The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kabra, N. H.
Right arrow Articles by Winoto, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kabra, N. H.
Right arrow Articles by Winoto, A.
The Journal of Immunology, 1999, 162: 2766-2774.
Copyright © 1999 by The American Association of Immunologists

A Tailless Fas-FADD Death-Effector Domain Chimera Is Sufficient to Execute Fas Function in T Cells But Not B Cells of MRL-lpr/lpr Mice1

Nisha H. Kabra, Dragana Cado and Astar Winoto2

Department of Molecular and Cell Biology, Division of Immunology and Cancer Research Lab, University of California at Berkeley, Berkeley, CA 94720


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Fas receptor delivers signals crucial for lymphocyte apoptosis through its cytoplasmic death domain. Several Fas cytoplasmic-associated proteins have been reported and studied in cell lines. So far, only Fas-associated death domain protein (FADD), another death domain-containing molecule has been shown to be essential for Fas signals in vivo. FADD is thought to function by recruiting caspase-8 through its death-effector domain. To test whether FADD is sufficient to deliver Fas signals, we generated transgenic mice expressing a chimera comprised of the Fas extracellular domain and FADD death-effector domain. Expression of this protein in lymphocytes of Fas-deficient MRL-lpr/lpr mice completely diminishes their T cell but not their B cell abnormalities. These results suggest that FADD alone is sufficient for initiation of Fas signaling in primary T cells, but other pathways may operate in B cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas is a member of the TNFR family. Its protein structure consists of an extracellular domain with cysteine-rich repeats and a cytoplasmic tail containing a death domain 1, 2 . The death domain is crucial for Fas signal transduction because a single amino acid mutation in this region results in defective Fas function 3 . Mice and humans with Fas defects suffer from severe autoimmune problems characterized by lymphadenopathy, splenomegaly, elevated serum Abs, and the presence of autoantibodies 3, 4 . Death domains are also found in several other apoptosis-inducing TNFR family members, including TNFR-1, death receptor (DR)3, DR4, and DR5 2, 5, 6 .

To elucidate the signal transduction pathway of Fas-mediated apoptosis, several proteins have been isolated that associate with the cytoplasmic tail of Fas. These include the death domain-associated proteins, Fas-associated death domain (FADD)3, 7, 8, 9 , RIP 10 , Fas-associated protein factor (FAF)-1 11 , ubiquitin conjugating enzyme 12, 13 , and Daxx 14 . Both FADD and RIP also contain a death domain, and over-expression of either of them in cell lines results in apoptosis. FAF-1 and Daxx have no recognizable motifs, yet their over-expression can potentiate Fas-mediated apoptosis. For Daxx, this is mediated through c-Jun N-terminal kinase (JNK) activation, independent of a caspase cascade 14 . In addition, several kinases have been reported to bind to the Fas membrane proximal region 15 . FAP-1, a tyrosine phosphatase, was found to bind to the extreme carboxyl terminal amino acids of Fas 16 . While the identities of the Fas-associated kinases have not been determined, expression of FAP-1 seems to inhibit Fas function. Among the Fas-binding proteins, FADD is the only one thus far that has been shown to be essential for Fas-mediated apoptosis in vivo. Its association with Fas is ligand-dependent and has been confirmed by coimmunoprecipitation of the endogenous protein 9, 17 . In addition, FADD-deficient thymocytes and embryonic fibroblasts are completely resistant to Fas 18, 19 , suggesting that FADD is an essential mediator for Fas-induced apoptosis.

Given the large number of proteins found to associate with Fas in vitro, it is possible that in addition to FADD, one or more of them are also required for Fas-mediated apoptosis in vivo. While it is well established that recruitment of FADD to the membrane results in its association with caspase-8 (FADD-like interleukin-1 ß-converting enzyme; FLICE) through the death-effector domain homology units, it is not completely clear whether other molecules are involved in the initiation of apoptosis. By immunoprecipitation of the endogenous receptor, both FADD and caspase-8 were found to associate with the Fas cytoplasmic tail 17 . Differential phosphorylated forms of FADD were identified as cytotoxic-dependent Fas- associated protein (CAP)1 and CAP2, while CAP4 was identified as caspase-8. Another molecule, CAP3 is an unknown protein with an identical N terminus to caspase-8 17, 20 . As immunoprecipitation only detects proteins with strong affinity, the possible existence of other Fas-associated proteins required for Fas function cannot be completely ruled out.

We sought to address this issue by generating a Fas-FADD chimeric protein. Mouse Fas is a 306-amino acid polypeptide 3 . Its cytoplasmic tail can be divided into the membrane proximal region 166–216(166–216), the death domain 217–291(217–291), and the distal region (292–306). We constructed a Fas-FADD chimera by fusing the first 183 amino acids of Fas to the death-effector domain of FADD 1–96(1–96). This chimera does not contain any death domains and lacks the distal 15 amino acids of Fas and most of the Fas membrane proximal region. Introduction of this protein into several T cell tumors results in a ligand-dependent apoptosis. To assess its function in vivo, we generated transgenic mice expressing this chimera in Fas-deficient MRL-lpr/lpr background. In contrast to the over-expression studies in cell lines, massive apoptosis in the thymi of these mice is not seen, as thymocyte cell numbers and cell populations are normal. Its presence in the peripheral T cell compartment, however, diminishes the T cell abnormalities of the lpr/lpr mice in a dose-dependent manner. These data argue strongly that FADD is sufficient to deliver Fas apoptotic signals to T cells in vivo and that no other proteins are needed to bind to Fas for its function. In B cells, however, expression of the same protein does not completely rescue the lpr/lpr B cell abnormalities. Thus, other Fas pathways might yet operate in apoptosis of B lymphocytes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids

The DNA encoding the extracellular portion of mouse Fas was derived from the XbaI fragment of pEFBOS-Fas 3, 21 . The Fas{Delta}CT was constructed by inserting this XbaI fragment into the XhoI site of pCI plasmid (Promega, Madison, WI). The Fas-FADD truncation chimeras were generated in two steps. Plasmids encoding fusion proteins with FADD 1–96, 19–96, 1–82, and 1–67 were derived by PCR using oligonucleotides based on the mouse FADD cDNA sequence 9, 22 . The oligonucleotides have XbaI/MluI linkers on the ends. Fragments were then subcloned into the XbaI/MluI site of pCI-Fas{Delta}CT. For the full-length FADD chimera, the XbaI fragment of pEFBOS-Fas was first cloned into the SmaI site of pEV3S 23 . The NcoI/XhoI fragment of the mouse FADD cDNA was then cloned into the Asp318 site of the pEV3S-Fas{Delta}CT clone. The insert of the resulting plasmid was cut out with EcoRI/XbaI and subcloned into pCI vector (Promega).

For stable transfections, the XhoI/SalI fragment of pCI-Fas{Delta}CT was subcloned into the BamHI/HindIII sites of pHßApr-1-neo plasmid 24 . For transfection of the Fas-FADD 1–96 chimera, the pCI-Fas-FADD 1–96(1–96) plasmid was linearized with SalI and was cotransfected in a 1:3 molar ratio with the linearized pHßApr-1-neo plasmid (cut with NdeI).

