| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Division of Basic Sciences, Laboratory of Experimental Immunology, National Cancer Institute, and
Intramural Research Support Program, Science Applications International Corp. Frederick, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD 21702
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
induced by IL-6 in human
NK cells. Together, these results suggest that STAT proteins play a key
role in perforin gene transcription and provide a model by which
cytokines can regulate perforin gene expression. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human and mouse perforin genes have been cloned, and the structure of the 5'-flanking regions was analyzed 7, 8, 9 . It was found that the general organization of the genes is very similar with three exons and a large intron separating the 5' untranslated region from the coding region. At the nucleotide level, mouse and human perforin genes are very homologous, especially in a region proximal to the cap site 10 . In that region, several potential regulatory elements of the promoter are conserved, suggesting that human and mouse genes are regulated in a similar fashion. However, many of the conserved sequences are not related to known regulatory elements, and the human perforin 5'-flanking region contains certain sequence elements, which are absent from the mouse sequence, that could represent species-specific regulatory elements.
Studies of mouse perforin promoter activity in perforin-positive and -negative cells revealed a core promoter that was not cell type specific, flanked by several cis-acting elements that restricted reporter gene expression to perforin-positive cells 11 . Upstream regulatory elements were found that could enhance or suppress perforin promoter activity in perforin-positive or -negative cells, respectively. An Ets-homologous binding site found in the proximal region of the mouse promoter was shown to bind Ets-related proteins in CTLL-R8, a perforin-positive cell line 12 . More recently, a critical role for Sp1- and Ets-related transcription factors in maintaining CTL-specific expression of mouse perforin was reported 13 . Interestingly, it was also proposed that Ets family members expressed exclusively by nonkiller cells can silence perforin expression 14 , further strengthening the role of these transcription factors in regulation of perforin expression.
Because a functional analysis of the human perforin promoter has not been performed, it remains to be established if the human perforin promoter is controlled in a similar fashion by Ets-related proteins or other transcription factors. STAT proteins are transcription factors that transfer signals generated by cytokine receptors from the cell surface to the nucleus and direct gene regulation by binding to a cis-acting STAT binding site 15, 16 . Several cytokines, including IL-2, IL-4, IL-6, IL-7, IL-12, and IFNs, have been shown to enhance perforin expression in different systems 17, 18, 19, 20 . In addition, the importance of STAT1 and STAT4 proteins in cell-mediated immunity has been documented 21, 22 . Therefore, STAT proteins represent transcription factors that could be involved in perforin gene regulation. In this study, a functional analysis of the human perforin promoter region was performed, and evidence for an important role of a STAT binding site in up-regulating perforin gene transcription in perforin-positive cells is presented.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
YT cells, a human NK-like cell line, and Jurkat cells, a human T
cell line, were cultured in complete medium (RPMI 1640 supplemented
with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin). The
Kit225-k6 IL-2-dependent human T cell line was cultured in complete
medium containing 20 U/ml human rIL-2 (Chiron, Emeryville, CA).
Antisera against STAT1, STAT3, and STAT5a/b were kindly provided by
Dr. Andrew C. Larner (Food and Drug Administration, Center for
Biologics Evaluation and Research, Division of Cytokine Biology,
Bethesda, MD).
Purification and stimulation of NK cells
PBMCs were separated on Ficoll-Hypaque (ICN, Costa Mesa, CA) as previously described 23 . Leukocyte suspensions were washed in HBSS and resuspended in RPMI 1640 containing 1% FCS. Monocytes and B cells were removed by adherence to plastic dishes followed by passage through a nylon wool column. Highly enriched populations of NK cells (>90% CD3-CD56+) were obtained from PBMC by centrifugation of nylon wool nonadherent cells on discontinuous density gradients of Percoll (Pharmacia Biotech, Uppsala, Sweden). Contaminating CD3+ cells in NK cell fractions were removed with anti-CD3 mAbs coupled to magnetic beads. Cells were washed and resuspended in RPMI 1640 medium, incubated at 37°C for 30 min in the absence of FCS, and immediately stimulated with 1000 U/ml IL-2 or 100 U/ml IL-6 for 15 min.
