| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Pathology and Program in Immunology and Molecular Pathogenesis, Emory University, Atlanta, GA 30322
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we demonstrate that IL-4 signaling in mast cells results in the activation of a novel STAT6 isoform. Several features of the mast cell STAT/DNA complex distinguish it from conventional STAT6, including its 65-kDa size and lack of reactivity with a C-terminal anti-STAT6 Ab. Despite the coexpression of conventional STAT6 in mast cells, it is the smaller isoform that is preferentially activated in an IL-4-dependent manner and that binds to a consensus STAT6 site within the IL-4 promoter. These results imply that an additional level of specificity in the IL-4R signaling mechanism exists and may partially explain the diverse effects that IL-4 exerts on different cell types.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CFTL-15 (a murine IL-3-dependent mast cell line (C15) 7), M12.4.1 cells (a transformed B cell line 8), and DO11.10 cells (OVA-specific T cells 9) were cultured in cRPMI (10% heat-inactivated FBS, 0.5% penicillin/streptomycin, 2 mM glutamine, 1 mM sodium pyruvate, 50 µM 2-ME). C15 culture media also contained 25% WEHI-3B supernatant as a source of IL-3, a crucial growth factor for mast cells 10 . DO11.10 cells were stimulated with BALB/c spleen cells, IL-2 (104 U/ml), and OVA323–339 peptide (0.5 µM) every 7 to 10 days. Bone marrow-derived mast cells (BMMC) were harvested from BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) and STAT6-/- BALB/c mice 11 and differentiated with 25% WEHI-3B supernatant. Cultures from STAT6-/- mice grew normally, despite previous evidence that IL-4 is a mast cell growth factor 12 . Recent studies in our lab have demonstrated that STAT6-/- BMMC make normal levels of IL-4 44 . BMMC were used after 4 wk in culture at 90% purity, as determined by FACS analysis (FACScan; Becton Dickinson, Mountain View, CA). To induce STAT6 activation, cells were stimulated with rIL-4 (a kind gift of W. E. Paul, National Institutes of Health) at 10,000 U/ml.
Antibodies
Supershift analyses and Western blot analyses were performed
with rabbit polyclonal anti-STAT6 Abs raised against the C-terminal
domain (M20x; Santa Cruz Biotechnology, Santa Cruz, CA) or the DNA
binding domain (M200x; Santa Cruz Biotechnology) of murine STAT6;
rabbit polyclonal anti-STAT5A antisera (L-20; Santa Cruz
Biotechnology); or rabbit polyclonal anti-NF-
B p50 (NLS;
Santa Cruz Biotechnology).
Whole cell extract preparation and EMSAs
C15 and BMMC whole cell extracts were prepared in the presence of high concentrations of protease inhibitors (Sigma, St. Louis, MO), according to the published protocol 13 . Briefly, after treatment with IL-4 (15 min at RT), cells were pelleted, washed in PBS, resuspended in lysis buffer (50 mM Tris (pH 8), 0.5% Nonidet P-40, 200 mM NaCl, 10% glycerol, 0.1 mM EDTA, 1 mM DTT, 100 µM sodium orthovanadate, and protease inhibitors), and incubated for 60 min on ice. Following high speed centrifugation at 4°C, supernatants were collected and protein concentration was determined by the Bradford procedure 14 (Bio-Rad, Hercules, CA).
EMSA binding reactions were conducted with 5 µg extract in binding
buffer (40 mM KCl, 1 mM MgCl2, 0.1 mM EGTA, 20 mM HEPES (pH
7.9), 20% Ficoll, 0.5 mM DTT), 0.1 mg/ml poly(dI-dC), 1 mg/ml BSA, and
1 ng 32P-labeled probe. Oligonucleotide probes (synthesized
by Life Technologies, Gaithersburg, MD) include: IL-4 promoter,
TGATTTCACAGGAAAATT; ß-casein promoter,
AGATTTCTAGGAATTCAAATC; and C
promoter,
GATCTAACTTCCCAAGAACAG. Supershift assays were performed
with 1 µg antisera. The resulting DNA-protein complexes were resolved
on a prerun (60 min at 200 V) native, 4.5% polyacrylamide gel at 200 V
for 90 min and detected by autoradiography. In the phosphopeptide
inhibition studies, phosphopeptides were added to the binding reaction
in indicated concentrations before addition of probe. The
phosphopeptides used corresponded to the STAT6 docking sites of the
murine IL-4R
(RPSGDPGYKAFSSLL) and human IL-4R
(GPPGEAGYKAFSSLL). The STAT docking site
(TSFGYDKPH) from the murine IFN-
receptor was used as a
negative control.