The transgenic construct was cloned in two steps. The BamHI/EcoRI fragment of p1017 25, 26 encoding the human growth hormone exons was inserted into the EcoRV site of pSP72-V{alpha}11.1 plasmid containing a 600-bp XbaI fragment of the TCR V{alpha}11.1 promoter fragment from pTCR1700 27 . This generates the pV{alpha}11-GH plasmid. The XhoI/SalI fragment from pCI-Fas-FADD 1–96(1–96) was then inserted into the BamHI site of pV{alpha}11-GH. The resulting plasmid was linearized with SphI and was coinjected in an equimolar ratio with the SalI/ClaI 9.5-kb fragment of pLCRc plasmid 28 , which contains the TCR{alpha} locus control region 29 .

Antibodies

Anti-poly (ADP ribose) polymerase (PARP) (C2–10) for Western blot analyses was purchased from PharMingen (San Diego, CA). Anti-FADD was used as previously described 9 . The secondary Abs for Western blot analysis were either sheep anti-mouse Abs (whole IgG) from Amersham (Arlington Heights, IL) or goat anti-rabbit IgG (heavy and light chain) from Caltag (South San Francisco, CA). For in vitro assays, anti-Fas (Jo2) was purchased from PharMingen with no azide and low endotoxin. For flow cytometric analysis CD16/CD32 (2.4G2), Thy1.2 (53-2.1) FITC, Jo2 FITC, and Annexin V FITC were purchased from PharMingen, and B220-PE (RA3-6B2), CD4-PE (CT-CD4), CD8{alpha}-TC (CT-CD8a), TCR{alpha}ß-PE (H57-597) were purchased from Caltag. Anti-CD3 (500A2) and anti-CD28 (37.51) ascites were produced in house. Both were titrated for effective concentration and were used at 1 µg/ml and 5 µg/ml, respectively, unless otherwise noted.

Transgenic mice

MRL/Mpj Faslpr mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Transgenic mice were generated by microinjection of DNA into the pronucleus of (C57BlXCBA) F1 fertilized mouse eggs, and transferred to pseudo-pregnant CD1 foster mothers. Founders were identified by Southern blot analysis and PCR typing. Each line was then backcrossed for a minimum of two generations to obtain transgenic and homozygous lpr/lpr mice.

Mouse typing

Tail DNA was tested for two alleles. First, the transgenic allele (Tg) PCR primers and conditions are as follows: 5'-CCCTTGAGCCATGCACAGC and 3'-CGCCTCGAAGTCGTCCAGG for 1 min at 95°C, 1 min at 59°C, 1 min at 72°C for 29 cycles, 5 min at 72°C, and soak at 4°C. The Tg allele is a 436-bp fragment. Lastly, the lpr allele PCR primers and conditions are as follows (as described by Drs. Hui-Chen Hsu and John Mountz, unpublished observations): Three primers are F1 GTAAATAATTGTGCTTCGTCAG (Fas intron 2), R1 TAGAAAGGTGCACGGGTGTG (corresponds to the sequence of the viral insertion in the lpr locus), and R2 CAAATCTAGGCATTAACAGTG (Fas intron 2) for 1 min at 94°C, 45 s at 50°C, 45 s at 74°C for 30 cycles, 7 min at 74°C, and soak at 4°C. The wild-type allele is 184 bp and the lpr allele is 212 bp.

Flow cytometry

Cell suspensions were prepared from lymphoid organs of mice 6–16 wk of age. Briefly, thymocytes, lymph node cells, and splenocytes were depleted of erythrocytes by treatment for 5 min at room temperature with Red Blood Cell Lysis Buffer (Sigma, St. Louis, MO). Cells were filtered, washed, and resuspended in PBS, 4% FCS, and 1 mM NaN3 for analysis. One million peripheral lymphoid cells were incubated with anti-Fc{gamma}RII/III Ab (2.4G2; PharMingen) and normal rabbit serum for 10 min at 4°C before cell surface staining. Cell surface staining was conducted for an additional 20 min in staining buffer with the appropriate Abs. Cells were washed twice, and analysis was performed on the Beckman-Coulter (Fullerton, CA) EPICS XL-MCL.

Western blot and in vitro translation

For PARP western blot, transfected cells were collected and lysed in 62.5 mM Tris (pH 6.8), 6 M urea, 10% glycerol, 2% SDS, and 5% 2-ME and briefly sonicated. Lysate was then heated to 65°C before loading onto 8.5% SDS-PAGE. Gels were transferred to Optitran membrane (Schleicher & Schuell, Keene, NH), blocked for 2 h at room temperature, and incubated with primary Ab (C2–10) overnight at 4°C. The next day, the blot was washed and probed with horseradish peroxidase (HRP) anti-mouse Abs (Amersham). Chemiluminescence was conducted using Renaissance Western blot chemiluminescence reagent (New England Nuclear, Boston, MA). For FADD Western blot analysis, a cell pellet of 2.5 x 107 cells was lysed in 0.5% Nonidet P-40, 150 mM NaCl, 1 mM EDTA, 50 mM Tris (pH 7.5), 1 mM DTT, 0.1 M NaF, 1 mM Na3V04, and 1 mM PMSF. Five million cells were loaded per lane onto a 12% SDS-PAGE. The transfer and blotting were done as before using the appropriate Abs. For in vitro translation all pCI constructs were linearized with NotI and were transcribed with T7 polymerase (NEB, Beverly, MA). In vitro translation was conducted using the rabbit reticulocyte lysate system (Promega) as per manufacturer’s protocol.

Apoptotic assays

TUNEL assay 30 was conducted using the in situ cell death detection kit, fluoroscein (Boehringer Mannheim, Indianapolis, IN) per manufacturer’s protocols. Briefly, 106 stably transfected cells with and without anti-Fas treatment were aliquoted into a 96-U-well plate and fixed in 4% paraformaldehyde and PBS at room temperature for 30 min. Cells were subsequently washed with 1% BSA and PBS and permeabilized on ice for 2 min with 0.1% Triton X-100 in 0.1% sodium citrate. Cells were washed twice and incubated with TUNEL reaction mixture for 1 h at 37°C. Cells were washed and analyzed by flow cytometry.

ELISA

Sera were prepared from mice between 16 and 17 wk of age. Serum isotypes were quantified using the clonotyping system/HRP and the mouse Ig standard panel (Southern Biotechnology Associates, Birmingham, AL). All concentrations were calculated from the appropriate standard curve and the appropriate dilutions. Serum levels of anti-dsDNA Abs were quantified using the Hemagen DNA kit (Hemagen, Waltham, MA), per manufacturer’s protocol. A change to the protocol includes the use of an alternate secondary Ab, goat anti-mouse IgG HRP (Southern Biotechnology Associates).