Construction of reporter plasmids
Fragments of the human perforin promoter region were amplified from genomic DNA by PCR using a common 3' reverse primer (5'-GCTCCTGGAATTCTGGCATC-3') containing an EcoRI site and various 5' forward primers containing a HindIII site. The forward PCR primers used were: P1, 5'-GGTGAGGAAGCTTACGCTCAG-3'; P3, 5'-CCGAGAAGCTTGCATAAGCC-3'; P5, 5'-TGACCTCAAGCAAGCTTGAGTGCAG-3'; P6, 5'-TGGGATGAAGCTTGAGCAGG-3' P7, 5'-GTGAAGAAGCTTAGGCACAG-3'; and P8, 5'-GCTGTGAAGCTTAAGCAAGG-3'. The PCR-derived fragments were digested with HindIII and EcoRI, cloned into pBluescript-KS (Stratagene, La Jolla, CA), and sequenced entirely using the Sequenase II kit (United States Biochemical, Cleveland, OH). Only two mismatches (A–G) were found between the PCR-generated perforin fragments and the published sequence 9 at position -1298 in the P1 fragment and at position -665 in the P5 fragment. Positions are relative to the transcription start site.
Each fragment was excised from recombinant pBluescript-KS clones with KpnI and BamHI and subcloned upstream of the luciferase gene in the promoter-less and enhancer-less pGL3-basic vector (Promega, Madison, WI) at the KpnI and BglII sites. The P2 construct was generated from the P1 clone by excision of the region upstream of the PstI site (position -1136). The P4 construct was generated from the P3 clone by excision of the region upstream of the NcoI site (position -835). The P9, P10, and P11 constructs were generated from the P8 clone by excision of the region upstream of the HaeIII (position -160), FokI (position -107), and PvuII (position -55) sites, respectively.
The potential STAT binding site TTCCGAGAA at the 5' end of the P2 construct was mutated to TGCCGACAA using the transformer site-directed mutagenesis kit (Clontech, Palo Alto, CA), and the mutated clone was verified by sequencing.
The ß-galactosidase (ß-gal)4 reporter plasmid was constructed as follows: complementary oligonucleotides consisting of three copies of a potential STAT binding site-containing segment of the human perforin 5'-flanking region (5'-TGGGGCCAGATTCCGAGAAGACAGCAT-3' (position -1099 to -1073) were synthesized with HindIII and SalI restriction sites at the 5' and 3' ends, respectively, and annealed to form dsDNA. The fragment was subcloned upstream of a thymidine kinase (TK) promoter linked to the ß-gal gene. The construct was verified by sequencing.
Transient transfection
Transient transfections were performed by the DEAE-dextran method as previously described 24 . Briefly, for each point, 4 x 106 cells were incubated with 5 µg of indicated reporter gene constructs in RPMI 1640 with 50 mM Tris-HCl (pH 7.5) containing 350 µg/ml DEAE-dextran for 1 h at 37°C with periodic agitation. Cells were washed twice with RPMI 1640, 50 mM Tris-HCl, resuspended in complete medium, and incubated for 48 h.
Luciferase and ß-gal assays
Cells were washed with PBS, pelleted, and lysed by vortex mixing for 15 s in 100–200 µl of reporter lysis buffer (Promega). A clear lysate was obtained by centrifugation at 12,000 x g. Luciferase activity was measured from 20 µl of supernatant using the luciferase assay system (Promega) according to the manufacturer’s directions. For ß-gal assays, 80 µl of cell lysate were preincubated at 50°C for 1 h and ß-gal activity was measured by a standard colorimetric assay using the chlorophenol red ß-D-galactopyranoside substrate. Luciferase units were corrected for protein content and normalized for ß-gal activity.
Preparation of nuclear extracts
Cells were washed once with ice-cold PBS and once with buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 1 mM Na3VO4, 25 mM NaF, 10 mM Na-pyrophosphate, and 25 mM p-nitrophenyl guanidinobenzoate), and lysed in buffer A containing 0.05% Nonidet P-40 (Sigma, St. Louis, MO). Lysate was placed on ice for 10 min and centrifuged at 4000 x g at 4°C for 4 min to remove cytoplasmic proteins. Nuclear proteins were extracted from the pellet in high salt buffer (410 mM KCl, 25% glycerol, and 0.2 mM EDTA in buffer A). Insoluble material was removed by centrifugation at 15,000 x g for 10 min. Protein concentration was measured with a Bio-Rad protein assay (Hercules, CA) and samples were stored at -70°C until use.