Western blot analyses
Cell extracts (20 µg) were electrophoresed on a 10% SDS-PAGE gel and transferred to nylon membrane. The blot was blocked in 5% milk/TBST (10 mM Tris (pH 8), 150 mM NaCl, 0.5% Tween) overnight at 4°C. Abs (1 µg/ml) were added in 2% milk/TBST and incubated 1 h at RT. Horseradish peroxidase-conjugated donkey anti-rabbit secondary Abs (Amersham, Arlington Heights, IL) were added at a 1/5000 dilution in 2% milk/TBST and incubated 1 h at RT. Reactive proteins were visualized by enhanced chemoluminescence (DuPont NEN, Boston, MA) and radiography.
Oligonucleotide affinity purification
Binding reactions were conducted with 1 mg cell extract in 1 ml EMSA binding buffer with 0.2 µg/ml poly(dI:dC) (Pharmacia Biotech, Piscataway, NJ), a biotinylated form of the oligonuculeotides used in EMSA reactions (200 ng, biotinylated at the 5' end during synthesis on one strand only), and 40 µl of streptavidin agarose (Sigma). The mixture was incubated on a rocker plate for 4 h at 4°C. Beads were pelleted, washed three times with wash buffer (40 mM KCl, 1 mM MgCl2, 20 mM HEPES (pH 7.9)), resuspended in 20 µl of SDS sample buffer, and heated at 95°C for 5 min. Supernatants were loaded onto a 10% SDS-PAGE minigel (Bio-Rad). Immunoblotting was performed as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
While examining the influence of IL-4 on its own transcription in
mast cells, we observed that the IL-4-induced DNA-protein complexes
formed with mast cell extracts migrate at a faster mobility when
compared with control B cell STAT6 complexes.4 To further
examine the nature of these DNA-protein interactions, EMSA analysis was
performed with a probe corresponding to the STAT6 binding site from the
IL-4 promoter 15 and extracts from IL-4-stimulated mast cells, B
cells, and T cells. Some reactions were conducted in the presence of an
anti-STAT6 supershift reagent. As shown in Fig. 1
, Abs to the C-terminal region of murine
STAT6, but not the control antisera, react with both the B and T cell
IL-4-induced STAT complexes. However, the mast cell complex is only
minimally affected. These results demonstrate that IL-4 activates a
protein(s) in mast cells that can specifically bind to a STAT6 site and
that is antigenically distinct from the previously defined IL-4-induced
STAT found in other cell types.
|
Several possibilities exist to explain the nature of the
IL-4-induced STAT complex in mast cells. The complex could be composed
of a new STAT family member or an isoform of STAT6. Alternatively,
STAT6 could form a heterodimer with another STAT family member, and
this association could mask the antigenic determinants recognized by
STAT6 antisera. In fact, it was demonstrated recently that stimulation
of B cells through their Ag receptor induces the formation of a
-activation sequence (GAS) complex of unique mobility 16 . Oligo
affinity purification experiments established that both STAT6 and STAT5
bind to this GAS element, implying these STATs interact as
heterodimers. Because in vitro mast cell cultures require IL-3 for
long-term growth, we examined the possible involvement of IL-3-induced
STAT5 in the mast cell complex. We first verified that mast cells
cultured in IL-3 contain activated STAT5 that binds to a consensus GAS
element. The IL-3-dependent complex was supershifted by Abs specific
for both STAT5A and STAT5B (Fig. 2A, lanes 4 and
5), but not STAT6 (lane 3). These Abs do
not react with the IL-4-induced STAT complex (lanes
8, 9, and 10). IL-4-induced STAT complexes
from C15 mast cells that were grown under standard conditions were then
compared with those starved from IL-3 for 24 h before IL-4
stimulation. As shown in Fig. 2B, the removal of IL-3 from
the mast cell culture does not affect the complex. Taken together,
these results indicate that the mast cell IL-4-dependent STAT complex
does not contain STAT5. In addition, Abs specific for STAT1, STAT2,
STAT3, and STAT4 fail to react with the protein-DNA complex (data not
shown), suggesting that the IL-4-induced mast cell complex does not
contain other defined STAT family members.