Cell culture and proliferation assay

Jurkat T cells were grown in RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% FCS, 2 mM glutamine, 1 mM sodium pyruvate, 100 U/ml of penicillin/streptomycin, 10 mM HEPES, and 80 µM 2-ME. Twenty million cells per construct were electroporated at the following settings: 250 volts, 750 µF. Cells were allowed to recover from transfection for 8 h, after which dead cells were removed by Ficoll gradient (Sigma). Live cells were recovered from the gradient, washed, and cultured overnight. Treatments to the cells were conducted the next day. YAC-1 cells were grown and transfected as described above. Twenty-four hours posttransfection, dead cells were removed by Ficoll gradient and the live cells were put under selection conditions, 1 mg/ml G418 (Life Technologies). Selection medium was replenished every 48 h. Colonies were picked after 7 days, expanded and checked for expression by flow cytometry, and confirmed by Western blot analysis. Lymph node cells were harvested in complete RPMI 1640 and depleted of RBC as described. B cells were depleted using Dynabeads mouse pan B (B220) (Dynal, Great Neck, NY). One hundred thousand T cells (>97% purity) were triplicate cultured in round-bottom 96-well plates, previously coated with 1 µg/ml of anti-CD3 (500A2). Anti-CD28 (37.51) was added in solution at a final concentration of 5 µg/ml. [3H]thymidine (1 µCi; NEN) was added per well. Cells were harvested, and 3H incorporation was measured at the times indicated.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of the Fas-FADD chimeras in T cell tumors

We generated the Fas-FADD chimeric molecules by fusing the first 183 amino acids of the mouse Fas protein encoding the extracellular and transmembrane domain (Fas{Delta}CT) to the full-length FADD or various truncations of the FADD death-effector domain (amino acids 1–96, 19–96, 1–67, and 1–82; Fig. 1Go). They were cloned into an eukaryotic expression plasmid and shown to produce proteins of expected size as assessed by in vitro translation (Fig. 2GoA). To evaluate their apoptotic function, the Fas-FADD constructs were transiently transfected into human Jurkat T cells, and their ability to induce apoptosis was measured by PARP cleavage 31 . Apoptosis was initiated by addition of anti-mouse Fas Abs, which do not recognize the endogenous human Fas protein. As shown in Fig. 2GoB, the truncated Fas did not induce PARP cleavage by itself nor when stimulated by anti-Fas Abs. In contrast, the Fas-FADD chimera containing the full-length 1–96 or 1–82 regions of FADD induced PARP cleavage when cross-linked by anti-Fas Abs (Fig. 2GoB). Deletion of the first 18 amino acids of the FADD death-effector domain or its C-terminal region abolished their ability to induce PARP cleavage (Fig. 2GoB). These data are consistent with the proposed role of FADD death-effector domain to recruit caspase-8 to the membrane 2, 5, 6 . Fas-FADD 1–96(1–96) was further chosen for analysis in stable transfection experiments. For this purpose, we used a subclone of the mouse T cell tumor YAC-1 that had been selected for low Fas cell surface expression by cell sorting. Stable transfectants were obtained with either tailless Fas (Fas{Delta}CT) or Fas-FADD 1–96(1–96) proteins, indicating that the Fas-FADD chimera is not toxic to the cells. Stimulation of three independent Fas-FADD stable clones (G3, H3, and D9) with the anti-Fas Abs resulted in a high level of apoptosis as measured by the TUNEL assay (Fig. 2GoC). As controls, neither the parental YAC-1 cells nor the Fas{Delta}CT clones (A11, C2) showed any significant apoptosis when treated with anti-Fas Ab (Fig. 2GoC). We concluded that Fas-FADD 1–96(1–96) fusion protein, hereafter termed Fas-FADD, is not lethal to cells and is capable of delivering Fas apoptotic signals.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 1. A schematic diagram of the mouse Fas-FADD transgene. A schematic diagram of the mouse Fas protein is depicted as a black box for its extracellular domain (1–148), an open box for the transmembrane domain (TM, 149–165), its membrane proximal (166–216), and distal region of the cytoplasmic tail (292–306), and a stippled box for the death domain (DD, amino acid 217–291). The mouse FADD protein is drawn in a gray box, which indicates its death-effector domain (amino acid 1–96) and a stippled box for its death domain (97–206). The Fas-FADD cDNA used for transgenic experiments was derived by fusing the mouse Fas cDNA encoding the first 183 amino acids to the mouse FADD cDNA encoding its first 96 amino acids. A 6-amino acid peptide (SREFTR) was introduced into the junction between Fas and FADD because of the polylinker sequence used for cloning. The Fas-FADD (1–96) transgenic construct consists of the TCR V{alpha}11.1 promoter, Fas-FADD cDNA and the human growth hormone minigene. The TCR{alpha} locus control region (28, 29) with all eight DNase I hypersensitive sites (1–8) was coinjected with the V{alpha}11.1-Fas-FADD cassette into the mouse embryos.

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Characterization of the Fas-FADD chimeras in T cell lines. A, Five different versions of the Fas-FADD chimeric cDNAs (fusion of Fas 1–183 to full-length FADD, 1–96, 19–96, 1–67, or 1–82 of FADD) and the truncated Fas cDNA (Fas{Delta}CT) were transcribed and translated in vitro using standard techniques. Samples were run on a 12% SDS-PAGE gel and were developed using autoradiography. B, The tailless Fas (Fas{Delta}CT) or five different versions of Fas-FADD chimeric constructs were transiently transfected into Jurkat T cells. Cells were treated with or without 0.5 µg/ml anti-Fas (Jo2) for 6 h. Whole cell extracts were made after this incubation time and were subjected to Western blot analysis using anti-PARP Abs. Upon Fas stimulation, PARP cleavage (an indication of apoptosis) was detected in cells transfected with Fas-FADD chimeras containing either a full-length FADD, 1–96 death-effector domain of FADD, or the first 82 amino acids of mouse FADD. The experiments have been repeated several times with similar results. C, Stable transfectants were generated using pHß-APr-neo plasmid expressing the tailless Fas or by cotransfecting the same neomycin-containing plasmid with the Fas-FADD (1–96) cDNA under expression of the cytomegaloviral promoter/enhancer. Constructs were transfected into YAC-1 T cell subclones that were sorted for a lack of Fas cell surface expression by flow cytometry. Two Fas{Delta}CT stable clones (A11 and C2) and three Fas-FADD clones (G3, H3, and D9) were tested for their sensitivity to Fas killing using the TUNEL assay. All five clones express equivalent amount of Fas on the cell surface (data not shown). Upon stimulation with 0.5 µg/ml of anti-Fas (Jo2), the Fas-FADD clones undergo apoptosis, while clones expressing the tailless Fas protein remain viable. As a control, the parental YAC-1 cells, which express very little Fas on the cell surface, remain TUNEL-negative under similar conditions. Open and shaded bars represent duplicate samples.