Electrophoretic mobility shift assays (EMSA)
Double-stranded oligonucleotides containing potential STAT and
purine binding transcription factor- (PuF-) like motifs from the
5'-flanking region of human perforin gene
(CTGCAGTTTCTAGAAGAGGGTGGGGACACTGCGGAGAGAAGATGGGGCCAGATTCCGGAAGACAGCAT),
located between positions -1141 and -1073 or containing the STAT
(TGGGGCCAGATTCCGAGAAGACAGCAT) or PuF-like
(CTGCAGTTTCTAGAAGAGGGTGGGGACACT) elements alone were end-labeled
with [-32P]dATP (3000 Ci/mmol; DuPont, Boston, MA)
using the Klenow fragment of DNA polymerase I (New England Biolabs,
Beverly, MA). Labeled DNA probe was purified from a 12% polyacrylamide
gel by excising the corresponding radioactive band after
electrophoresis. Purified DNA probe was adjusted to 15,000 cpm/µl and
stored at -20°C until use. EMSA were performed as previously
described 25 . For supershift analysis, nuclear extracts were
incubated with 1 µl of normal rabbit serum (NRS) or antisera to
STAT1, STAT3, or STAT5a/b for 2 h on ice before the addition of
32P-labeled DNA probe. Cold competition experiments were
performed by including unlabeled probes. Results were visualized by
autoradiography after 1–4 days exposure at -70°C.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous reports have indicated that the human perforin promoter
region contains many putative cis-acting regulatory elements
9, 10 . To study the role of these elements in perforin gene
regulation, we have generated luciferase reporter constructs containing
11 different perforin promoter fragments, cloned into the
promoter-less and enhancer-less luciferase reporter plasmid pGL3.
The size and location of the fragments used are shown in Fig. 1
. These constructs were transfected into
YT cells, an NK-like cell line that has constitutive transcription of
the human perforin gene 26 and two human T cell lines, Jurkat and
Kit225-k6, that do not express perforin. Fig. 1 shows the relative
luciferase activity of the promoter constructs in transiently
transfected cells. The P11 construct (-55 bp) had a 3-fold increase in
activity when compared with the empty vector in YT cells and 7- to
8-fold in Jurkat and Kit225-k6 cells, indicating the presence of a core
promoter element in this fragment. Constructs with increasing lengths
of 5' sequence produced no significant peak of promoter activity in
Jurkat or Kit225-k6 cells. However, in YT cells, constructs P1 and P3
(-1366 and -1076 bp) showed a 34- and 25-fold increase, respectively.
The highest promoter activity was observed with construct P2,
containing 1136 bp upstream of the transcription start site. The
activity of this construct was about 65 times higher than the empty
vector control (Fig. 1). These results suggest that cell-specific
transcription factor(s) regulate perforin promoter activity and that an
enhancer sequence is located in the region from -1136 to -1076 of the
perforin promoter.
|
A computer-assisted search of the -1076 to -1136 region of the
perforin promoter revealed the presence of two known transcription
factor binding sites, STAT and PuF. To investigate whether YT cells
contain specific trans-acting factors that are able to bind
to these sites, EMSA were performed with a probe containing nucleotides
-1141 to -1076 of the perforin promoter. Two DNA-protein complexes
were detected in YT cells (identified as C1 and C2 in Fig. 2, lane 1). Specific
oligonucleotides were used for competition assays to identify the
elements involved. As expected, a full-length unlabeled probe
completely eliminated the C1 and C2 bands, indicating that these
complexes were specific (Fig. 2, lane 2). Interestingly, an
unlabeled oligonucleotide (TGGGGCCAGATTCCGAGAAGACAGCAT) containing
the putative STAT element present in the labeled probe was able to
block the formation of complex C1 but not C2, indicating that the STAT
containing region is only involved in the formation of complex C1 (Fig. 2, lane 3). On the other hand, the addition of an unlabeled
oligonucleotide (CTGCAGTTTCTAGAAGAGGGTGGGGACACT) containing the
PuF-like element did not prevent the formation of either complex,
indicating that PuF binding proteins are not involved in the formation
of these complexes (Fig. 2, lane 4). EMSA analysis of Jurkat
cells with the probes described above did not result in the detection
of any complexes, consistent with the lack of promoter activity in
these cells (data not shown).
|
(lane 5), addition of anti-STAT3 antiserum
supershifted complex C1, revealing the presence of STAT3 in that
complex and further demonstrating the role of the STAT binding element
in the formation of the C1 complex. NRS had no effect on the formation
of either complex. Collectively, these data provide evidence that STAT
proteins can bind to the perforin promoter, forming complex C1, whereas
unknown proteins are involved in the formation of complex C2.
