| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Cell Biology, Albert Einstein College of Medicine, Bronx, NY 10461
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). One enhancer, Eµ, is located within
the JH-Cµ intron 1, 2, 3 , and four enhancers are located
downstream of the IgH gene cluster within an extensive 3' regulatory
region 4, 5, 6, 7, 8, 9, 10 . We and others have recently shown that the proximal
three enhancers of the 3' regulatory region (hs3A, hs1,2, and hs3B) are
key elements of a 25-kb unit of quasi-dyad symmetry 11, 12 . The
enhancer, hs1,2, lies at the center of this region, and hs3A and hs3B,
which are virtually identical in sequence and oriented opposite to each
other, are located at the termini. Separating hs1,2 from each terminal
enhancer are members of at least three families of repetitive sequences
5, 7, 11, 12, 13 .
|
Transient transfection assays with various reporter plasmids have demonstrated transcriptional synergy in B cell lines between hs3A and hs3B 12 , as well as between different combinations of hs1,2, hs3B, and hs4 9 , and Eµ and 3' enhancers 23 . The latter experiments have implied differences in the transcription factor environment in various B cell lines that may predispose, to varying degrees, the independent and synergistic activities of Igh enhancers at different stages of development. In addition, it has been suggested that the 3' regulatory region is a potent influence on the dysregulation of the c-myc oncogene in plasmacytomas 24 . Indeed, a construct comprising hs1,2, hs3B, and hs4 exhibited properties of a locus control region (LCR) when juxtaposed to the myc gene and analyzed by stable transfection in plasmacytomas 9 .
Consistent with the inference that 3' enhancers regulate high levels of
IgH production in plasma cells, the loss of all four 3' enhancers as
part of a 34-kb natural deletion in a variant plasmacytoma cell line,
LP (low producer) 1.2, was correlated with a decrease in C
production, as compared with its parental precursor, W3129 10, 25 .
Interestingly, unlike deletion of the ß-globin LCR, which affected
replication timing of that locus 26, 27 , the deletion in LP1.2 did
not alter the early timing of replication of the Igh locus observed in
B cells 28 . These data indicated that the 3' regulatory region could
influence transcription, but not replication timing, of the Igh locus.
Meanwhile, an essential role for hs1,2 in heavy chain gene expression
was inferred from the observation of a total loss of Igh protein and
message after targeted replacement of this enhancer by a
phosphoglycerate kinase 1 promoter-driven neomycin resistance gene
(neor) in an IgG2a-producing cell line, 9921,
already lacking Eµ as a result of a spontaneous rearrangement 29 .
In another study, replacement of hs1,2 with the neor
in mice resulted in a severe impairment of class switching to
some, but not all isotypes 30 . However, in studies of the Ig
and
heavy chain intronic enhancers and enhancers of the ß-globin locus,
dramatic phenotypes that were initially observed upon deletional
replacement of transcriptional regulatory elements by
neor were considerably attenuated or eliminated
entirely in the absence of the neor gene
14, 15, 31, 32, 33, 34, 35 . Accordingly, the precise roles of 3' enhancers have
not yet been elucidated.6
In this paper, we briefly describe the polymorphic nature of the murine
3' regulatory region and use this knowledge to identify a naturally
occurring 
30-kb deletion encompassing hs3A and hs1,2 from the
expressed (C57BL/6) Igh allele in the F1-derived pre-B cell
line, 70Z/3 36 . Since, historically, fusion of pre-B cells with
myeloma cell lines has yielded hybrids phenotypically resembling the
latter 17 , we assessed the effect of this "knockout" in a more
differentiated B cell milieu by fusing 70Z/3 to the Ig-nonproducing
myeloma, NSO 37 . We find that in the hybridoma environment, the
deleted allele shows considerable up-regulation of µ expression to an
average level comparable with that of an intact 3' regulatory
region-containing locus. Furthermore, spontaneous class switching to
IgG1 was observed to take place in the fusion hybrids. These data show
that hs3A and hs1,2 are not essential for the up-regulation of µ
expression at the plasma cell stage, or for class switching in cultured
cells and suggest that the remaining 3' enhancers, hs3B and hs4, are
sufficient for these activities.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The 70Z/3 cell line was generated from a pre-B cell leukemia,
which was induced with methyl nitrosourea in a thymectomized
(C57BL/6 x DBA)F1 mouse 38 . 70Z/3 cells express µ
from the C57BL/6 allele 36 and have a rearranged gene that is
expressed upon stimulation with LPS, IFN-
, and other inducers of
differentiation 39, 40, 41, 42 . 70Z/3 cells were obtained from three sources:
as gifts, from Drs. Carl Schildkraut (Albert Einstein College of
Medicine, Bronx, NY) and Carol Sibley (University of Washington,
Seattle, WA), and purchased, from the American Type Culture
Collection (ATCC, Manassas, VA; TIB 158). Other cell lines included:
18-81 (BALB/c; pre-B; µ), NSO (BALB/c; plasmacytoma), A3.2D10
(BALB/c; hybridoma; µ,), and 12A1 (BALB/c; hybridoma; µ, ),
the latter two produced by fusion with NSO and received as gifts from
Dr. Arturo Casadevall (Albert Einstein College of Medicine)
43 . 70Z/3, 18-81, NSO, and A3.2D10 were grown in RPMI 1640
(BioWhittaker, Walkersville, MD), supplemented with 10%
heat-inactivated FCS (Life Technologies, Grand Island, NY), 50 µM
2-mercaptoethanol, 100 U/ml of penicillin and 100 µg/ml
streptomycin, and 2 mM L-glutamine. 12A1 was grown in DMEM
(Mediatech, Herndon, VA) with 10% FCS and 100 U of
penicillin-streptomycin. Freshly fused cells (see below for generation)
were maintained in RPMI with 20% FCS; 10% J774.1 macrophage cell line
supernatant; and the same concentrations of 2-mercaptoethanol,
penicillin, streptomycin, and L-glutamine as indicated
above, in an atmosphere of 10% CO2 at 37°C. Other cells
were cultured in 5% CO2.
Generation of drug-resistant cell lines
Cells (2–5 x 106) were transfected in a 0.4-cm cuvette in a Bio-Rad Gene Pulser (Bio-Rad Laboratories, Hercules, CA) with 10 µg of nonlinearized plasmid, pPuro (conferring resistance to puromycin for 70Z/3 and 18-81) or pSV2neo (producing resistance to neomycin/G418; for NSO), both gifts from Dr. Nancy Green (Albert Einstein College of Medicine), in 1 ml of PBS at 450 V, 960 µF and 200 ohms. The cells were resuspended in 10 ml of medium and plated at 100 µl per well in a 96-well plate. After 48 h, 6 µg/ml puromycin (Clontech Laboratories Inc., Palo Alto, CA) and 1.5 mg/ml G418 sulfate (Life Technologies) were added. Antibiotic selection was continued until stable transfectant lines were obtained from wells having single colonies.