 
Generation of Fas-FADD transgenic mice

Fas-FADD transgenic mice were generated using the chimeric Fas-FADD 1–96(1–96) cDNA under the control of the TCR{alpha} promoter and locus control region 29 . This locus control region has previously been shown to confer copy number-dependent and integration-independent expression to a transgene in both thymus and spleen 28 . Thus, the Fas-FADD fusion protein should be expressed in both the developing and the mature T cell compartment. The expression pattern was confirmed using Western blot and flow cytometric analyses (Fig. 3Go). Abs for mouse FADD were used to detect expression of the transgenic protein, which runs at a higher m.w. than the endogenous FADD. Transgene expression was detected in both thymocytes and splenocytes of three separate lines (lines 2, 4, and 8). Line 8 has the highest while line 2 has the lowest transgenic expression (Fig. 3GoA). Transgene expression in the peripheral lymphocyte organs is high (Fig. 3GoA and data not shown), as expected for a transgene under the control of the TCR{alpha} locus control region. All the transgenic founders were subsequently mated to MRL-lpr/lpr mice for at least two generations to generate transgenic mice in Fas-deficient background. Cell surface expression of transgenic Fas-FADD fusion protein in thymocytes, splenocytes, and lymph node cells was examined in line 8 lpr/lpr mice (Fig. 3GoB and data not shown). In the thymus, Fas expression was found in the majority of CD4+CD8+ (double positive, DP) and all of CD4+CD8-, CD4-CD8+ (single positive, SP) thymocytes but not in the CD4-CD8- (double negative, DN) population (Fig. 3GoB). Endogenous Fas from lpr/+ mice is expressed in a similar fashion (Fig. 3GoB), as described previously 32 . While expression of the transgenic Fas-FADD is higher than the endogenous Fas in MRL-lpr/+ mice, it is similar to levels of Fas found in the thymocytes of C57BL/6 mice (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Fas-FADD transgenic expression pattern. A, Whole cell extracts were made from thymus and spleen of line 2, line 4, and line 8 Fas-FADD transgenic mice. Western blot analysis was performed using purified rabbit anti-mouse FADD Abs. The transgenic protein (Fas-FADD Tg) runs at a higher m.w. (roughly 46 kDa) than the endogenous FADD, which runs close to the 30-kDa marker. B, Flow cytometric analysis of thymocytes from lpr/lpr, lpr/+, and line 8 Fas-FADD transgenic in lpr/lpr background. Thymocytes from 8-wk-old mice were analyzed using anti-CD4, anti-CD8, and anti-Fas Abs. Fas expression is plotted on the x-axis for each individual thymocyte population (DP: double positive, CD4+CD8+; SP: single positive, CD4+CD8- and CD4-CD8+; DN: CD4-CD8-).

 
Transgenic Fas-FADD does not grossly affect T cell development

Thymocytes of transgenic and nontransgenic littermates were analyzed using various Abs that stain different T cell populations. The total thymocyte cell number for transgenic mice did not vary significantly from that of the nontransgenic counterparts in either lpr/+ or lpr/lpr background (Figs. 4Go and 5A for line 8, similar results were obtained for other lines of transgenic mice). Staining with anti-CD4, CD8, and CD3 did not reveal any abnormalities in transgenic thymocytes. Normal percentages of DP, SP, and DN T cells were found in all the transgenic mice examined, whether they were in lpr/lpr or lpr/+ background (Fig. 4Go). Staining with anti-CD69 activation markers also did not reveal any significant differences between transgenic and nontransgenic thymocytes. When cultured in vitro, transgenic thymocytes did die faster over time as compared with their nontransgenic counterparts (data not shown). However, the number of steady-state transgenic thymocytes in vivo did not significantly differ from that of the wild-type mice (Fig. 5GoA). Thus, expression of the Fas-FADD fusion protein does not grossly affect T cell development.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of transgenic thymocytes and peripheral T cells. Flow cytometric analysis of thymocytes and lymph nodes from nontransgenic lpr/+, nontransgenic lpr/lpr, and line 8 Fas-FADD transgenic mice in lpr/lpr background. Thymocytes or lymph nodes (eight total from the following areas: superficial inguinal, axillary, lateral axillary, and cervical) from 5-wk-old mice were analyzed using anti-CD4 and anti-CD8 Abs. The total cell numbers for organs from each mouse are indicated below. The number in each quadrant corresponds to the percentage of the corresponding population.

 


View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 5. Rescue of T cell abnormality by the Fas-FADD transgene. A, Total cell number of thymocytes, lymph node cells, as well as spleen weight (in grams) of wild-type (lpr/+), Fas-FADD transgenic (line 8) lpr/+,lpr/lpr, and lpr/lpr Fas-FADD transgenic (line 8) mice. Mice were analyzed at 16–17 wk of age. B, Flow cytometric analysis of lymph node cells from lpr/+, lpr/lpr, and lpr/lpr transgenic Fas-FADD (Tg) mice. Abs for B220 and Thy-1 were used for staining. The numbers in each quadrant denote percentages for each cell population. "High" indicates mice from line 8 littermates, which express a high level of transgenic protein in those that are typed transgene positive. "Mid" denotes littermates from line 4 transgenic mice, which express a modest amount of Fas-FADD fusion protein. Mice were analyzed at 16–17 wk of age.

 
Peripheral T cells of 5- to 8-wk-old line 8 transgenic mice were examined. The Fas-FADD transgenic mice contained normal numbers of splenocytes and lymph nodes T cells (Fig. 4Go and data not shown). The percentages of CD4 or CD8 SP T cells were similar to that of their nontransgenic lpr/+ littermates, while the nontransgenic lpr/lpr mice already contained slightly elevated cell numbers (Fig. 4Go). Examination of early activation markers CD69 and Mel14 indicated that the transgenic mice contained a slightly higher number of CD69+ cells and a slightly lower percentage of Mel14+ cells (data not shown). However, the profile of two late T cell activation markers, CD25 and CD44, in these mice are normal (data not shown). These data suggest that the transgenic T cells may be somewhat activated.

Absence of lymphadenopathy, splenomegaly, and Thy-1+B220+ T cell population from MRL-lpr/lpr mice expressing the Fas-FADD protein

Fas deficiency in lpr/lpr mice leads to severe autoimmune problems in both T and B cells. Introduction of wild-type Fas into T cells of lpr/lpr mice was shown to eliminate their T cell abnormality, lymphadenopathy, and splenomegaly but not the B cell autoimmunity 33 . To see if the Fas-FADD fusion protein is functionally equivalent to Fas in vivo, we analyzed a number of aged transgenic mice in the lpr/lpr background. As shown in Fig. 5GoA and Table IGo, while lpr/lpr mice developed lymphadenopathy and enlarged spleens, lpr/lpr mice with high levels of Fas-FADD transgene expression showed normal numbers of lymph node cells and splenocytes. A similar but less dramatic rescue was observed in line 4 mice, which contain a fewer number of cells expressing the transgenic protein (data not shown, see below). Transgenic mice from the line 2 founder, which barely express the Fas-FADD protein, did not have a significant effect on the lpr/lpr phenotype (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Diminished lymphoproliferation in Fas-FADD lpr/lpr transgenic mice1

 
Flow cytometric analysis further supported the notion that the Fas-FADD fusion protein is functionally equivalent to the wild-type Fas receptor in T cells. In addition to lymphadenopathy and splenomegaly, older lpr/lpr mice also develop an unusual T cell population, which is CD4-CD8-CD3+B220+Thy-1+ 34 . This signature T cell population has all but disappeared in the high expressing transgenic line (4% vs 79%; Fig. 5GoB). This population was also greatly reduced in mice that expressed medium levels of Fas-FADD chimeric protein (20% vs 72%; Fig. 5GoB). Thus, expression of the Fas-FADD transgene eliminates the T cell abnormality associated with lpr/lpr mice in a dose-dependent manner.

