGF) in patients with distinct variants of rheumatoid synovitis Ann Rheum Dis, September 1, 2002; 61(9): 804 - 809. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Coronella, C. Spier, M. Welch, K. T. Trevor, A. T. Stopeck, H. Villar, and E. M. Hersh Antigen-Driven Oligoclonal Expansion of Tumor-Infiltrating B Cells in Infiltrating Ductal Carcinoma of the Breast J. Immunol., August 15, 2002; 169(4): 1829 - 1836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Muller, U. E. Hopken, H. Stein, and M. Lipp Systemic immunoregulatory and pathogenic functions of homeostatic chemokine receptors J. Leukoc. Biol., July 1, 2002; 72(1): 1 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Klimiuk, S. Sierakowski, R. Latosiewicz, B. Cylwik, J. Skowronski, and J. Chwiecko Serum matrix metalloproteinases and tissue inhibitors of metalloproteinases in different histological variants of rheumatoid synovitis Rheumatology, January 1, 2002; 41(1): 78 - 87. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Pettit, H. Weedon, M. Ahern, S. Zehntner, I. H. Frazer, J. Slavotinek, V. Au, M. D. Smith, and R. Thomas Association of clinical, radiological and synovial immunopathological responses to anti-rheumatic treatment in rheumatoid arthritis Rheumatology, November 1, 2001; 40(11): 1243 - 1255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bas, P. Muzzin, T. Fulpius, N. Buchs, and T. L. Vischer Indirect evidence of intra-articular immunoglobulin G synthesis in patients with Chlamydia trachomatis reactive arthritis Rheumatology, July 1, 2001; 40(7): 801 - 805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Souto-Carneiro, H. Burkhardt, E. C. Muller, R. Hermann, A. Otto, H.-G. Kraetsch, U. Sack, A. Konig, D. Heinegard, H. K. Muller-Hermelink, et al. Human Monoclonal Rheumatoid Synovial B Lymphocyte Hybridoma with a New Disease-Related Specificity for Cartilage Oligomeric Matrix Protein J. Immunol., March 15, 2001; 166(6): 4202 - 4208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Hjelmström Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines J. Leukoc. Biol., March 1, 2001; 69(3): 331 - 339. [Abstract] [Full Text]
|
|
|
|
|
|
A. Brauninger, W. Yang, H.-H. Wacker, K. Rajewsky, R. Kuppers, and M.-L. Hansmann B-cell development in progressively transformed germinal centers: similarities and differences compared with classical germinal centers and lymphocyte-predominant Hodgkin disease Blood, February 1, 2001; 97(3): 714 - 719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shi, K. Hayashida, M. Kaneko, J. Hashimoto, T. Tomita, P. E. Lipsky, H. Yoshikawa, and T. Ochi Lymphoid Chemokine B Cell-Attracting Chemokine-1 (CXCL13) Is Expressed in Germinal Center of Ectopic Lymphoid Follicles Within the Synovium of Chronic Arthritis Patients J. Immunol., January 1, 2001; 166(1): 650 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. K. de Hooge, F. A. J. van de Loo, O. J. Arntz, and W. B. van den Berg Involvement of IL-6, Apart from Its Role in Immunity, in Mediating a Chronic Response during Experimental Arthritis Am. J. Pathol., December 1, 2000; 157(6): 2081 - 2091. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Odendahl, A. Jacobi, A. Hansen, E. Feist, F. Hiepe, G. R. Burmester, P. E. Lipsky, A. Radbruch, and T. Dorner Disturbed Peripheral B Lymphocyte Homeostasis in Systemic Lupus Erythematosus J. Immunol., November 15, 2000; 165(10): 5970 - 5979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Colombo, M. Dono, P. Gazzola, S. Roncella, A. Valetto, N. Chiorazzi, G. L. Mancardi, and M. Ferrarini Accumulation of Clonally Related B Lymphocytes in the Cerebrospinal Fluid of Multiple Sclerosis Patients J. Immunol., March 1, 2000; 164(5): 2782 - 2789. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