Fusion of pre-B cell lines with NSO
70Z/3 and 18-81 puromycin-resistant pre-B cells (5 x 106) were each mixed with an equal number of neomycin-resistant NSO cells and electrofused 44 under the following conditions. Cells were washed twice in RPMI and pulsed at 220 V and 960 µF in a 0.2 cm Bio-Rad cuvette, incubated in an atmosphere of 10% CO2 at 37°C for 60 min, resuspended in 10 ml of medium supplemented with 20% FCS and 10% J774.1 supernatant, and distributed into 96-well plates. Antibiotic selection was started 48 h postfusion. The culture medium was replenished every 3–4 days. Approximately 3 wk later, the wells containing cells were examined for µ expression by ELISA of supernatants or cytoplasmic lysates. Positive clones were subsequently subcloned either in soft agar or by limiting dilution.
ELISA and ELISAspot assays
ELISA assays were performed as previously described 29 . Specifically, 1 µg/ml unlabeled goat anti-mouse IgM (catalog number OB1020-01, Southern Biotechnology Associates (Birmingham, AL)) was used to coat the microtiter plates, and 1 µg/ml of alkaline phosphatase-labeled goat anti-mouse IgM was used as the developing Ab (catalog number OB1020-04, Southern Biotechnology Associates). ELISAspot assays were performed as described 45 .
Western blot analysis
Whole-cell extracts were prepared by lysing 106 cells in 100 µl of lysis buffer (50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.1% Tween-20, 0.1% PMSF, 2.5 mg/ml leupeptin, and 0.1 mM Na3VO4). Lysis was completed by mixing and incubating the extracts at -70°C overnight. The supernatant containing the soluble proteins was collected by centrifuging the extracts at 12,000 x g for 15 min. Total protein in the supernatants was quantitated by the Bradford protein assay. Requisite amounts of total protein were subjected to SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA). Western blotting was done as follows: membranes were blocked for 1–2 h in 5% nonfat milk in PBS, washed, and then incubated with 1 µg/ml horseradish peroxidase-conjugated anti-mouse IgM (catalog number OB1021-05, Southern Biotechnology Associates). Enzyme activity was assayed by enhanced chemiluminescence (Amersham Life Science, Arlington Heights, IL).
Immunofluorescence
Cells (5–10 x 105) in 1 ml of medium were
centrifuged at 500 rpm for 5 min onto glass slides in a cytocentrifuge
(Shandon, Pittsburgh, PA). Cells were briefly air dried and fixed in a
mixture of 95% ethanol and 5% acetic acid for 10 min at 4°C, rinsed
in water, and washed for 5 min in PBS. To detect µ protein, the
slides were incubated with 20 µl of a 1:50 dilution of
FITC-conjugated anti-mouse IgM Ab (catalog number OB1021-02, SBA) at
room temperature for 30 min, washed twice with PBS for 15 min, and
mounted with a coverslip on a drop of Fluoromount G (catalog number OB
100-01, SBA). For µ and costaining, Texas red-conjugated
-mouse was used (catalog number OB 1055-07, SBA) at the same
concentration. The cells were viewed and photographed on a fluorescence
light microscope (Zeiss Axiophot).
Isolation and analysis of cellular RNA
Total RNA was prepared from cell lines using the Trizol reagent (Life Technologies).
RT-PCR and subcloning of products
Total RNA (5 µg) was reverse transcribed with 500 ng of oligo(dT), 10 nmol of deoxynucleotide triphosphates, and 200 U of Superscript (Life Technologies) in a total volume of 20 µl at 42°C for 50–60 min. Three microliters of the RT product was then subjected to 30 cycles of PCR amplification at 94°C for 1 min, 37°C for 1 min, and 72°C for 1 min, using Taq or Pfu polymerase and the primers J558v and µCH2a or J558L and µCH1a. PCR products were ligated either with PCR II (for Taq) or PCR-Blunt (for Pfu) (Invitrogen, Carlsbad, CA) according to the manufacturers’ protocol, and individual colonies were selected and subjected to sequence analysis.
Oligonucleotides used were the following: J558L, atgggatggagctggatctttctc (J558 leader sequence; 46 ; J558v, gctgagcttgtgaagcctg (J558 family variable region primer; R. Riblet, personal communication); µCH1a, tctcgcaggagacgtggggga (µ exon 1 antisense sequence; 47 ; and µCH2a, atctcgagtcagaggttcagctgcag (µ exon 2 antisense sequence; 47 .
Northern hybridization
This was performed according to methods described in Reference 48. Briefly, 25 µg of total RNA was loaded on a 1.2% formaldehyde-agarose gel and electrophoresed at 3 V/cm for 12 h. The RNA was transferred onto nylon membranes (Hybond-N+; Amersham Life Science) and probed with 1–2 x 10-6 cpm/ml 32P-labeled denatured DNA probe in 6x SSC, 2x Denhardt’s reagent, 0.1% SDS, and 100 µg/ml salmon sperm DNA. For rehybridization, the membranes were stripped 2–3 times with boiling 0.1x SSC and 0.5% SDS. The probe used for detecting µ RNA was a PCR product containing the first exon of the µ constant region. The probe used for detecting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was an 800-bp fragment of the rat cDNA.
Isolation and analysis of genomic DNA
DNA was isolated from tissues and cell lines using the
recommended protocol of the Puregene kit (Gentra Systems, Minneapolis,
MN). DNA was digested with the appropriate restriction enzyme and
subjected to genomic Southern analysis, as previously described 12 .
The M67-5' probe 13 , a 10-kb EcoRI fragment spanning
the switch and coding sequences from the BALB/c strain, and an
internal 1.2-kb BglII subfragment, M67-1.2 Bgl, were used in
genomic Southern analysis to identify the 5' end of the deletion in
70Z/3. 3'-1.3 7, 12, 49 , a 1.3-kb
BamHI/BglII fragment from the 3' regulatory
region of I-strain mice (a gift from Janet Stavnezer, University of
Massachusetts Medical School, Worcester, MA), was used to detect
the approximate 3' end of the 70Z/3 deletion.
Genomic PCR
The Expand long-template PCR system (Boehringer Mannheim,
Indianapolis, IN) was used to perform PCR on 0.5 µg of untreated or
EcoRI-digested genomic DNA from appropriate mouse cell lines
or tissues using the C-H3 and oligo L primers (see sequences below).