Normal proliferation of transgenic peripheral T cells in response to mitogens

Previous analysis of FADD-deficient mice indicated that FADD is not only required for Fas apoptosis but is surprisingly also essential for mitogen-induced T cell proliferation 19 . As FADD is normally not associated with Fas, the direct linkage between FADD and Fas in the Fas-FADD chimeric protein may accelerate cell death and affect T cell proliferation. In addition, Fas-FADD peripheral T cells appear somewhat activated (see above). We examined the proliferative capacity of Fas-FADD mature T cells by performing proliferation assays using purified T lymphocytes activated with anti-CD3 and anti-CD28 (Fig. 6Go). Proliferation was detected starting at 24 h poststimulation and was measured up to 48 h after addition of anti-CD3 and anti-CD28. As shown in Fig. 6Go, no substantial differences in T cell proliferation were observed between transgenic lpr/lpr, lpr/lpr, and wild-type (lpr/+) T cells. Consistent with these data, IL-2 production of activated transgenic T cells was not significantly different from that of the wild-type T cells (data not shown). We conclude that the presence of Fas-FADD chimera does not affect proliferative capacity of peripheral T cells.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. Proliferation assay. Proliferative response of lymph node T cells to TCR stimulation. Solid black diamonds indicate wild-type (lpr/+), solid black squares indicate lpr/lpr, and solid gray triangles indicate lpr/lpr transgenic Fas-FADD (line 8) T cells. Purified T cells from 11-wk-old mice were stimulated with immobilized anti-CD3 (500A2) and soluble anti-CD28. Results are presented as incorporated [3H]thymidine counts measured from triplicate cultures over time.

 
B cell abnormality in Fas-FADD lpr/lpr mice

In addition to the T cell dysfunction, Fas deficiency also results in a B cell abnormality as manifested by a high level of serum Abs, development of glomerulonephritis, and the presence of anti-dsDNA Abs 34 . Although there were initial conflicting reports regarding interdependency of B and T cell dysfunction 35, 36, 37, 38, 39 , recent results favored a function for Fas in both T and B cells 33, 40, 41 . Thus, the rescue of T cell abnormality alone would not necessarily lead to resolution of the B cell autoimmunity unless Fas is functional in B cells as well. We examined this issue in the Fas-FADD transgenic mice. Despite the use of TCR locus control region, Western blot analysis showed that the transgenic protein is expressed at a high level in purified transgenic B cell population (Fig. 7GoA). Expression of the chimera is higher than or equivalent to the endogenous FADD and is not too dissimilar from its expression level in total lymph nodes (75–80% T cells). This is further confirmed by flow cytometric analysis (Fig. 7GoB). Wild-type B cells have been shown to express a low level of Fas receptor on their cell surface that is subsequently up-regulated upon B cell activation 42 . In contrast, a majority of the Fas-FADD transgenic IgM+ resting B cells constitutively express the chimeric protein (Fig. 7GoB). Its level is similar to the cell surface expression on the peripheral T cells (Fig. 7GoC).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 7. Fas-FADD expression in B cells by Western blot analysis and FACS analysis. A, Bone marrow cells, splenic B cells (>95% pure B cells purified using anti-Thy1.2/complement lysis), lymph node cells (75–80% T cells), and thymocytes from wild-type and transgenic Fas-FADD lpr/+ were lysed, and Western blot analysis was performed using purified rabbit anti-mouse FADD Abs. "Tg-" denotes cells from a wild-type mouse, and "Tg+" denotes cells from a transgenic Fas-FADD mouse. B, Lymph node cells from 5-wk-old mice were collected, stained for flow cytometry, and gated on IgM+ cells. Fas expression is plotted on the x-axis and overlaid for the following three genotypes: lpr/+ denotes wildtype, lpr/lpr denotes homozygous MRL-lpr, and Tg+ lpr/lpr denotes transgenic Fas-FADD in a homozygous MRL-lpr background. Similar results were obtained from splenic IgM+ cells. C, Lymph node cells from 5-wk-old mice were collected, stained for flow cytometry, and gated on TCR{alpha}ß+ cells. Fas expression is plotted on the x-axis and overlaid for the same three genotypes as in B.

 
The presence of serum Abs and anti-dsDNA Abs was measured using ELISA assays in transgenic and nontransgenic littermates of lpr/+ and lpr/lpr background. As shown in Fig. 8GoA, nontransgenic lpr/lpr mice expressed elevated amounts of serum IgM, IgG1, IgG2a, IgG2b, and IgG3 when compared with their lpr/+ littermates. The levels of serum Abs in the transgenic lpr/lpr mice were reduced, although they were still higher than those found in the wild-type lpr/+ mice. These are particularly obvious for IgG1, IgG2a, IgG2b, and IgG3. Similar results were found for anti-dsDNA Abs (Fig. 8GoB). While lpr/lpr mice expressed elevated amounts of anti-DNA Abs, the transgenic lpr/lpr mice expressed intermediate levels of serum autoantibodies. Thus, in contrast to the T cell compartment, the B cell abnormalities of MRL-lpr/lpr mice are not completely diminished despite a high level of Fas-FADD chimera expression.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 8. Partial rescue of B cell abnormality in Fas-FADD transgenic lpr/lpr mice. A, Serum Ab levels were determined using ELISA assay as described in Materials and Methods. Each circle denotes the serum level of one mouse, and numbers along the y-axis represent units in mg/ml. Gray filled circles indicate the level of antiserum in the lpr/lpr Fas-FADD transgenic mice. B, Serum levels of anti-dsDNA Abs were determined using ELISA assay. Each circle denotes the level (in arbitrary units) of anti-DNA Abs present in the serum of one mouse based on a standard curve supplied by the manufacturer (Hemagen). Gray filled circles denote the level for lpr/lpr Fas-FADD transgenic (Tg) mice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several Fas-associated proteins have been reported in the literature 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 . These proteins were initially identified in a yeast-two hybrid system using the Fas cytoplasmic tail as bait. While many of them have been shown to associate with Fas when over-expressed in mammalian cells, association between the endogenous proteins and Fas has been more difficult to demonstrate. In addition, most of these proteins have yet to demonstrate their involvement in downstream caspase activation. Immunoprecipitation using Fas Abs has revealed several Fas-associated proteins: CAP1, CAP2, CAP3, and CAP4 17 . Both CAP1 and CAP2 were identified as differential phosphorylated forms of FADD (Mort1). CAP4 is the cysteine protease caspase-8 43 . The identity of CAP3 is still not completely clear despite its having identical stretches of peptides to caspase-8 44 . Expression of dominant negative forms of either FADD or caspase-8 can inhibit Fas-mediated apoptosis 9, 22, 43, 45, 46 . Based on these data, a simple model of signal transduction pathway for Fas was proposed 2, 5, 6 . In this model, engagement of Fas receptor by its ligand leads to recruitment of FADD to the membrane through association between death domains. Aggregation of FADD at the membrane, in turn, recruits caspase-8 through the death-effector domain. Subsequent caspase-8 activation by self-cleavage leads to initiation of downstream caspase cascade and cell death 47, 48, 49 . The essential role of FADD was tested recently in vivo in FADD-/- mice. Fas apoptosis is completely blocked in FADD-deficient thymocytes and embryonic fibroblast cells 18, 19 , suggesting that there is no redundant apoptotic pathways emanating from Fas.