|
phosphopeptides
To determine whether the mast cell IL-4-induced STAT is related to
conventional STAT6, we used a phosphopeptide inhibition assay described
by Hou et al. 17 . This assay utilizes phosphorylated forms of
peptides derived from the STAT6 docking sites of the IL-4R subunit
to inhibit STAT6 complex formation in vitro. Extracts from untreated
and IL-4-treated C15 mast cells were incubated under standard EMSA
binding conditions with the STAT6 DNA probe in the presence of
increasing concentrations of phosphopeptides derived from the murine
and human IL-4R or murine IFN- receptor. Extracts from M12 B
cells were included as a positive control. As shown in Fig. 3, both the human and mouse IL-4R
phosphopeptides, but not IFN- receptor phosphopeptides, inhibit the
formation of mast cell and B cell complexes. Thus, IL-4-induced STAT in
mast cells can associate with the same receptor docking site as
conventional STAT6, supporting the idea that a STAT6 isoform, rather
than a novel STAT protein, is involved in mast cell signaling by IL-4.
|
If an isoform of STAT6 (as opposed to a novel STAT) mediates IL-4
signaling in mast cells, DNA-STAT protein complexes should be absent in
IL-4-stimulated mast cells from STAT6-deficient mice. To test this
prediction, EMSA analysis was performed using extracts from
IL-4-stimulated STAT6-/- BMMC. IL-4-inducible complexes
are not observed with these extracts (Fig. 4A), confirming that IL-4
signaling pathways in mast cells are dependent on an intact STAT6 gene.
The extracts were also shown to contain STAT5 binding activity in
similar assays using a ß-casein promoter GAS site as a control for
extract integrity (Fig. 4B).
|
To examine STAT6 protein expression in mast cells, Western blot
analysis was performed using Abs that recognize two distinct domains of
the STAT6 protein. As shown in Fig. 5,
M12 B cells and DO11.10 T cells express a single protein of 
94 kDa
that is recognized by Abs specific for both the C-terminal and DNA
binding domain of STAT6. In contrast, C15 and BMMC express the 94-kDa
form as well as smaller forms between 90 and 65 kDa that are
recognized only by antisera specific for the DNA binding domain. These
mast cell-specific forms are significantly smaller than the three known
naturally occurring human STAT6 isoforms described previously 6, 18, 19 . BMMC from STAT6-/- mice do not express these
proteins (data not shown), suggesting that they are products of the
STAT6 gene.
|
) and STAT5B (data not shown) as well as conventional
STAT6 (Fig. 5) are intact in these extracts. In addition, omitting the
high concentrations of protease inhibitors from the lysis buffer during
extract preparation causes no change in EMSA complexes following IL-4
stimulation (data not shown). Mixing experiments were also conducted to
determine whether proteases present in mast cell extracts could affect
the integrity of the B cell STAT6 complex. As shown in Fig. 6, coincubation of mast cell and B cell
extracts does not affect the ability of the B cell complex to be
recognized and supershifted by the C-terminal specific Ab
(lane 7). Based on these results, we conclude that it
is unlikely that the mast cell 65-kDa STAT6 protein results
from nonspecific proteolysis, but rather represents a
cell-specific isoform.
|
The EMSA results imply that a unique STAT6 isoform binds DNA in
mast cells, yet these cells contain conventional STAT6 (Fig. 5) in
addition to the smaller forms. To directly determine which isoform is
present in the IL-4-dependent mast cell complexes, DNA binding factors
were isolated by oligonucleotide affinity purification. A biotinylated
STAT6 probe from the IL-4 promoter was used in large scale EMSA binding
reactions with extracts from IL-4-treated mast cells and B cells.