The PCR cycle used was 2 min at 92°C followed by 30 cycles of 10
s at 92°C, 30 s at 65°C, and 5–8 min at 68°C and a final
elongation step at 68°C for 10 min. Primers used for genomic PCR were
the following: C-H3, ctaagctaggctgcctgagctaagctt (sequence
upstream of S from BALB/c strain; GenBank accession numbers, U08933
and D11468), and oligo L, ccacactcgtgccttagtgaggccatgttctgtcccaa
(derived from hs3B and, together with its complement, also used for
electromobility shift assay (EMSA); GenBank accession numbers, S74164
and X99607).
DNA sequence analysis
Sequences of the RT-PCR and genomic PCR products subcloned into PCR II or PCR-Blunt were determined using T7 or SP6 primers by automated sequencing on a 373A ABI DNA sequencer (Applied Biosystems, Foster City, CA). Sequences were analyzed using the GCG software program.
EMSA
Nuclear extracts were prepared from cell lines as described
50 , and EMSAs were done as before 21 . Specifically, 10
µg of nuclear extract (corresponding to 5–10 x
105 cells) was used per reaction. The oligonucleotides used
as probes and competitors were as follows: B cell-specific activator
protein (BSAP), 5'-aggattgtgaagcgtgacca-3' and its complement (sequence
of core B element; 21 ; B(H2),
gagaggggattccccgattagctttcggggaatcccctct (self-complementary
oligonucleotide of canonical B site; B(hs4), ggcgtggaaagccccattca
and its complement 51 ; and octamer, 5'-(atttgcat)3-3' and
its complement (trimerized octamer element; 21 . The probes used
were hs4-190, a 190-bp subfragment of hs4 containing a binding site for
BSAP and an octamer element, and hs4-110, another fragment of hs4
adjacent to hs4-190 and containing a B and another octamer element
51 . BSAP, octamer, and B binding sites have been shown to
contribute significantly to hs4 enhancer activity in transient
transfection assays 51 . For Ab competitions, either 1–2 µl of Ab
was incubated with the reaction mixture for 30 min at room temperature
before addition of DNA probe or Ab was added after probe and the
mixture incubated for 45 min at room temperature. The BSAP, Oct-1, and
Oct-2 Abs (catalog numbers sc-1974X, sc-232X and
sc-233X, respectively) were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). The p50, p65, p52, relB, and c-rel Abs
were a generous gift of S. Lee and J. Liu (Albert Einstein College of
Medicine).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
E(hs1,2) are highly polymorphic
The 3' regulatory region contains four enhancers, three of which
are located in a 25-kb segment, marked by quasi-dyad symmetry 11, 12 . While the dyad structure and the resident enhancers of this region
are conserved in wild and laboratory mice strains (Fig. 1
and
data not shown), the 3' regulatory region exhibits considerable
polymorphism. Originally reported for the 3'1.3 probe (then called
p3') on Southern blots of TaqI-digested DNA 49 , we have further
analyzed the polymorphism of this region with other enzymes and probes
(Refs. 7 and 13 and the present study). The probe 3'-1.3 or a
subfragment of it, 3'-0.54, hybridizes to five distinct
BamHI fragments located exclusively in the 3' regulatory
region 7, 12 , and another probe 3'-0.3 also hybridizes to multiple
fragments. These results identified the presence of families of
repeated sequences on either side of hs1,2 12 , a finding confirmed by
extensive sequence analysis of the region 11 . Fig. 1 shows the maps
of the 3' regulatory region of BALB/c, DBA, and C57BL/6, which are
pertinent to the subsequent experiments described in this paper.
Restriction patterns and genomic Southern analysis show that the length
polymorphism is mainly due to expansions or contractions of the repeat
elements that separate hs1,2 from hs3A (Ref. 12 and M. Singh,
unpublished observation).
Deletion of hs3A and hs1,2 in 70Z/3
The extensive polymorphism of the 3' regulatory region enabled us
fortuitously to detect a naturally occurring 30-kb deletion
encompassing 3' regulatory sequences in the µ-producing pre-B cell
line 70Z/3. The 70Z/3 cell line is derived from an F1
mouse: the expressed µ chain is from the C57BL/6 allele, while the
unexpressed DBA allele has undergone only D-J joining 36 and is
incapable of synthesizing a heavy chain without further rearrangements.
Genomic Southern analysis of 70Z/3 DNA with a number of probes for the
3' regulatory region, including 3'1.3, which hybridizes to two
EcoRI fragments of 8–16 kb and 23 kb, respectively, in
several mouse strains (Refs. 7 and 12, Fig. 1, and data not shown),
revealed that of the three sizes of expected EcoRI
fragments, i.e., 11.0 kb (C57BL/6), 16 kb (DBA), and 23 kb (both
C57BL/6 and DBA), only 16- and 23-kb bands were present. These findings
indicated that the expressed C57BL/6 allele of 70Z/3 had sustained a
deletion of the entire 11-kb EcoRI fragment in which hs3A
and a portion of hs1,2 were located. Additionally, the failure to
detect any "new" band suggested that either the entire
3'-1.3-hybridizing region was deleted or that new bands resulting
from the deletion comigrated with the 16- or 23-kb bands.
The 5' breakpoint of the deletion was further localized by genomic
Southern analysis of EcoRI and BamHI digests,
probed with M67-5' 13 , (shown in Fig. 2, B and C).
C57BL/6-specific 10-kb EcoRI and 16-kb BamHI
fragments detected by M67-5' were absent from 70Z/3 and replaced by a
new EcoRI band of 23 kb and a new BamHI
fragment of 6.3 kb (Fig. 2B). As confirmed by the following
data (Fig. 2C), this "new" C57BL/6-derived
EcoRI band also hybridized to 3'-1.3 and comigrated with
the 23-kb EcoRI fragment from the DBA locus. The latter
appeared to be intact in this region, since DBA-specific fragments were
unaffected. Based on the predicted location of a C57BL/6-associated
BamHI site 700 bp upstream of the 5' EcoRI
site of M67-5' (from homology to the known sequence of BALB/c and
restriction maps of the 3' regulatory region; see Fig. 2C),
and consistent with the observation that 70Z/3 retained two of the
three M67-5' hybridizing C57BL/6 wild-type HindIII fragments
(Fig. 2C and data not shown), the 5' end of the deletion was
localized to the vicinity of S sequences.
|
5-kb BamHI
fragments that contain hs3B and hs4, respectively, from C57BL/6 are
both present in 70Z/3 (Fig. 1 and data not shown) in addition to the
single 11-kb fragment containing hs3B and hs4 from DBA (data not
shown). These data suggested that the deletion in 70Z/3 encompassed
both hs3A and hs1,2 from the C57BL/6 allele, leaving hs3B and hs4
intact. Together with other data using 3'-1.3 as a probe (data not
shown) that showed that the deletion extended into sequences between
hs1,2 and hs3, the 3' end of the deletion was predicted to lie no less
than 4 kb upstream of hs3B. The presence of Eµ on both alleles in
70Z/3 was inferred from previous data showing the retention of two
distinct 14.1-kb and 12.3-kb Cµ hybridizing EcoRI
fragments, derived from the C57BL/6 and DBA germlines, respectively
36 . We confirmed the intact status of Eµ on both alleles by genomic
Southern analysis using Eµ as a probe. The 11-kb and 9-kb
BamHI fragments spanning Eµ in the C57BL/6 and DBA
strains, respectively, were preserved in 70Z/3 (data not shown).