Because YT is an NK-like cell line, it may differ from freshly isolated
NK cells. Therefore, the ability of the perforin STAT element to bind
STAT proteins from IL-2-activated human NK cells was studied. As shown
in Fig. 3A (lanes
1–4), specific complexes with the perforin STAT,
but not with the PuF-like element, were observed with NK cell nuclear
extracts. Contrary to the results obtained with YT cells, inhibition of
complex formation with anti-STAT Abs demonstrated that activated
STAT5a/b and not STAT3 were binding to the STAT element (Fig. 3, lanes 5–7). To investigate whether
STAT1 is capable of binding to the perforin STAT element, we
stimulated human NK cells with IL-6, which has been shown to activate
STAT1. As shown in Fig. 3B, IL-6 stimulation results in
the detection of a complex that can be blocked by the addition of
anti-STAT1 antiserum. This indicates that multiple STAT proteins
are capable of binding the perforin STAT element and that different
STAT proteins may be used by different perforin-positive cells to
regulate perforin gene transcription.
|
Having demonstrated that STAT proteins bind a specific sequence of
the perforin promoter, the functional relevance of that observation was
then evaluated. The STAT binding site contained in the P2 construct was
altered by site-directed mutagenesis so that it could no longer be
recognized by STAT proteins. We have previously shown that this
mutation completely abrogates STAT binding activity 25 . YT cells were
transfected with wild-type or mutated P2 constructs and luciferase
activity was measured. As shown in Fig. 4, destroying the STAT binding site
resulted in a dramatic reduction of promoter activity to the level of
the core promoter (P11). This result clearly indicates the requirement
for STAT proteins in perforin promoter activity and suggests the
presence of a suppressor element in the region between -1076 and
-1136 bp.
|
To test the transcription-enhancing activity of the perforin STAT
element, a TK-ß-gal reporter plasmid containing three repeats of the
STAT binding element was generated. YT cells were transfected with the
STAT containing vector or control vector with the TK promoter and
ß-gal gene alone and stimulated with 1000 U/ml of IL-2 for 24 h
before measuring ß-gal activity (Fig. 5). The transcriptional activity of the
STAT containing vector was notably higher than the control vector; this
finding is consistent with our previous result that constitutively
activated STAT3 from YT cells is able to bind the perforin STAT element
(Fig. 2). The IL-2 stimulation only increased the activity of the STAT
containing vector about 2-fold. Regardless, these data demonstrate that
the perforin STAT element can function as an enhancer in a heterologous
promoter.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), suggesting that the Ets-related sites may only be important for
basal promoter activity or cell type-specific restriction of promoter
activity in the human. However, a strong enhancer activity was detected
in construct P2 that increased promoter activity about 65-fold in YT
cells, but not in Jurkat and Kit225-K6 cells, suggesting that
cell-specific transcription factors are binding to this region of the
promoter. This region of the human promoter contains a
potential STAT binding site (TTCCGAGAA) at -1081. DNA
protein binding assays confirmed that the putative STAT element from
the human promoter is capable of binding STAT proteins. In YT cells,
the STAT3 protein was found to bind to this element (Fig. 2), whereas
in IL-2-activated human peripheral blood NK cells, STAT5a/b proteins
were detected (Fig. 3A) and STAT1 was detected after IL-6
stimulation (Fig. 3B). Interestingly, the mouse perforin
promoter contains a similar site (TTCTGAGAA) at position -802. Mouse
perforin promoter constructs containing this potential STAT binding
site showed increased transcriptional activity only in
perforin-positive cells 11, 13 , suggesting that this element may also
be active in the mouse perforin promoter. The mouse and human STAT elements are flanked on the 5' side by purine-rich sequences. Interestingly, the human gene contains a single PuF-like element in this region. PuF is encoded by the nucleoside diphosphate kinase-B gene that has been postulated to suppress tumor metastasis. In addition, PuF has been shown to act as a transcriptional activator of the myc promoter in which it binds to a tandem repeat of GGGTGGG 27 . An oligonucleotide corresponding to this region did not produce any DNA-protein complexes in either YT or peripheral blood NK cells, suggesting that no activated PuF or PuF-like proteins are present in these cells or that the single PuF motif is not sufficient to confer transcription factor binding.
