|
|
||||||||


*
Immunology Program, Cornell University Graduate School of Medical Sciences, and Department of Medicine, Division of Immunology, Cornell University Medical College, New York, NY 10021;
Laboratory of Allergic Diseases, National Institute of Allergy and Infectious Diseases/National Institutes of Health, Rockville MD 20852; and
Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases/National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
and Gq
proteins present in T
cells, and inhibits Gi- and Gq-mediated
signaling pathways. By comparison, the mitogen-induced RGS2 inhibits
Gq but not Gi signaling. Moreover, the two RGS
genes exhibit marked differences in expression patterns. The
IL-2-induced expression of the RGS16 gene in T cells is suppressed by
elevated cAMP, whereas the RGS2 gene shows a reciprocal pattern of
regulation by these stimuli. Because the mitogen and cytokine receptors
that trigger expression of RGS2 and RGS16 in T cells do not activate
heterotrimeric G proteins, these RGS proteins and the G proteins that
they regulate may play a heretofore unrecognized role in T cell
functional responses to Ag and cytokine
activation. | Introduction |
|---|
|
|
|---|
, ß, and
subunits couple with members of a family of receptor molecules that
have seven transmembrane-spanning segments and are termed G
protein-coupled receptors
(GPCRs)4. Thus far, the GPCRs
expressed on lymphocytes and their respective G proteins have not been
found to play major roles in lymphocyte activation, which is regulated
by Ag receptors and cytokine receptors, neither of which couple with G
proteins. However, several lines of evidence suggest that both TCR-, as
well as IL-2R-driven events may be intertwined with heterotrimeric G
proteins and their signaling pathways. For example, both cytokine
production and T cell proliferation are inhibited by PGE1
and PGE2 1 . These mediators are produced by activated
macrophages during immune responses and elicit their effects through
specific GPCRs. In addition, T cells from Gi
2 knockout
mice show a marked increase in TCR-induced production of IL-2, TNF, and
IFN-
relative to wild-type controls, and TCR-induced proliferation
is increased in the Gi
2 knockout mice 2 , indicating
that heterotrimeric G proteins may well function to modulate both TCR-
and IL-2R-stimulated signaling pathways.
Recently, a possible mechanism whereby Ag or cytokine receptor
signaling might interface with heterotrimeric G proteins was suggested
by the discovery and characterization of a new family of molecules
termed regulators of G protein signaling (RGS; reviewed in 3 . RGS
proteins inhibit heterotrimeric G protein-mediated signaling by
accelerating the rate of GTP hydrolysis by the G
subunits 4 . Thus, these RGS proteins are GTPase-activating proteins
(GAPs) that are specific for the heterotrimeric G proteins and function
in a fashion similar to the GAPs that are well known to regulate the
smaller monomeric G proteins such as p21ras.
Heterotrimeric G protein complexes are activated upon GTP binding to
the G
subunit, with dissociation of the
G
-GTP from Gß
. The intrinsic GTPase
activity of G
drives GTP hydrolysis to GDP and
G
-GDP reassociation with Gß
. Thus, like
the monomeric G protein GAPs, RGS-GAP activity favors accumulation of
the G
subunits in a GDP-bound inactive state, promoting
the reassociation of G
with Gß
subunits, thereby attenuating both the G
and
Gß
effector pathways. There are four families of
G
subunits, Gi, Gq,
Gs, and G12; the Gi and
Gq appear to be the primary targets of RGS proteins 3 .