Having determined the approximate location and size of the deletion, we
were able to define its extent precisely by PCR, using a 5' primer,
C-H3, from within the M67-5' region (based on the BALB/c sequence of
the region), and a 3' primer, oligo L, from hs3 (based on 129SV
sequence) (see Materials and Methods). This procedure
specifically amplified a 4-kb DNA fragment from 70Z/3, but not from
C57BL/6, DBA, or 18-81 (BALB/c) DNA (data not shown). Genomic Southern
and PCR analysis identified the same deletion in three samples of 70Z/3
that we obtained from independent sources, including ATCC, suggesting
its occurrence early in the generation and propagation of this cell
line.
The sequence of the 5' end of this PCR product, spanning the deletion
junction (GenBank accession number AF068482) is shown in Fig. 2C. The length of the PCR product and the sequence of the
breakpoint shows that the deletion in 70Z/3 commences 200 bp upstream
of S and terminates 4 kb upstream of hs3B, covering almost 30 kb
and including S, C, hs3A and hs1,2. There is no extended sequence
homology between the 5' and 3' ends of the deletion to suggest
conventional homologous recombination. However, 6 of the 7 bp from the
5' breakpoint match those of the 3' end in reverse orientation
(sequences in bold in part c of Fig. 2C). Additionally,
there are three CTGG motifs in the vicinity of the junction (shown in
boxes in Fig. 2C). This tetrameric motif is characteristic
of nonhomologous recombination events at Ig loci, as well as
breakpoints identified in VH gene replacements and class
switching 52 . The position of the deletion breakpoints leads us to
speculate that the 70Z/3 deletion may represent the aberrant resolution
of a looplike intermediate involving C and the 3' enhancers,
potentially utilizing class switch machinery.
The 70Z/3 allele shows up-regulation of µ expression in a fusion hybrid with NSO
The identification of a spontaneous deletion of two of the four 3'
enhancers provided an opportunity to assess the roles of these
enhancers in various processes of heavy chain production. We
anticipated that at the pre-B cell stage, the absence of hs3A and hs1,2
from the expressed allele would have no significant deleterious effect
on heavy chain expression, reflecting the limited activity identified
for these enhancers at this early stage of B cell differentiation 7, 9, 12, 21, 22 . Consistent with this prediction, protein and RNA assays
showed that the level of µ protein in 70Z/3 was equivalent to that of
18-81, which has an intact 3' regulatory region on the expressed allele
(Figs. 3 and
4). Ideally, a better comparison would
have been one between 70Z/3 and a precursor of this cell line, from the
same stage but having an intact regulatory region. However, in the
absence of such a cell line, we used an independently derived pre-B
cell line, 18-81, as our control.
|
) and 12A1. Cytoplasmic µ protein
expression in hybrid 11 and several of its subclones appeared to be
independent of light chain expression. While hybrid 11 and hybrid 11-6
expressed light chain and secreted IgM, other subclones (e.g.,
hybrids 11-3 and 11-2c) did neither (data not shown). Nonetheless, both
groups made copious and comparable amounts of cytoplasmic µ. These
results suggested that hs3A and hs1,2 were unnecessary for
up-regulation of µ expression in plasma cells.
µ expression in the 70Z/3-NSO fusion hybrid 11 and its subclones was
also assessed by Western analysis of whole-cell extracts. This assay
detected a lower level of µ protein in the 70Z/3-NSO hybrids 11 and
11-3, as compared with µ-producing hybridomas A3.2D10 (Fig. 3, B and C) and 12A1, which was not detected by the
ELISA assay. This difference was reproducible and perhaps reflected the
difference in the sensitivity between the enzymatic reactions used in
the two assays, since both secondary Abs were derived from the same
antisera (see Materials and Methods). We also noted a slight
difference in the mobility of the µ band in 70Z/3 vs the hybrids.
While this observation could reflect differences in protein amount
loaded onto the gel, it is more likely explained by differences in
glycosylation between cytoplasmic and secreted proteins 40 . In any
event, it seems unlikely that these minor alterations of the protein
could affect its recognition by an excess of polyclonal antisera.
Consistent with the Western data, immunofluorescence assays also
detected variation in µ protein expression in hybrids 11 and 11-3,
relative to the uniformly high level staining in the hybridomas (Fig. 3C and data not shown). Only a subset of the hybrid cells
stained as intensely as the hybridomas, while others exhibited variable
brightness, including a few that were negative for µ expression. By
additional rounds of subcloning, we obtained both negative subclones of
11 and 11-3 and those (e.g., 11-2C, 11-3-2C and 11-3-2E respectively)
that showed a more uniform pattern of elevated µ expression and,
therefore, an overall higher level of µ protein (Fig. 3, B
and C). This indicated that the uniformity of µ expression
was derived from a stabilization of the cell population with respect to
its genetic makeup and consequent protein expression. Accordingly, in
hybrid 11, the level of expression in individual cells usually
correlated with that of µ, except, of course, where either the heavy
or light chains were not detected, presumably because of loss of the
expressed allele (data not shown). This correspondence likely reflects
the milieu of transcription factors in individual cell that drive µ
and expression, e.g., BSAP and the B and octamer binding
proteins (see below). This analysis could not be extended to hybrids
11-2C, 11-3-2C, and 11-3-2E, since all of them lacked . These
results also eliminated the possibility that variation in µ
expression reflected an essential characteristic of the deleted allele,
as reported for some other LCRs, in which partial truncations result in
position-dependent variegation in expression of associated genes 53, 54 .