While FADD is clearly necessary for Fas apoptosis in cell lines, it is not clear if it is the only Fas-binding protein in vivo and whether it is sufficient to initiate the Fas apoptotic pathway. Over-expression of human FADD in cell lines leads to apoptosis. However, many other proteins can induce a similar response. As immunoprecipitation only detects strongly associated proteins, those that might weakly or transiently associate with Fas could escape detection. To address this issue in an in vivo situation, we generated transgenic mice expressing a Fas-FADD chimeric protein. This protein does not contain any death domain, and most of the cytoplasmic tail of Fas has been deleted. Transient and stable transfection into T cell tumors demonstrated that this protein is functional. In contrast to previous studies in the human system, mere over-expression of Fas-FADD chimera does not kill the cells, as evident by generation of multiple stable lines.

To express this chimeric protein in both the thymus and the peripheral T cell compartment, we used the TCR locus control region to drive transgene expression. Thymi of the Fas-FADD transgenic lpr/lpr mice appear normal overall in both number and distribution of populations. The lack of extensive apoptosis suggests that thymocytes are replenishing and exiting the thymus in a steady-state manner. Expression of this transgene in the periphery of MRL-lpr/lpr mice completely rescues the T cell abnormality of Fas deficiency, suggesting that FADD is sufficient for initiation of Fas function in T cells, and no other Fas cytoplasmic-binding proteins are necessary to initiate the Fas-death pathway in primary T cells. Furthermore, these data also show that the first 96 amino acids of FADD death-effector domain are sufficient for FADD function in vivo and that the cytoplasmic tail of Fas merely serves to recruit FADD to the membrane.

We have also examined the proliferative capacity of mature T cells in Fas-FADD transgenic lpr/lpr mice. Activated mature T cells are initially resistant to Fas-mediated apoptosis, but gain susceptibility upon prolonged activation 50, 51 . One possible hypothesis for this initial resistance to Fas killing is a differential association between FADD and Fas during different stages of T cell activation. During early T cell activation, FADD might fail to associate with Fas, allowing T cells to proliferate normally. If this hypothesis were correct, the Fas-FADD chimera would bypass the requirement for FADD recruitment. T cells expressing the chimeric protein would be killed immediately upon T cell activation. However, we found that peripheral T cells expressing Fas-FADD chimera proliferate normally when stimulated through the TCR complex. Additionally, we did not observe any accelerated cell death during activation (data not shown). These results agree with our unpublished results and recent data from Refaeli et al. 52 , which show an unregulated association of FADD with Fas during different phases of T cell activation. Another protective molecule (i.e., FLICE-inhibitory protein (FLIP)) may be responsible for regulating the susceptibility or resistance of activated T cells to Fas-induced apoptosis 20, 52 .

In contrast to the T cell phenotype, the Fas-FADD transgenic protein did not rescue the lpr B cell abnormalities completely. A moderate level of serum Igs and anti-dsDNA Abs could still be found in these mice. Several previously published reports suggest that the B cell autoimmunity in lpr/lpr mice is completely dependent on the T cell abnormalities 35, 36, 38 . Introduction of the wild-type Fas under the T cell-specific CD2 locus control region in lpr mice was shown to rescue not only the T cell but also the B cell autoimmunity 38 . However, several recent papers argue that Fas plays a crucial role in both B and T cells and suggest that autoreactive B cells die through interaction between Fas and Fas ligand expressed on activated B cells and activated T cells, respectively 33, 40, 41, 42 . Thus, the lymphadenopathy, splenomegaly, and existence of B220+Thy-1+ T cells in Fas-deficient mice can be completely rescued by expression of Fas in T cells, but the prevention of B cell autoimmunity requires Fas expression in B cells as well. It is possible that the CD2 locus control region used to express Fas in the initial study 38 may have permitted some transgene expression in B cells. Further posttranscriptional control may allow protein expression, despite a low mRNA level. This is indeed the case in transgenic mice where Fas is expressed under the control of the lck proximal promoter 33 . Although its mRNA was expressed at a low level in peripheral T cells, Fas cell surface expression was equivalent in comparing thymus and peripheral organs 33 . A similar situation most likely exists for our Fas-FADD transgenic mice. While the TCR{alpha} locus control region is expected to drive T cell-specific transgene expression, high levels of Fas-FADD protein was detected in B cells by Western blot and FACS analyses. Remarkably, B cell autoimmunity persists in these Fas-FADD transgenic mice despite the high level of chimeric protein expression. This is in contrast to the ability of the wild-type Fas to completely clear the autoimmunity of MRL-lpr/lpr mice 33, 38 . While it is possible that the Fas-FADD transgenic expression was still not high enough to completely rescue the lpr B cell phenotype, its high level expression suggests that other Fas-binding proteins may yet operate in the Fas pathway of B cells. This protein may synergize with FADD in vivo or alternatively may contribute to the efficient activation of downstream caspases.

In summary, we have shown that the FADD death-effector domain 1–96(1–96) is sufficient for Fas signaling in T cells. The Fas cytoplasmic tail, including its death domain, is dispensable for Fas function in vivo if its extracellular portion is physically linked to the first 96 amino acids of FADD. Therefore, the Fas cytoplasmic tail merely serves as a protein-protein interaction domain to recruit FADD to the membrane. In lpr/lpr Fas-FADD transgenic mice, the splenomegaly, lymphadenopathy, and autoimmune T cell population have completely disappeared. These data and those from FADD-/- mice 18, 19 , lead us to conclude that FADD is not only essential but also sufficient for the initiation of Fas function in T cells in vivo. However, the inability of Fas-FADD transgenic protein to rescue the B cell autoimmunity of MRL-lpr/lpr mice may imply that the Fas signaling pathway is different between T and B cells.


    Acknowledgments
 
We thank Jianke Zhang, Nancy Hong, and Vikas Kabra for critical reading of this manuscript; S. Nagata for the generous gift of pEFBOS-Fas; Hui-Chen Hsu and J. Mountz for the PCR-typing conditions of lpr/lpr mice; Peter Schow for his expert technical assistance in flow cytometry; and the Keck Foundation for a gift to purchase a flow cytometric machine.