Western blot analysis of the purified proteins indicates that it is the
65-kDa mast cell protein that preferentially associates with this
element in mast cells. Although the full-length form of STAT6 is
present in mast cells, it does not interact significantly with the
STAT6 binding element (Fig. 7). These
data suggest that the smaller form is functional and that it is
preferentially activated in response to IL-4 signaling. Parallel
experiments performed with a STAT6 site derived from the C gene, a
known target of STAT6 in B cells 8, 21, 22, 23 , yielded identical results
(data not shown), demonstrating that the preferential binding of the
STAT6 isoform is cell type specific rather than gene specific.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-4 induces a variety of biologic responses in multiple cell types,
and the preferential activation of isoforms may explain the
cell-specific activation of appropriate gene targets induced by IL-4.
For example, IL-4 induces Ig isotype switching and class II MHC
expression in B cells 23, 24, 25 and Th2 cytokine expression by T cells
26, 27 . In mast cells, IL-4 induces FcR1 expression 28, 29 ,
cytokine production 12 , and proliferation 30 . Cell type-specific
activation of STAT isoforms may represent a common mechanism of
selective signaling needed for the diverse effects a cytokine can exert
on different cell types. In support of this scenario, Azam et al. and
Rosen et al. demonstrate that preferential activation of STAT5 isoforms
in distinct cell populations may account for the different phenotypic
responses induced by STAT5 activation 31, 32 .
The mechanism of selective STAT activation is unknown. Based on the
currently accepted model for activation of STAT binding, we predict
that the 65-kDa STAT6 isoform is preferentially phosphorylated and thus
can dimerize and associate with its target DNA sites. How this is
accomplished is unclear. One isoform may become activated due to a
stronger interaction with the IL-4R or JAK kinase. Alternatively, there
are several potential phosphorylation sites on the STAT6 molecule 17, 18 , and it is possible that mast cell-specific kinases mediate
selective phosphorylation. Because our assay of activation in these
experiments is binding activity, we cannot rule out the possibility
that both forms are phosphorylated, but it is the truncated form that
exhibits preferential binding to target sites. If so, selective binding
must be sequence dependent. Flanking sequences surrounding the STAT
binding site may interact with accessory proteins that, in turn,
recruit specific STAT isoforms. In fact, it has been shown that
flanking sequences can alter the ability of a transcription factor to
bind DNA even when the consensus sequence remains unchanged 33, 34, 35 .
Experiments are currently underway to distinguish between these
alternatives. However, the observation that IL-4-induced binding of the
STAT6 isoform to two STAT6 sites (from the IL-4 promoter and the C
gene) with distinct flanking sequences is indistinguishable argues
against a role for flanking sequences in selective binding in our
system.
The identification of this unique STAT6 protein adds to the
growing list of STAT family isoforms having both positive and negative
effects on transcriptional activation 5, 6, 18, 31, 36, 37 . Based on
the lack of reactivity with C-terminal specific Abs and its
significantly smaller size, we predict that this isoform lacks the
C-terminal domain that encodes the transactivation domain of STAT6
13 . There are several potential consequences of such a truncation.
The 65-kDa isoform may be able to bind DNA, but unable to activate
transcription, acting as a repressor by competing with full-length
STAT6 in a manner akin to STAT1ß 38 and STAT3ß 5 . In fact, it
has been observed recently that STAT6-/- mice have an
increase in mucosal mastocytosis 39 , implying that STAT6 may play a
role in down-regulating mast cell growth. The isoform may use an
alternative transactivation domain that interacts with the basal
transcriptional machinery through a different set of TATA binding
protein-associated factors or other accessory factors. The truncated
isoform may also associate with other transcription factors to enhance
or repress transcription in a manner distinct from the full-length
form. Consistent with this possibility, previous studies have shown
that STAT6 can interact with NF-B family members with both positive
and negative effects on transcription 22, 40, 41, 42, 43 . A determination of
the sequence of the 65-kDa isoform and its protein interaction partners
will lead to the elucidation of the specific role of this new STAT6
protein in mast cell transcriptional activation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 M.A.S. and V.H.S. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Melissa A. Brown, Department of Experimental Pathology, Emory University School of Medicine, WMB 7311, 1639 Pierce Drive, Atlanta, GA 30322. E-mail address:
4 Abbreviations used in this paper: JAK, Janus kinase; BMMC, bone marrow-derived mast cell; EMSA, electrophoretic mobility shift assay; GAS, -activation sequence; RT, room temperature.