The increase in the µ protein levels in the 70Z/3-NSO fusion
hybrids was due to and paralleled by a concomitant increase in µ
message levels, as observed in Northern hybridization (Fig. 4) and
RT-PCR assays (Fig. 5A). Thus,
the up-regulation of µ expression seems to be a direct consequence of
elevated µ mRNA levels and not simply due to increased translation of
message. The increase in IgH mRNA levels in plasma cells and hybridomas
relative to pre-B cells, including 70Z/3, has been shown to be
primarily due to posttranscriptional processes such as message
stabilization 55, 56 , suggesting a similar mechanism for the increase
in µ mRNA levels in the 70Z/3-NSO fusion hybrids. While the half-life
of µ message in plasma cells, fusion hybrids of myeloma cells and
pre-B cells, and spleen cell-derived hybridomas was found to be
generally equivalent and much higher than that of pre-B cells, the
transcriptional rates of the IgH gene in pre-B cells, plasma cells, and
hybrids, as measured by nuclear run-on assays, were quite similar 56 .
Thus, the similarity between the µ mRNA levels in the 70Z/3-NSO
hybrids and hybridomas is consistent with little or no effect of the 3'
enhancer deletion on the rate of transcription of the µ gene in this
cellular milieu. This observation is in contrast to that seen for LP1.2
and 9921
hs1,2neo, in which enhancer deletion or inactivation
affected message levels at the level of transcription 25, 29 .
|
|
To confirm that the µ protein in the 70Z/3-NSO hybrid was
expressed from the C57BL/6 allele of 70Z/3, we compared the expressed
VH sequence of hybrids 11 and 11-3 with that of 70Z/3. To
determine the expressed VH gene sequence of 70Z/3, which
had not been reported previously, RT-PCR was conducted on total
cellular RNA. The 5' primer used for the PCR reaction (J558v) was from
a conserved part of the C57BL/6-derived, J558 family of VH
regions, as it was known that the expressed 70Z/3 VH gene
is a member of this family (Ref. 36 and R.Riblet, personal
communication), and the 3' primer was from the second exon of the µ
constant region (µCH2a; 47 . A 700-bp cDNA
fragment was amplified from 70Z/3 and from the hybrids 11 and 11-3, but
not from 18-81, A3-2D10, or NSO (Fig. 5A and data not
shown). The sequence of the full-length 70Z/3 VH region was
obtained via a second PCR, using a leader-derived 5' primer (J558L;
46 and a 3' primer from the CH1 exon of µ (µCH1a; 47 .
The sequence of the 70Z/3 VH region (GenBank accession
number AF068481) is identical to the germline C1H4 segment (EMBL
accession number DS6748; 57 and possesses 94.7% identity with
VH186.2 (GenBank accession number MMU32235; 58 (Fig. 5B), the canonical J558 family member utilized in most
C57BL/6 anti-(4-hydroxy-3-nitrophenyl)acetyl (NP) hybridomas. In
70Z/3, the C1H4 VH gene is recombined with JH1
(Ref. 36 and the present study), instead of JH2, which is
more commonly found in anti-NP hybridomas 59 . Germline C1H4 has
not been detected in anti-NP hybridomas. However, ELISA assays on
cytoplasmic extracts showed weak NP binding in 70Z/3, despite the lack
of a light chain, as well as in 70Z/3-NSO, which expresses a chain
(S. Saleque, unpublished observation; 
expression is consistently
observed in -NP hybridomas). We propose that Ag-specific binding in
70Z/3 could be further increased by introduction of an -NP
chain.
The VH sequences of the µ cDNA obtained from several independent subclones of the RT-PCR reaction of the hybrids 11 and 11-3 were essentially identical to 70Z/3. Hence, VH gene expression in hybrid 11 and its µ-expressing subclones originates from the C57BL/6 allele of 70Z/3.
We considered the possibility that µ expression resulted from a
recombination of the C57BL/6-expressed VH sequences with an
intact 3' regulatory region from NSO (BALB/c) or DBA. Such an
event would dissociate the expressed heavy chain of 70Z/3 from the
deleted C57BL/6 3' region. However, genomic Southern analysis using
either M67-5' (data not shown) or M67-1.2 Bgl as a probe (Fig. 2C) and PCR assays both showed that the characteristic
deleted C57BL/6 allele of 70Z/3 was consistently linked to µ
expression. Of 11 independent 70Z/3-NSO clones and 10 subclones of
hybrid 11 examined by Southern or PCR assays, only the µ-expressing
hybrid 11 and its 7 positive subclones possessed the 70Z/3-derived
C57BL/6 Igh allele (Fig. 6 and data not
shown), while none of the µ-negative clones 10 and subclones 3
retained the 3' deleted allele. Additionally, each of five clones and
one subclone examined by Southern analysis also showed loss of the DBA
allele of 70Z/3. Thus, there is complete correspondence between
retention of the deleted C57BL/6 allele and µ expression in all
clones and subclones, implying the presence of the deletion in
cis with the expressed µ allele.
|
The premise of the fusion experiments between the pre-B cell
line 70Z/3 and the myeloma NSO was that some resultant hybrids would
have a plasma cell-like transcription factor milieu compatible with
optimal 3' enhancer activation. To test this premise, we conducted EMSA
for some of the transcription factors known to bind and modulate the
activity of the 3' enhancers, namely BSAP (Fig. 7A), B proteins, and
octamer-binding proteins (Fig. 7, A and B). The
probes were derived from hs4 and had been previously used to assess
transcription factor requirements for hs4 enhancer activity 51 . Our
EMSA data (Fig. 7, A, lanes 1–5, and
B, lanes 1 and 2) show that 70Z/3 and
18.81 pre-B cell lines are essentially indistinguishable in their
transcription factor milieu and, by this criterion, appear to represent
the same or very similar stages of B cell differentiation. The gelshift
patterns of the 70Z/3-NSO hybrids (Fig. 7, A, lanes
6–10, and B, lane 3) were significantly
different from these pre-B cells and consistent with a plasma cell
phenotype, as seen in A3.2D10 (Fig. 7A, lane 9)
and NSO (Fig. 7A, lane 10). Specifically,
BSAP, which functions as a negative regulator of hs4 (and hs1,2) in
pre-B cells 51, 60 , was abundant in both 18-81 (Fig. 7A,
lanes 1–4) and 70Z/3 (Fig. 7A, lane
5) but was essentially absent from the hybrids, NSO and A3.2D10
(Fig. 7A, lanes 6–10).
|
B binding complexes (Fig. 7B,
lane 3, and data not shown). Notably, two new complexes, one
containing relA/p65 (Fig. 7B, lane 8) and the
second, relB (Fig. 7B, lane 9) (the latter being
characteristic of late stage B cells and plasma cells; 41 , were
seen in NSO, A3.2D10, and the 70Z/3-NSO hybrids (Fig. 7B,
lanes 3–12) but not in 70Z/3 and 18-81 (Fig. 7B,
lanes 1 and 2). There was also significant
enhancement of a third complex (Fig. 7B, lanes
3–12), which appeared to comprise several proteins, including p65
(and Oct-2), but was not affected by the addition of anti-p50,
anti-p52, or anti-c-rel Abs. This is consistent with previous
EMSA data using the same hs4 probe that showed only a slight reduction
in the B binding activity in nuclear extracts of B cells from
p50-negative mice 51 . The hybrids also exhibited high Oct-1 protein
levels in most cases (Fig. 7A) and elevated Oct-2 expression
(Fig. 7B, lane 10,), as did the hybridoma A3.2D10
and NSO. This transcription factor profile, observed in both
µ-producing and nonproducing hybrids (Fig. 7A, lane
8 and data not shown), is consistent with activation of hs4.