To date, >20 members of the RGS family have been described 3, 5, 6 . Notably, two of the first mammalian RGS genes identified, RGS1 (BL34/IR20) and RGS2 (G0S8), were isolated by virtue of their mitogen-induced expression in lymphocytes 7, 8, 9 . RGS1 expression is induced in B cells by phorbol ester, staphylococcal protein A, surface Ig, and by IL-4, cAMP, or platelet-activating factors as well 5, 7, 10 . In comparison, the expression of the RGS2 gene that was originally termed G0 switch gene 8 is induced upon Con A stimulation of the G0-G1 transition in T cells 9, 11 . Con A has been shown to bind the TCR/CD3 complex 12, 13, 14 and the T cell mitogenic response to Con A is blocked by Fab of an anti-CD3 mAb 12 . Thus, it is likely that the induction of RGS2 expression is mediated at least in part through the TCR/CD3 complex, although the involvement of additional accessory signals cannot be ruled out. Therefore, stimuli that induce RGS gene expression, such as Ags, mitogens, and cytokines, and stimuli which activate heterotrimeric G proteins (e.g., PG and chemokines) may modulate one another via RGS proteins.
Previously, we described the isolation of IL-2-induced immediate/early
genes from human T cells 15 . We report here the characterization of
the cytokine responsive gene 1 (CR1), which is a member of the RGS
family. This gene was also cloned by Buckbinder et al. 16 and
has been designated RGS16 17 . The RGS16 gene exhibits a broad pattern
of constitutive expression in every tissue examined with highest
expression in the retina 16, 17 . In vitro assays have
demonstrated that rRGS16 protein binds with high affinity
(kD
35 nM) to transducin, the retina-specific
GTPase involved in visual signal transduction. Assays with
reconstituted rod outer segment membranes showed that RGS16 accelerates
transducin GTPase activity 10-fold 18 . Thus, a role for RGS16 in
visual signal transduction is clearly implicated. Potential functions
of this gene product in lymphocytes have not been addressed.
As the GTPase-promoting activity of the RGS proteins is constitutive,
the regulation of expression of the RGS genes may well be an important
means to control RGS function. Therefore, the present studies were
undertaken to identify the stimuli that regulate expression of the RGS2
and RGS16 genes in human T cells and to identify the G
subunits targeted by the respective gene products. Our results,
detailed in this report, demonstrate that RGS function is regulated by
the inherent target specificity of individual RGS proteins toward
distinct G
subunits and also by differential regulation
of expression of the RGS genes. Moreover, these results lend
further support to the notion that in T cells, non-G protein-coupled
receptors such as the IL-2R may use RGS proteins to influence
heterotrimeric G protein signaling pathways.
| Materials and Methods |
|---|
|
|
|---|
PBCs were isloated from the venous blood of healthy donors by Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) density centrifugation. Lymphocytes were cultured in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS (Gemini BioProducts, Calabasas, CA) and antibiotics and were stimulated with a 1:500 dilution of an anti-CD3 mAb (OKT3; Ortho Pharmaceuticals, Raritan, NJ). After 3 days of OKT3 stimulation, cells were washed and replaced in culture for an additional 11 days in the presence of 500 pM IL-2 (Takeda, Osaka, Japan). Cells were washed out of IL-2 and replaced in culture for 36 h, then restimulated with 50 ng/ml phorbol-12,13-dibutyrate (Calbiochem, San Diego, CA) to induce high affinity IL-2R expression. Cells were washed of phorbol-12,13-dibutyrate for 12 h before restimulation. This enabled generation of a synchronized-T cell population which was arrested in early G1 and comprised of >90% CD8+ T cells 19 . The phorbol ester treatment does not affect the expression of RGS2 11 or RGS16 15 . The U937 and the 293 human embryonic kidney cell lines 20 were maintained in RPMI 1640 with 10% FCS and antibiotics.
Cellular proliferation, Northern blot analysis, and RT-PCR analysis
IL-2R+ T cells were restimulated with 500 pM IL-2 alone or in combination with 0.5 mM dibutyryl-cAMP (Sigma, St. Louis, MO) or 0.5 mM sodium butyrate (Sigma). PGE1 or PGE2 (Sigma) were used at a final concentration of 1 µM. Cell cycle progression was monitored by placing aliquots of 105 cells in a total volume of 200 µl for 48 h, the last 5 h in the presence of 0.5 µCi [3H]thymidine. Cells were harvested onto glass fiber filters and incorporated radiocativity was quantitated by liquid scintillation counting.