    Footnotes
 
1 This work is supported by the National Institutes of Health Grant CA75162. A.W. is a National Science Foundation Presidential Faculty Fellow. Back

2 Address correspondence and reprint requests to Dr. Astar Winoto, Department of Molecular and Cell Biology, University of California, Berkeley, 469 Life Science Addition, Berkeley, CA 94720-3200. E-mail address: Back

3 Abbreviations used in the paper: FADD, Fas-associated death domain protein; CAP, cytotoxic-dependent Fas-associated protein; PARP, poly (ADP-ribose) polymerase; HRP, horseradish peroxidase; SP, single positive, DP, double positive, DN, double negative, TUNEL, TdT-mediated dUTP-X nick end labeling. Back

Received for publication October 27, 1998. Accepted for publication December 3, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagata, S., P. Golstein. 1995. The Fas death factor. Science 267:1449.[Abstract/Free Full Text]
  2. Nagata, S.. 1997. Apoptosis by death factor. Cell 88:355.[Medline]
  3. Watanabe, F. R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314.[Medline]
  4. Fisher, G. H., F. J. Rosenberg, S. E. Straus, J. K. Dale, L. A. Middleton, A. Y. Lin, W. Strober, M. J. Lenardo, J. M. Puck. 1995. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 81:935.[Medline]
  5. Matiba, B., S. M. Mariani, P. H. Krammer. 1997. The CD95 system and the death of a lymphocyte. Semin. Immunol. 9:59.[Medline]
  6. Chinnaiyan, A. M., V. M. Dixit. 1997. Portrait of an executioner: the molecular mechanism of FAS/APO-1-induced apoptosis. Sem. Immunol. 9:69.[Medline]
  7. Boldin, M. P., E. E. Varfolomeev, Z. Pancer, I. L. Mett, J. H. Camonis, D. Wallach. 1995. A novel protein that interacts with the death domain of fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270:7795.[Abstract/Free Full Text]
  8. Chinnaiyan, A. M., K. O’Rourke, M. Tewari, V. M. Dixit. 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81:505.[Medline]
  9. Zhang, J., A. Winoto. 1996. A mouse Fas-associated protein with homology to the human Mort1/FADD protein is essential for Fas-induced apoptosis. Mol. Cell. Biol. 16:2756.[Abstract]
  10. Stanger, B. Z., P. Leder, T.-H. Lee, E. Kim, B. Seed. 1995. RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death. Cell 81:513.[Medline]
  11. Chu, K., X. Niu, L. T. Williams. 1995. A Fas-associated protein factor, FAF1, potentiates Fas-mediated apoptosis. Proc. Natl. Acad. Sci. USA 92:11894.[Abstract/Free Full Text]
  12. Okura, T., L. Gong, T. Kamitani, T. Wada, I. Okura, C. F. Wei, H. M. Chang, E. T. Yeh. 1996. Protection against Fas/APO-1- and tumor necrosis factor-mediated cell death by a novel protein, sentrin. J. Immunol. 157:4277.[Abstract]
  13. Wright, D. A., B. Futcher, P. Ghosh, R. S. Geha. 1996. Association of human Fas (CD95) with a ubiquitin-conjugating enzyme (UBC-FAP). J. Biol. Chem. 271:31037.[Abstract/Free Full Text]
  14. Yang, X., R. Khosravi-Far, H. Y. Chang, D. Baltimore. 1997. Daxx, a novel Fas-binding protein that activates JNK and apoptosis. Cell 89:1067.[Medline]
  15. Kennedy, N. J., R. C. Budd. 1998. Phosphorylation of FADD/MORT1 and Fas by kinases that associate with the membrane-proximal cytoplasmic domain of Fas. J. Immunol. 160:4881.[Abstract/Free Full Text]
  16. Sato, T., S. Irie, S. Kitada, J. C. Reed. 1995. FAP-1: a protein tyrosine phosphatase that associates with Fas. Science 268:411.[Abstract/Free Full Text]
  17. Kischkel, F. C., S. Hellbardt, I. Behrmann, M. Germer, M. Pawlita, P. H. Krammer, M. E. Peter. 1995. Cytotoxicity-dependent APO-1 (Fas/CD95) associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J. 14:5579.[Medline]
  18. Yeh, W.-C., J. L. Pompa, M. E. McCurrach, H.-B. Shu, A. J. Elia, A. Shahinian, M. Ng, A. Wakeham, W. Khoo, K. Mitchell, et al 1998. FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science 279:1954.[Abstract/Free Full Text]
  19. Zhang, J., D. Cado, A. Chen, N. H. Kabra, A. Winoto. 1998. Absence of Fas-mediated apoptosis and T cell receptor-induced proliferation in FADD-deficient mice. Nature 392:296.[Medline]
  20. Irmler, M., M. Thome, M. Hahne, P. Schneider, K. Hofmann, V. Steiner, J.-L. Bodmer, M. Schroter, K. Burns, C. Mattmann, et al 1997. Inhibition of death receptor signals by cellular FLIP. Nature 388:190.[Medline]
  21. Watanabe, F. R., C. I. Brannan, N. Itoh, S. Yonehara, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. The cDNA structure, expression, and chromosomal assignment of the mouse Fas antigen. J. Immunol. 148:1274.[Abstract]
  22. Hsu, H., H.-B. Shu, M.-G. Pan, D. V. Goeddel. 1996. TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 84:299.[Medline]
  23. Matthias, P., M. M. Muller, E. Schreiber, S. Rusconi, W. Schaffner. 1989. Eukaryotic expression vectors for the analysis of mutant proteins. Nucleic Acids Res. 17:6418.[Free Full Text]
  24. Gunning, P., J. Leavitt, G. Muscat, S. Y. Ng, L. Kedes. 1987. A human ß-actin expression vector system directs high-level accumulation of antisense transcripts. Proc. Natl. Acad. Sci. USA 84:4831.[Abstract/Free Full Text]
  25. Chaffin, K. E., C. R. Beals, T. M. Wilkie, K. A. Forbush, M. I. Simon, R. M. Perlmutter. 1990. Dissection of thymocyte signaling pathways by in vivo expression of pertussis toxin ADP-ribosyltransferase. EMBO J. 9:3821.[Medline]
  26. Allen, J. M., K. A. Forbush, R. M. Perlmutter. 1992. Functional dissection of the lck proximal promoter. Mol. Cell. Biol. 12:2758.[Abstract/Free Full Text]
  27. Kingsley, C., A. Winoto. 1992. Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol. Cell. Biol. 12:4251.[Abstract/Free Full Text]
  28. Ortiz, B. D., D. Cado, V. Chen, P. W. Diaz, A. Winoto. 1997. Adjacent DNA elements dominantly restrict the ubiquitous activity of a novel chromatin-opening region to specific tissues. EMBO J. 16:5037.[Medline]