Binding sites for these same families of proteins are also present in
hs3B (Ref. 9 and S. Saleque, unpublished observations), which would
presumably be similarly activated.
The EMSA patterns of the hybrids, however, were not identical to each
other (Fig. 7; lanes 6–8, and data not shown), and these
differences in their nuclear milieu, although slight, could affect
their IgH levels. Similar differences between individual cells in a µ
allele-containing population of 70Z/3-NSO hybrid cells could account
for differential µ (and ) expression seen in the
immunofluorescence experiments, as well as a generally lower level of
µ protein in the earlier hybrids relative to both the later,
stabilized ones and to stable hybridomas, as observed in Western blots.
The 70Z/3-NSO hybridoma exhibits class switching in vitro
ELISAspot assays (Table I) with
hybrid 11 revealed the presence of IgG-producing cells among the
IgM-producing population, ascribable to spontaneous DNA recombination
resulting in the production of one of the isotypes. The number of
IgG producers detected was 3.35–3.65 per 106 cells. This
number is within the range of 10-5 to 10-6,
commonly observed for most hybridomas 45 , and higher than the two
spleen cell hybridomas compared simultaneously. Using specific
anti-isotype antisera to develop the ELISAspots, we observed that
the control cell line produced only 1, and the same was true of
hybrid 11. Although the specific relationship between a change in
isotype expression in cultured cells and physiologic class switching in
vivo is unclear, it is interesting that switching to IgG1 was also
unaffected in mice in which targeted deletion of hs1,2 with
neor severely reduced switching to other
isotypes 30 . IgG-positive spots obtained from hybrid 11 were
consistently smaller and fainter than their 12A1 counterparts. This may
either reflect differences in detection of C57BL/6 isotypes as compared
with BALB/c (expressed in 12A1), or lower levels of IgG expression from
the switched 70Z/3-NSO hybrid, as influenced by cis or, more
likely, trans effects. Other groups have observed
differences in spot sizes between different subclones having the same
transfected constructs (M. Scharff, personal communication). Neither
70Z/3 itself nor other hybrid subclones that produce uniformly high
levels of µ protein could be appropriately assayed for production of
isotypes by this method because of the absence of protein,
resulting in their inability to secrete Ig, a prerequisite for this
assay.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
200 bp
upstream of S and terminates 4 kb upstream of hs3B (Fig. 2C). This deletion includes 3' Igh enhancers, hs3A and
hs1,2. The presence of the same 30-kb deletion in three different
samples of 70Z/3, including that from ATCC, leads us to predict its
general prevalence in this cell line. Hence, we suggest that in
addition to our observations, all data regarding the 70Z/3 pre-B cell
line be considered in light of this probability.
The location of the 5' end of the deletion in close proximity to S
has led us to speculate that the deletion was executed by class switch
machinery. Interestingly, 70Z/3 has been shown to support class
switching of extrachromosomal substrates as efficiently as other pre-B
cell lines 61 , and subclones/variants of the 18-81 pre-B cell line
have been shown to undergo class switching of the endogenous locus to
62, 63, 64 . Hence, there is a precedent for the operation of class
switch machinery in pre-B cells. However, because hs3A and hs1,2 have
generally been considered to be both inactive and inaccessible in pre-B
cells, their deletion from 70Z/3 (which implies their accessibility to
recombinational machinery) raises a question as to whether 70Z/3
represents an authentic pre-B cell line. The presence of a rearranged
although silent light chain in 70Z/3 could reflect a slightly advanced
pre-B cell (relative to 18-81) or a mature B cell that had transiently
reverted to the pre-B phenotype, as seen in a subset of germinal center
B cells 65 . On the other hand, the absence of somatic mutation in the
70Z/3 V region, inferred by its utilization of the germline
VH segment, C1H4, is consistent with the possibility that
the 70Z/3 cell line had not encountered Ag at the time of
transformation, which is a hallmark of a bonafide pre-B cell line.
Together, these observations raise the interesting possibility that
hs3A and hs1,2 enhancers might function in certain pre-B cell subsets.
The lesion in the Igh 3' regulatory region of the C57BL/6 allele of 70Z/3 not only eliminated the enhancers, hs3A and hs1,2, but also truncated a large segment of the dyad structure in which these enhancers were located together with hs3B 11, 12 . We have previously speculated that the dyad symmetry of the region in which hs3A, hs1,2, and hs3B are located is correlated with functional activity, because at early stages of B cell differentiation, all three enhancers are DNase I insensitive, hypermethylated, and relatively inactive in transient transfection assays, while in plasma cells, the three enhancers, collectively, become DNase I hypersensitive, undermethylated, and active in transient transfection assays. We therefore addressed the possibility that in 70Z/3, accessibility of hs3B, and perhaps hs4 as well, had been affected as a consequence of the disruption of the dyad structure. Our results showed that DNase I hypersensitivity profiles of hs3B and hs4 in 70Z/3 were apparently unchanged as compared with the 18-81 pre-B cell line with an intact 3' regulatory region. While we could not fully distinguish the DBA and C57BL/6 alleles of 70Z/3, we found that like other pre-B cells, only hs4, and not hs3B, was DNase I hypersensitive in 70Z/3 (data not shown).
Hence, the 70Z/3 cell line could be used to assess the roles of hs3A and hs1,2 in µ expression at the pre-B cell stage, as well as in subsequent stages of B cell stimulation. Basal µ protein and RNA expression in 70Z/3, as measured by ELISA and Western analysis, and Northern analysis, respectively, was equivalent to that of 18-81 (with an intact 3' regulatory region). These observations are consistent with the hypothesis that in pre-B cells, µ expression is primarily regulated by the intronic enhancer, Eµ, and by hs4, which is the only 3' enhancer active at this stage; other 3' enhancers, i.e., hs3A and hs1,2 (and hs3B), are dispensable.