Received for publication September 23, 1998. Accepted for publication November 23, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
interferon and interferon requires transcriptionally active Stat 1 protein. J. Virol. 70:647.[Abstract]
activation site. J. Immunol. 157:39.[Abstract]
promoter: regulation by NF-IL-4, a C/EBP family member and NF-B/p50. J. Exp. Med. 181:181. activation site-like sequence upstream of the I exon in a human B cell line. J. Clin. Invest. 96:907.
transcripts in B lymphoid cells. J. Exp. Med. 168:2385.R1) on human mast cells by IL-4. Int. Immunol. 8:1367.B response element are necessary for tumor necrosis factor -induced gene expression. J. Biol. Chem. 272:15928. and STAT3ß. Mol. Cell. Biol. 17:5307.[Abstract]
. Science 261:1744., and STAT6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity 8:255.[Medline]
B/rel in the IL-4-induced up-regulation of the human IgE germline promoter. J. Immunol. 159:3330.[Abstract]
-stimulated E-selectin gene transcription is mediated by STAT6 antagonism of NF-B. J. Biol. Chem. 272:10212. germline transcripts in B cells via activation of NF-B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18:3395.This article has been cited by other articles:
|
|
 |
|
  Y. Huang, J. Qiu, S. Dong, M. S. Redell, V. Poli, M. A. Mancini, and D. J. Tweardy Stat3 Isoforms, {alpha} and , Demonstrate Distinct Intracellular Dynamics with Prolonged Nuclear Retention of Stat3 Mapping to Its Unique C-terminal End J. Biol. Chem., November 30, 2007; 282(48): 34958 - 34967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Nagarkatti, C. B-Rao, V. Vijayan, S. K. Sharma, and B. Ghosh Signal Transducer and Activator of Transcription 6 Haplotypes and Asthma in the Indian Population Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 317 - 321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Bulanova, V. Budagian, Z. Orinska, H. Krause, R. Paus, and S. Bulfone-Paus Mast Cells Express Novel Functional IL-15 Receptor {alpha} Isoforms J. Immunol., May 15, 2003; 170(10): 5045 - 5055. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Sherman, D. R. Powell, and M. A. Brown IL-4 Induces the Proteolytic Processing of Mast Cell STAT6 J. Immunol., October 1, 2002; 169(7): 3811 - 3818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Suzuki, H. Nakajima, S.-i. Kagami, A. Suto, K. Ikeda, K. Hirose, T. Hiwasa, K. Takeda, Y. Saito, S. Akira, et al. Proteolytic Processing of Stat6 Signaling in Mast Cells as a Negative Regulatory Mechanism J. Exp. Med., July 1, 2002; 196(1): 27 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Malaviya and F. M. Uckun Role of STAT6 in IgE Receptor/Fc{varepsilon}RI-Mediated Late Phase Allergic Responses of Mast Cells J. Immunol., January 1, 2002; 168(1): 421 - 426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Hural, M. Kwan, G. Henkel, M. B. Hock, and M. A. Brown An Intron Transcriptional Enhancer Element Regulates IL-4 Gene Locus Accessibility in Mast Cells J. Immunol., September 15, 2000; 165(6): 3239 - 3249. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Suzuki, H. Nakajima, N. Watanabe, S.-i. Kagami, A. Suto, Y. Saito, T. Saito, and I. Iwamoto Role of common cytokine receptor gamma chain (gamma c)- and Jak3-dependent signaling in the proliferation and survival of murine mast cells Blood, September 15, 2000; 96(6): 2172 - 2180. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. M. Ceponis, F. Botelho, C. D. Richards, and D. M. McKay Interleukins 4 and 13 Increase Intestinal Epithelial Permeability by a Phosphatidylinositol 3-Kinase Pathway. LACK OF EVIDENCE FOR STAT 6 INVOLVEMENT J. Biol. Chem., September 8, 2000; 275(37): 29132 - 29137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Masuda, T. Matsuguchi, K. Yamaki, T. Hayakawa, M. Kubo, W. J. LaRochelle, and Y. Yoshikai Interleukin-15 Induces Rapid Tyrosine Phosphorylation of STAT6 and the Expression of Interleukin-4 in Mouse Mast Cells J. Biol. Chem., September 15, 2000; 275(38): 29331 - 29337. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