For RNA analysis, cells were harvested after 2 h stimulation. To
prepare Northern blots, total cellular RNA was isolated and 15 µg RNA
was separated on a 1.2% agarose gel, followed by capillary transfer to
a Hybond-N+ membrane (Amersham, Arlington Heights,
IL). Hybridization was conducted with random-primed
32P-labeled DNA probes (>1 x 106 cpm/ml)
at 65°C overnight in Rapid-Hyb solution (Amersham). The RGS2 cDNA was
a generous gift from D. R. Forsdyke (Queens University,
Kingston, Ontario, Canada). Membranes were washed twice in 2x
SSC/0.1% SDS at room temperature for 15 min, then 60°C in 0.2x
SSC/0.1% SDS for 15 min, and subjected to autoradiography. For RT-PCR
analysis, oligo(dT)-primed cDNA was prepared from the total RNA
isolated from 2 x 106 cells. An aliquot of cDNA
corresponding to 1 x 105 cells was used for
amplification with primers specific to RGS16 (product size, 536 bp),
RGS2 (446 bp), and ß2-microglobulin (ß2-m)
(268 bp). The primer sequences were designed to span introns and, in
the case of the RGS genes, to bind sequences not homologous with other
RGS family members. The primer sequences are as follows (written
5'-3'): RGS16 sense TGGAGAGAGTCGTTCGACCTG and antisense
TGTCCTCTTGCACTTGCTTTGC; RGS2 sense
CCAAATCACCCCAAAAGCTGTCCTC and antisense CTCCTAGTCAGTTACTGGCTTCCTG;
ß2m sense CCAGCAGAGAATQQAAAGTC and antisense
GATGCTGCTTACATGTCTCG. Using previously described reagent concentrations
21 , amplification was conducted for one cycle at 94°C for 50
s, followed by 25 cycles of 94°C for 30 s, 58°C for 1 min,
72°C for 1 min, and a single 10-min cycle at 72°C. These conditions
were optimized using plasmid standards that contained the cDNA clones
of the target genes to allow discrimination of a range between
104 and 107 molecules. In all cases,
products derived from experimental samples fell within this range,
which corresponds to
0.1100 molecules/cell when
reverse-transcribed cellular cDNA was used. PCR products were separated
on 1.5% agarose gels, stained in ethidium bromide, and photographed as
negative images, using the Eagle Eye photographic system (Stratagene,
La Jolla, CA).
Preparation of rRGS16 protein
Hexa-histidine-tagged RGS16 protein (His6RGS16) was generated by cloning a cDNA fragment encoding the 202-amino acid RGS16 open reading frame into the pRSET plasmid (Invitrogen, Carlsbad, CA). The RGS16 construct was expressed in BL21/DE3pLysS bacteria (Novagen, Madison, WI), and protein expression was induced by incubation with 1 mM isopropyl ß-D-thiogalactopyranoside for 3 h at 37°C. Soluble recombinant protein was purified by binding to Ni2+/NTA resin (Qiagen, Chatsworth, CA) according to maufacturers instructions and eluted with a 50 mM to 300 mM imidazole gradient. Aliquots of eluted fractions were analyzed by SDS-PAGE and Coomassie Blue staining, and fractions containing RGS16 (>90% pure) were used for further assays.
G
-binding assays
Affinity purification of endogenous G proteins with rRGS16
protein was performed as follows. Jurkat cells (5 x
107) were lysed in buffer containing 50 mM HEPES (pH 8.0),
300 mM NaCl, 1 mM DTT, 6 mM MgCl2, and 1% Triton X-100.