Mutation of the STAT binding element demonstrated the essential role of
the element in driving perforin promoter activity in YT cells. It is of
interest to note that removal of STAT binding revealed a strong
suppressor activity present in the -1076 to -1136 region of construct
P2, because the mutant had transcriptional activity that was greatly
decreased when compared with construct P3. A lower m.w. complex was
observed with a probe spanning this region (C2; Fig. 2), that could not
be inhibited by competition with oligonucleotides containing either the
STAT site or PuF-like element. Additional experiments will be necessary
to determine whether this complex is associated with the inhibitory
activity detected in this region.
The identification of a functional STAT binding element in the human
perforin promoter and a potential STAT binding element in the mouse
promoter provides a possible molecular explanation for the ability of
cytokines to modulate perforin expression. Two cytokines that have been
demonstrated to increase perforin expression, IL-2 and IL-7 6, 19 ,
have also been demonstrated to activate and induce heterodimerization
of the STAT5a/b isoforms in human peripheral blood T cells 28, 29 .
Similarly, IL-2 stimulation of NK cells predominantly activates STAT5
isoforms 25 . Our results with primary human NK cells have
demonstrated the ability of STAT5a/b from IL-2-activated NK cells to
bind to the perforin STAT element. Although the activation of human
perforin gene transcription by STAT3 in YT cells aided in the
identification of a STAT-responsive element in the perforin promoter,
STAT5a/b probably represents the physiologically important activator in
response to IL-2 stimulation. Indeed, although IL-2 can induce STAT3
activation in human peripheral blood NK cells 25 , no STAT3 could be
detected using the perforin promoter STAT binding site (Fig. 3A) and treatment of YT cells with IL-2 also leads to the
activation of STAT5a/b (Ref. 30 and data not shown). IL-6 treatment is
known to activate STAT1 and STAT3 31 , and it has also been shown
to induce perforin transcription 18 . In the present study, STAT1
activated by IL-6 treatment was shown to bind to the perforin STAT
element. We have also observed the ability of the perforin STAT element
to bind to STAT1, STAT3, and STAT5 induced in fresh human T cells
(data not shown). Therefore, it appears that the perforin STAT element
is responsive to multiple STAT proteins. This correlates with the
ability of various ILs to enhance perforin expression although they
induce the activation of different STAT family members.
This study provides strong evidence that transcriptional activation of the perforin gene in human NK cells involves STAT protein activation. Because perforin has been shown to be crucial for NK lytic activity 4 , these results provide a molecular explanation for the cytokine regulation of NK lytic activity.
|
Acknowledgments |
|---|
, STAT3, STAT5a, and STAT5b and
for helpful discussions. We also thank Dr. Daniel McVicar for his
critical review of this manuscript. |
Footnotes |
|---|
2 Current address: Laboratory of Clinical Investigation, Cytokine Biology Unit, National Institutes of Allergy and Infectious Diseases, National Institute of Health, Building 10, Room 11C106, 10 Center Drive, Bethesda, MD 20892-1158.
3 Address correspondence and reprint requests to Dr. Stephen K. Anderson, Science Applications International Corp.-Frederick, National Cancer Institute-Frederick Cancer Research and Development Center, Bldg. 560, Rm. 31-93, Frederick, MD 21702-1201. E-mail address:
4 Abbreviations used in this paper: ß-gal, ß-galactosidase; TK, thymidine kinase; PuF, purine binding transcription factor; EMSA, electrophoretic mobility shift assays; NRS, normal rabbit serum.