To study the effects of the deletion of hs3A and hs1,2 in a plasma cell
milieu in which 3' enhancers are predicted to be active, we fused 70Z/3
with NSO. One 70Z/3-NSO hybrid clone and several of its subclones
showed a substantial elevation of µ expression to a level comparable
with that of several µ-producing hybridomas. The sequence of the µ
transcripts in the 70Z/3-NSO hybrids confirmed that they originated
from the C57BL/6 allele of 70Z/3, and µ expression always correlated
with the presence of the deleted 3' regulatory region. Although µ
protein and RNA levels in the hybrids were independent of the light
chain, IgM secretion correlated with activation of expression.
Subsequent 70Z/3-NSO fusion experiments did not yield additional µ
expressors. It is unlikely that deletion of 3' regulatory enhancers in
70Z/3 accounted for this difficulty, because fusion of 18-81 with NSO
similarly produced only two µ-positive hybrids (from different
experiments), and both ceased µ expression after a few weeks in
culture. Furthermore, subclones of hybrid 11 lost expression at a
high rate, presumably because of loss of the expressed allele, and in
all cases examined, the DBA allele was lost. Although the reason for
the frequent loss of pre-B-derived alleles is not clear, it may be
related to the dominance of the myeloma phenotype in the pre-B-NSO
hybrids. This phenomenon could conceivably result from or extend to the
genes of the respective cell types. Because of this ongoing chromosome
loss, it was only by repeated subcloning that we were able to obtain
stable 70Z/3-NSO hybrids expressing uniformly high levels of µ.
A switch in production from IgM to IgG1 occurred in the 70Z/3-NSO hybrids at levels comparable with those seen for other hybridomas, suggesting that hs3A and hs1,2 were not essential for this process. Because the ELISAspot assay to analyze switching depends upon Ig secretion, we could not use it on 70Z/3 itself. From all these experiments, we conclude that an allele lacking hs3A and hs1,2 can show stimulation of µ expression upon fusion with myeloma cells, as well as undergo class switching to IgG1 in a plasma cell milieu. To what extent the deletion of hs3A and hs1,2 may influence Ig expression after the class switch cannot be assessed at this time, because class switch variants of 70Z/3-NSO have not been isolated.
Our observations on 70Z/3 are generally consistent with previous
studies reported for this cell line. While some groups reported no
change in µ message levels in 70Z/3 upon LPS stimulation 66 , others
detected a modest 2–3-fold increase in cytoplasmic µ protein after
18–24 h of LPS induction 40 , generally in accord with the 4–8-fold
increase we have detected (data not shown). In addition to expressing
µ, the 70Z/3 cell line has been shown to contain a rearranged, but
quiescent, chain 39 . LPS treatment activates expression of ,
leading to the appearance of surface but not secreted IgM 38, 39 .
Furthermore, consistent with our observation of secreted IgM,
previously reported hybrids of 70Z/3 and P3, an NSO-related cell line,
also produced a secreted (pentameric) form of IgM, and no surface
expression 67 . The transition from cytoplasmic expression to
surface IgM to secreted IgM was understood to reflect the progressive
maturity of the cell type, from pre-B (in unstimulated 70Z/3) to
immature B (in LPS-stimulated cells) to plasma cell-like (in the
hybrids). However, the level of enhancement of µ mRNA or protein in
the hybrids was not specifically documented. With respect to class
switch expression, a previous report has described the acquisition of
surface 2b expression in addition to surface µ in 70Z/3 cells
cultured with the T cell hybridoma HAJ-3. However, it was unclear
whether this represented endogenous class switching, because µ
expression was retained, no CH gene rearrangement was
discernible, and the 2b transcripts did not possess a VH
region 68 .
Our studies of 70Z/3-NSO hybrids contribute to a general understanding
of the relative contribution of Eµ and 3' enhancers to IgH activity.
As summarized in Fig. 8, the results from
the 70Z/3-NSO fusion hybrid indicate that high level Igh expression can
occur in a plasma cell despite the absence of hs3A and hs1,2. However,
a deletion of all four 3' enhancers was correlated with a loss of
90% of heavy chain expression in the plasmacytoma LP1.2 10, 25 .
Together, these results demonstrate that Eµ, hs3B, and hs4 are
sufficient to drive full-scale IgH expression in plasma cells (although
this specific combination may or may not be necessary), while Eµ
alone can produce only a fraction (10%) of this expression. We did
not attempt to determine the DNase I hypersensitivity of either hs3B or
hs4 (as an indication of their activity) in the hybrids, as we would
not have been able to distinguish the C57BL/6 allele from the BALB/C
alleles of NSO, particularly since genomic Southern analysis (Fig. 6)
had indicated that the latter were amplified. Based on cell lines, such
as 9921, in which high levels of 2a expression are apparently
unaffected despite the absence of Eµ, Eµ appears to be dispensable
in the presence of an intact 3' regulatory region. It should be noted
that all these conclusions are based on the premise that Igh-associated
enhancers operate exclusively in cis, and that the expressed
chromosome is not regulated through interaction with enhancers or other
sequences present on other chromosomes.
|
2a expression upon deletional replacement of hs1,2
with neor in the 9921 cell line
(9921hs1,2neo) may reflect the effect of the combined deletion of
both Eµ and hs1,2 18 . However, mice in which hs1,2 alone has been
inactivated by substitution with neor showed
defects in class switching, but no alteration in Igh expression in
class-switched cells was evident 30 . Alternatively, the severity of
the phenotype of 9921hs1,2neo, in comparison with those of the
70Z/3-NSO hybrids and LP1.2, is suggestive of a 3' regulatory region
rendered virtually inactive by the interference exerted by the inserted
neor gene on its neighboring
cis-regulatory elements. As inferred from 70Z/3-NSO hybrids,
these are likely to be hs3B and hs4. (It is not known whether the
position of the neo gene in 9921hs1,2neo would
deleteriously affect hs3A activity.) In any event, the total shutoff of
transcription of the heavy chain gene locus in 9921hs1,2neo might
result from functional inactivation of any or all four Igh enhancers,
coupled with the absence of Eµ. Such an observation is consistent
with the possibility that Eµ and 3' enhancers are functionally
redundant with respect to each other at this stage. In fact,
transfection experiments with nonchromosomal reporter plasmid
substrates in plasma cell lines have shown that 3' enhancers become
active to a level comparable with that of Eµ but exhibit no
additional synergism when they are assessed together 23 .
The comparisons between LP1.2 (IgA), 9921hs1,2neo (IgG2a), and
70Z/3-NSO hybrids (IgM) necessarily presume no isotype or
strain-specific differences in the modes of 3' enhancer-dependent
transcriptional regulation of their respective heavy chains.