Cell lysates were then activated with GDP (30 µM) or GDP plus 30 µM
AlCl3 and 100 mM NaF for 30 min at 30°C. Lysates were
then incubated for 1 h at 4°C with 20 µg
rHis6RGS16 and 60 µl of a 50% slurry of
Ni2+/NTA beads (Qiagen). After one wash with buffer A (same
as above buffer, but with 0.025% C12E10 detergent (Sigma) substituted
for Triton X-100), bound proteins were eluted with Laemmli buffer and
boiled for 5 min. After separation by SDS-PAGE and transfer to
nitrocellulose filter, blots were probed with antisera against
Gi
12 (a gift of Allen Spiegel, National Institute of
Diabetes and Digestive and Kidney Diseases, National Institutes of
Health), Gi
3 (DuPont, Boston, MA), or
Gq
(Santa Cruz Biotechnologies, Santa Cruz, CA).
Cellular signaling assays
To monitor the Gi-linked CXCR1 pathway, mitogen-activated protein (MAP) kinase activation was measured in HEK 293, stably expressing CXCR1. Cells were transiently cotransfected with 2 µg of hemagglutinin (HA-) extracellular signal-regulated kinase 1 (ERK1) and 5 µg of RGS expression plasmid by the calcium phosphate method and subsequently stimulated for 3 min with IL-8 (50 ng/ml). MAP kinase activity was measured as previously described 5 .
To measure the activity of the Gq-linked m1 muscarinic
pathway, a cAMP-response element-binding protein- (CREB-)
ß-galactosidase (ß-gal) reporter gene (kindly provided by Roger
Cone, Oregon Health Sciences University, Portland, OR) was used.
Briefly, 1 µg of CREB-ß-gal, 1 µg of m1 receptor expression
plasmid (the kind gift of J. Silvio Gutkind, National Institute on
Dental Research, National Institutes of Health) and 4 µg of RGS
expression plasmids were cotransfected into 293 T cells by the calcium
phosphate method. A constitutively active Gq
mutant,
Gq
Q209L, was also assayed by cotransfection with the
CREB-ß-gal reporter. Cells were serum-starved for 24 h, and
after 48 h m1 receptor-transfected cells were stimulated for
6 h with 1 mM carbachol (Sigma). Cell extracts were prepared and
10 µl of supernatant was incubated in diluted ß-gal substrate
(Galacton; Tropix, Bedford, MA), and the luminescence measured
using a Monolight 3010 Luminometer (Analytical Luminescence
Laboratories, San Diego, CA). Each point was standardized by
measuring the protein concentrations of the lysates.
To determine expression of RGS plasmids, each construct (RGS2, RGS4, RGS16) was epitope tagged with an HA peptide. The remaining supernatants from each assay were immunoprecipitated with HA Ab (BAbCo, Richmond, CA), separated by SDS-PAGE, and then immunoblotted again with the HA Ab.
| Results |
|---|
|
|
|---|
CR1 was identified and cloned in a screen for IL-2-induced immediate/early genes in human T cells 15 . The full-length 2.4-kb CR1 cDNA encodes a predicted open reading frame of 202 amino acids. Sequence alignments indicate that CR1 is a member of the RGS family, identical to RGS16 (GenBank accession number U70426) 16, 17 . This human RGS gene was also cloned by Buckbinder et al. 16 , who termed it RGS14. However, the designation RGS14 was assigned earlier to a partial cDNA described by Koelle and Horvitz 6 in their original description of the RGS family. Chen et al. 22 cloned the murine homologue, RGS16, which was previously called RGS-r by virtue of its high expression in the retina 23 . The human gene has also been referred to as RGS-r 18 . To clarify the nomenclature, the Human Genome Organization/Genome Data Base Nomenclature Committee has designated this gene RGS16 17 .