  29. Diaz, P., D. Cado, A. Winoto. 1994. A locus control region in the T cell receptor {alpha}/{delta} locus. Immunity 1:207.[Medline]
  30. Gavrieli, Y., Y. Sherman, S. A. Ben-Sasson. 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119:493.[Abstract/Free Full Text]
  31. Lazebnik, Y. A., S. H. Kaufmann, S. Desnoyers, G. G. Poirier, W. C. Earnshaw. 1994. Cleavage of poly (ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371:346.[Medline]
  32. Ogasawara, J., T. Suda, S. Nagata. 1995. Selective apoptosis of CD4+CD8+ thymocytes by the anti-fas antibody. J. Exp. Med. 181:485.[Abstract/Free Full Text]
  33. Fukuyama, H., M. Adachi, S. Suematsu, K. Miwa, T. Suda, N. Yoshida, S. Nagata. 1998. Transgenic expression of Fas in T cells blocks lymphoproliferation but not autoimmune disease in MRL-lpr mice. J. Immunol. 160:3805.[Abstract/Free Full Text]
  34. Cohen, P. L., R. A. Eisenberg. 1991. Lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu. Rev. Immunol. 9:243.[Medline]
  35. Christianson, G. J., R. L. Blankenburg, T. M. Duffy, D. Panka, J. B. Roths, A. Marshak-Rothstein, D. C. Roopenian. 1996. ß2-microglobulin dependence of the lupus-like autoimmune syndrome of MRL-lpr mice. J. Immunol. 156:4932.[Abstract]
  36. Perkins, D. L., J. A. Listman, A. Marshak-Rothstein, W. Kozlow, V. R. Kelley, P. W. Finn, I. J. Rimm. 1996. Restriction of the TCR repertoire inhibits the development of memory T cells and prevents autoimmunity in lpr mice. J. Immunol. 156:4961.[Abstract]
  37. Ohteki, T., M. Iwamoto, S. Izui, H. R. MacDonald. 1995. Reduced development of CD4-8-B220+ T cells but normal autoantibody production in lpr/lpr mice lacking major histocompatibility complex class I molecules. Eur. J. Immunol. 25:37.[Medline]
  38. Wu, J., T. Zhou, J. Zhang, J. He, W. C. Gause, J. D. Mountz. 1994. Correction of accelerated autoimmune disease by early replacement of the mutated lpr gene with the normal Fas apoptosis gene in the T cells of transgenic MRL-lpr/lpr mice. Proc. Natl. Acad. Sci. USA 91:2344.[Abstract/Free Full Text]
  39. Yui, K., A. Bhandoola, M. Z. Radic, S. Komori, M. Katsumata, M. I. Greene. 1992. Inhibition of abnormal T cell development and autoimmunity in gld mice by transgenic T cell receptor ß chain. Eur. J. Immunol. 22:1693.[Medline]
  40. Chan, F. K.-M., A. Chen, A. Winoto. 1998. Thymic expression of the transcription factor Nur77 rescues the T cell but not the B cell abnormality of gld/gld mice. J. Immunol. 161:4252.[Abstract/Free Full Text]
  41. Rathmell, J. C., S. E. Townsend, J. C. Xu, R. A. Flavell, C. C. Goodnow. 1996. Expansion or elimination of B cells in vivo: dual roles for CD40- and fas (CD95)- ligands modulated by the B cell antigen receptor. Cell 87:319.[Medline]
  42. Rothstein, T. L., J. K. Wang, D. J. Panka, L. C. Foote, Z. Wang, B. Stanger, H. Cui, S. T. Ju, A. Marshak-Rothstein. 1995. Protection against Fas-dependent Th1-mediated apoptosis by antigen receptor engagement in B cells. Nature 374:163.[Medline]
  43. Muzio, M., A. M. Chinnaiyan, F. C. Kischkel, K. O’Rourke, A. Shevchenko, J. Ni, C. Scaffidi, J. D. Bretz, M. Zhang, R. Gentz, et al 1996. FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85:817.[Medline]
  44. Thome, M., P. Schneider, K. Hofmann, H. Fickenscher, E. Meinl, F. Neipel, C. Mattmann, K. Burns, J.-L. Bodmer, M. Schroter, et al 1997. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 386:517.[Medline]
  45. Boldin, M. P., T. M. Goncharov, Y. V. Goltsev, D. Wallach. 1996. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1-and TNF receptor-induced cell death. Cell 85:803.[Medline]
  46. Chinnaiyan, A. M., C. G. Tepper, M. F. Seldin, K. O’Rourke, F. C. Kischkel, S. Hellbardt, P. H. Krammer, M. E. Peter, V. M. Dixit. 1996. FADD/MORT1 is a common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis. J. Biol. Chem. 271:4961.[Abstract/Free Full Text]
  47. Yang, X. L., H. Y. Chang, D. Baltimore. 1998. Autoproteolytic activation of pro-caspases by oligomerization. Mol. Cell 1:319.[Medline]
  48. Martin, D. A., R. M. Siegel, L. X. Zheng, M. J. Lenardo. 1998. Membrane oligomerization and cleavage activates the caspase-8 (FLICE/MACH {alpha} 1) death signal. J. Biol. Chem. 273:4345.[Abstract/Free Full Text]
  49. Muzio, M., B. R. Stockwell, H. R. Stennicke, G. S. Salvesen, V. M. Dixit. 1998. An induced proximity model for caspase-8 activation. J. Biol. Chem. 273:2926.[Abstract/Free Full Text]
  50. Suda, T., M. Tanaka, K. Miwa, S. Nagata. 1996. Apoptosis of mouse naive T cells induced by recombinant soluble Fas ligand and activation-induced resistance to Fas ligand. J. Immunol. 157:3918.[Abstract]
  51. Klas, C., K. M. Debatin, R. R. Jonker, P. H. Krammer. 1993. Activation interferes with the APO-1 pathway in mature human T cells. Int. Immunol. 5:625.[Abstract/Free Full Text]
  52. Refaeli, Y., L. V. Parijs, C. A. London, J. Tschopp, A. K. Abbas. 1998. Biochemical mechanisms of IL-2-regulated Fas-mediated T cell apoptosis. Immunity 8:615.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
F. Harrow and B. D. Ortiz
The TCR{alpha} Locus Control Region Specifies Thymic, But Not Peripheral, Patterns of TCR{alpha} Gene Expression
J. Immunol., November 15, 2005; 175(10): 6659 - 6667.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. P. Quinn, S. J. Soifer, K. Ramer, L. T. Williams, and M. C. Nakamura
A Receptor for Vascular Endothelial Growth Factor That Stimulates Endothelial Apoptosis
Cancer Res., December 1, 2001; 61(24): 8629 - 8637.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
J. ZHANG, A. DEYOUNG, H.G. KASLER, N.H. KABRA, A.A. KUANG, G. DIEHL, S.J. SOHN, C. BISHOP, and A. WINOTO
Receptor-mediated Apoptosis in T Lymphocytes
Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 363 - 372.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kabra, N. H.
Right arrow Articles by Winoto, A.
Right arrow Search for Related Content