Transcription from either VH- or I-region promoters could
differentially require and engage either Eµ or the 3' enhancers in an
isotype-specific manner. Such a phenomenon would not only explain some
of the above results but have a profound although selective effect on
class switching. For example, replacement of hs1,2 with
neor in mice produces such a phenotype, in which
switching to several isotypes is impaired while switching to IgG1
remains unabated 30 , despite the presumably pervasive interference
exerted by neor on 3' enhancers. The deletion
analysis and transfection experiments on the Igh enhancers may imply a
functional redundancy of these elements with respect to heavy chain
expression and class switching. However, these enhancers may play
unique and important roles in other aspects of IgH synthesis, such as
in Ag-driven somatic hypermutation or in silencing of the locus in
non-B cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 The sequences reported herein have been deposited in the GenBank database and assigned accession numbers AF068481 and AF068482.
3 Current address: Department of Microbiology and Immunology, University of Maryland School of Medicine, 655 West Baltimore Street, Baltimore, MD 21201-1559.
4 Address correspondence and reprint requests to Dr. Barbara K. Birshtein, Department of Cell Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461. E-mail address:
5 Abbreviations used in this paper: IgH, immunoglobulin heavy chain protein; Igh, immunoglobulin heavy chain gene; VH, heavy chain variable region gene; CH, heavy chain constant region gene; hs, DNase I hypersensitive site; LCR, locus control region; EMSA, electromobility shift assay; BSAP, B cell-specific activator protein (Pax5); NP, (4-hydroxy-3-nitrophenyl)acetyl.
6 While our manuscript was under review, the article by Manis et al. (70) was published. The data of Manis et al. on the effect of independently targeted deletions of hs3A and hs1,2 in the mouse germline on class switching are consistent with the observations reported here. Specifically, they find that replacement of either hs3A or hs1,2 with neor causes identical and severe defects in switching to a number of isotypes in vivo and in vitro. These defects are completely abolished and class switching is restored to wild-type levels upon excision of the pgk-neor cassette, which essentially results in the replacement of hs3A or hs1,2 with a loxP site.
Received for publication September 2, 1998. Accepted for publication November 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2b genes. Nature 305:240.[Medline]
enhancer are differentially methylated and DNase I hypersensitive during B cell differentiation. J. Immunol. 150:1772.[Abstract]
constant region. Mol. Cell. Biol. 13:1547.-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23:975.3'E and hs3). J. Immunol. 158:4780.[Abstract]
enhancer at early stages of B-cell differentiation. Mol. Cell. Biol. 13:3611. heavy-chain gene products. Mol. Cell. Biol. 6:1903.ß
thalassemia due to a de novo mutation deleting the 5' ß-globin locus activating region hypersensitive sites. Proc. Natl. Acad. Sci. USA 86:7470.2a gene ceases upon deletion of an enhancer region over 70 kilobases away. EMBO J. 14:6229.[Medline]
chain intron enhancer abolishes chain gene rearrangement in cis but not chain gene rearrangement in trans. EMBO J. 12:2329.[Medline]
light chain intronic enhancer/matrix attachment region impairs but does not abolish VJ rearrangement. Immunity 4:377.[Medline]
B/Rel family proteins during B-cell terminal differentiation. Mol. Cell. Biol. 14:5349. induces the intron enhancer via an IFN-stimulated response element. J. Immunol. 156:2451.[Abstract]
B binding proteins. J. Immunol. 156:2828.[Abstract]
enhancer, 3'E(hs1, 2). Proc. Natl. Acad. Sci. USA 93:4392.3 or 2b production at pre-B cell stage. J. Immunol. 136:3092.[Abstract]
2b heavy chain expression. Mol. Immunol. 25:393.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. Vincent-Fabert, V. Truffinet, R. Fiancette, N. Cogne, M. Cogne, and Y. Denizot Ig Synthesis and Class Switching Do Not Require the Presence of the hs4 Enhancer in the 3' IgH Regulatory Region J. Immunol., June 1, 2009; 182(11): 6926 - 6932. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Giambra, S. Volpi, A. V. Emelyanov, D. Pflugh, A. L. M. Bothwell, P. Norio, Y. Fan, Z. Ju, A. I. Skoultchi, R. R. Hardy, et al. Pax5 and Linker Histone H1 Coordinate DNA Methylation and Histone Modifications in the 3' Regulatory Region of the Immunoglobulin Heavy Chain Locus Mol. Cell. Biol., October 1, 2008; 28(19): 6123 - 6133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Ju, S. A. Volpi, R. Hassan, N. Martinez, S. L. Giannini, T. Gold, and B. K. Birshtein Evidence for Physical Interaction between the Immunoglobulin Heavy Chain Variable Region and the 3' Regulatory Region J. Biol. Chem., November 30, 2007; 282(48): 35169 - 35178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Laurencikiene, V. Tamosiunas, and E. Severinson Regulation of {epsilon} germline transcription and switch region mutations by IgH locus 3' enhancers in transgenic mice Blood, January 1, 2007; 109(1): 159 - 167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Labbe, A. H. Tran, and C. J. Paige Murine Model of Immune-Mediated Rejection of the Acute Lymphoblastic Leukemia 70Z/3 J. Immunol., May 1, 2006; 176(9): 5354 - 5361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhou, S. Saleque, O. Ermakova, M. A. Sepulveda, Q. Yang, L. A. Eckhardt, C. L. Schildkraut, and B. K. Birshtein Changes in Replication, Nuclear Location, and Expression of the Igh Locus after Fusion of a Pre-B Cell Line with a T Cell Line J. Immunol., August 15, 2005; 175(4): 2317 - 2320. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Volgina, P.-C. Yam, and K. L. Knight A negative regulatory element in the rabbit 3'IgH chromosomal region Int. Immunol., August 1, 2005; 17(8): 973 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. W. Sulentic, W. Zhang, Y. J. Na, and N. E. Kaminski 2,3,7,8-Tetrachlorodibenzo-p-dioxin, an Exogenous Modulator of the 3'{alpha} Immunoglobulin Heavy Chain Enhancer in the CH12.LX Mouse Cell Line J. Pharmacol. Exp. Ther., April 1, 2004; 309(1): 71 - 78. [Abstract] [Full Text]
|
|
|
|
|
|
J. Zhou, O. V. Ermakova, R. Riblet, B. K. Birshtein, and C. L. Schildkraut Replication and Subnuclear Location Dynamics of the Immunoglobulin Heavy-Chain Locus in B-Lineage Cells Mol. Cell. Biol., July 1, 2002; 22(13): 4876 - 4889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Laurencikiene, V. Deveikaite, and E. Severinson HS1,2 Enhancer Regulation of Germline {epsilon} and {gamma}2b Promoters in Murine B Lymphocytes: Evidence for Specific Promoter-Enhancer Interactions J. Immunol., September 15, 2001; 167(6): 3257 - 3265. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