RGS16 contains a core RGS domain between amino acids 62 and 180, which is highly conserved among RGS proteins from yeast, Caenorhabditis elegans, and mammals 24 . Among human RGS proteins, RGS16 is most similar to RGS3 (the C-terminal 175 amino acids, GenBank U27655), RGS4 (U27768), RGS2 (LI3463), RGS1 (S59049), and RGS-GAIP (EMBL X91809). The overall identities of these proteins with RGS16 range from 38 to 49%. All show the highest degree of sequence conservation within the RGS domain. The murine RGS16 protein (U72881) is 86% identical to the human, and the rat homologue (AA817864) shows 86% identity to the human RGS16 protein 16, 18, 22, 23 .
Reciprocal effect of elevated intracellular cAMP on expression of RGS16 and RGS2 genes
Although both RGS16 and RGS2 were originally cloned from T
lymphocytes, mitogen stimulation induces the expression of RGS2 during
the G0/G1 cell cycle transition 9 , whereas
IL-2R activation induces RGS16 during the G1-S phase
transition 15 . To analyze further the expression patterns of these
RGS genes in T cells, we chose to examine the effect of elevated
intracellular cAMP, which inhibits both TCR and IL-2R signaling 25 ,
and is well known to be a second messenger activated by GPCRs. As shown
in Fig. 1
A, IL-2-induced DNA
synthesis in IL-2R+ human peripheral blood T cells, as
monitored by [3H]thymidine uptake, was completely
inhibited by the membrane permeant cAMP analogue, dibutyryl-cAMP, but
not by sodium butyrate. Northern blot analysis revealed marked
differences in the patterns of RGS16 and RGS2 expression (Fig. 1
B). RGS16 transcripts were expressed at very low levels in
G1-synchronized IL-2R+ cells, but exhibited
significant induction after 2 h of IL-2 stimulation.
Dibutyryl-cAMP completely blocked the IL-2 stimulatory effect, whereas
the sodium butyrate did not. In contrast, RGS2 transcripts were already
present at high levels as a result of completing the
G0-G1 transition. However, IL-2 stimulation
suppressed this RGS2 expression, and elevation of intracellular cAMP
reversed the IL-2 inhibition. Thus, the RGS16 and RGS2 genes exhibit
reciprocal patterns of expression in response to IL-2R stimulation, and
elevated intracellular cAMP also modulates the expression of the two
genes in a reciprocal fashion.
|
50%, which
is consistent with previous observations 1 . Just as in the case of
dibutyryl-cAMP, both PGE1 and PGE2 inhibited
RGS16 expression, whereas RGS2 expression was increased (Fig. 1Binding of RGS16 to endogenous G proteins in T cells
The differences in expression patterns of the RGS16 and RGS2 genes
suggested different functions of the respective gene products. In this
regard, the RGS2 protein is known to bind and activate the GTPase
activity of Gq
subunits, but not Gi
subunits 26 . To identify the target G
protein
specificity of RGS16 and to determine the relevant interactions that
occur between RGS16 and G
proteins in T lymphocytes, we
examined the binding of RGS16 protein to G
subunits
present in Jurkat T leukemic cells. Previous analyses of other RGS
proteins demonstrated little or no RGS binding to "inactive"
GDP-bound G
subunits, but high-affinity binding to
G
subunits complexed with GDP-AlF4 that mimics the
transition state of GTP hydrolysis 24 . Therefore, lysates of the
Jurkat T cell line were treated with excess GDP or activated with
GDP+AlF4- and then incubated with recombinant hexa-histidine-tagged
(His6) RGS16 immobilized on Ni2+/NTA beads.
After washing away unbound proteins and separating eluted proteins by
SDS-PAGE, the blots were probed for various G
subunits.
No G proteins from these lysates bound to beads alone or to beads
coupled to an irrelevant hexahistidine-tagged protein (data not shown).