Received for publication August 31, 1998. Accepted for publication November 23, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production, and cytotoxicity of human peripheral blood lymphocytes subsets. Cell. Immunol. 138:390.[Medline]
. J. Immunol. 157:126.[Abstract]
gene transcription. J. Biol. Chem. 272:31821.This article has been cited by other articles:
|
|
 |
|
  K. J. Marr, G. J. Jones, C. Zheng, S. M. Huston, M. Timm-McCann, A. Islam, B. M. Berenger, L. L. Ma, J. C. D. Wiseman, and C. H. Mody Cryptococcus neoformans Directly Stimulates Perforin Production and Rearms NK Cells for Enhanced Anticryptococcal Microbicidal Activity Infect. Immun., June 1, 2009; 77(6): 2436 - 2446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Thedrez, C. Harly, A. Morice, S. Salot, M. Bonneville, and E. Scotet IL-21-Mediated Potentiation of Antitumor Cytolytic and Proinflammatory Responses of Human V{gamma}9V{delta}2 T Cells for Adoptive Immunotherapy J. Immunol., March 15, 2009; 182(6): 3423 - 3431. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Gorjao, S. M. Hirabara, T. M. de Lima, M. F. Cury-Boaventura, and R. Curi Regulation of interleukin-2 signaling by fatty acids in human lymphocytes J. Lipid Res., September 1, 2007; 48(9): 2009 - 2019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Casey and M. F. Mescher IL-21 Promotes Differentiation of Naive CD8 T Cells to a Unique Effector Phenotype J. Immunol., June 15, 2007; 178(12): 7640 - 7648. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. White, S. Krishnan, N. Strbo, H. Liu, M. A. Kolber, M. G. Lichtenheld, R. N. Pahwa, and S. Pahwa Differential effects of IL-21 and IL-15 on perforin expression, lysosomal degranulation, and proliferation in CD8 T cells of patients with human immunodeficiency virus-1 (HIV) Blood, May 1, 2007; 109(9): 3873 - 3880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Janas, P. Groves, N. Kienzle, and A. Kelso IL-2 Regulates Perforin and Granzyme Gene Expression in CD8+ T Cells Independently of Its Effects on Survival and Proliferation J. Immunol., December 15, 2005; 175(12): 8003 - 8010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Shacklett, C. A. Cox, M. F. Quigley, C. Kreis, N. H. Stollman, M. A. Jacobson, J. Andersson, J. K. Sandberg, and D. F. Nixon Abundant Expression of Granzyme A, but Not Perforin, in Granules of CD8+ T Cells in GALT: Implications for Immune Control of HIV-1 Infection J. Immunol., July 1, 2004; 173(1): 641 - 648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Lu, A. Wu, D. Ray, C. Deng, J. Attwood, S. Hanash, M. Pipkin, M. Lichtenheld, and B. Richardson DNA Methylation and Chromatin Structure Regulate T Cell Perforin Gene Expression J. Immunol., May 15, 2003; 170(10): 5124 - 5132. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhou and G. G. Meadows Alcohol Consumption Decreases IL-2-Induced NF-{kappa}B Activity in Enriched NK Cells from C57BL/6 Mice Toxicol. Sci., May 1, 2003; 73(1): 72 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. Wulffraat, G. T. Rijkers, E. Elst, R. Brooimans, and W. Kuis Reduced perforin expression in systemic juvenile idiopathic arthritis is restored by autologous stem-cell transplantation Rheumatology, February 1, 2003; 42(2): 375 - 379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhou, J. Zhang, M. G. Lichtenheld, and G. G. Meadows A Role for NF-{kappa}B Activation in Perforin Expression of NK Cells Upon IL-2 Receptor Signaling J. Immunol., August 1, 2002; 169(3): 1319 - 1325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. G. Burnett and J. S. Hunt Nitric Oxide Synthase-2 and Expression of Perforin in Uterine NK Cells J. Immunol., May 15, 2000; 164(10): 5245 - 5250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhang, I. Scordi, M. J. Smyth, and M. G. Lichtenheld Interleukin 2 Receptor Signaling Regulates the Perforin Gene through Signal Transducer and Activator of Transcription (Stat)5 Activation of Two Enhancers J. Exp. Med., November 1, 1999; 190(9): 1297 - 1308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES J. Biol. Chem., February 23, 2001; 276(9): 6675 - 6688. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