In addition, as shown in Fig. 2
, little
or no binding of endogenous G
proteins was seen when the lysates
were treated with GDP alone. In contrast, strong binding of endogenous
Gi
13 and Gq
to immobilized RGS16 was
seen when the lysates were treated with AlF4-, consistent with the
binding activity of other RGS proteins 4, 27, 28 , and with
observations of RGS16 binding to in vitro translated Gi
1
29 . Thus, in contrast to RGS2, RGS16 binds to both G i
and Gq
subunits.
|
Single turnover GTPase assays indicated that RGS16 accelerates the
GTPase activities of Gi
1, Gi
2 and
Gi
3 subunits in vitro by
10-fold, whereas RGS2 could
not serve as a GAP for any of the Gi
subunits in
solution assays, consistent with its G
-binding
characteristics (data not shown). Because Gq
could not
be tested in vitro for technical reasons, we reconstituted in vivo
signaling pathways mediated by Gi
and Gq
in HEK 293 cells to determine whether the differences in binding and in
the activities of RGS2 and RGS16 proteins toward Gi
and
Gq
subunits observed in vitro were reflected in
differential regulation of intracellular G-coupled signaling pathways
in vivo. As a control, RGS4 was used, because this RGS protein has been
well characterized as an inhibitor of both Gi- and
Gq-mediated signaling 4 . To assess the effects of RGS
protein expression on a Gi
-linked pathway, we measured
MAP kinase activity in 293 cells expressing CXCR1 after stimulation
with the chemokine IL-8. An 8-fold increase in MAP kinase activity was
observed in stimulated vs nonstimulated cells, and cells transfected
with either RGS2 or RGS4 were inhibited by only
25%. By comparison,
cells expressing RGS16 consistently revealed an inhibition of
IL-8-induced MAP kinase activation by >60% (Fig. 3
A). Similar results were
observed when 293 cells stably transfected with CCR5 and transiently
transfected with RGS proteins were stimulated with RANTES (data not
shown).
|
Q290L) 30 . The
CREB-ß-gal construct reflects the activation of CREB resulting from
an increase in intracellular Ca2+ or cAMP 31 . In cells
expressing the m1 receptor, we observed an
12-fold increase in
reporter gene expression in cells stimulated with carbachol.
Coexpression of RGS2, RGS4, or RGS16 substantially inhibited this
pathway, with the strength of the activity ranked as RGS2 >>
RGS16 > RGS4 (Fig. 4
(Q290L): both RGS4 and RGS16 inhibited
reporter gene expression only moderately, whereas in cells that
expressed RGS2, Gq
activity was actually below basal
levels (Fig. 4
26 , and underscore the functional heterogeneity of RGS proteins that
may be expressed in the same cell.
|
| Discussion |
|---|
|
|
|---|
Both mitogenic lectin 11 and elevated intracellular cAMP induce the
expression of RGS2, which attenuates signaling via Gq
.
The inhibition of Gq
signaling by mitogen signaling
would appear to be paradoxical in that the Gq
pathway
mimics mitogen signaling by activation of phospholipase C-ß-mediated
IP3 hydrolysis with subsequent Ca2+ flux and
protein kinase C (PKC) activation. However, it could be speculated that
this is one way by which signals impinging upon the cell are
discriminated. Mitogen activation promotes characteristic changes in
the cell, which initiate entrance into the cell cycle, i.e.,
G0-G1 transition. During this process, the
induction of expression of RGS2 may serve to disconnect any signaling
via Gq
-coupled receptors, which may compete or
counteract mitogen signaling.
The induction of expression of RGS16 by IL-2R signaling, and the
inhibition of this induction by elevated intracellular cAMP may well be
another example of the control over GPCR signaling pathways by a
receptor family that does not couple directly with G proteins. In
contrast to RGS2, which only binds to and attenuates Gq
signaling, RGS16 attenuates both Gq
- and
Gi
-coupled pathways. As its designation implies,
Gi
acts to inhibit the activity of adenylate cyclase,
thereby counteracting the generation of elevated intracellular cAMP.
When viewed from the IL-2 signaled events, i.e., G1
progression to the S phase of the cell cycle, it is logical that the
IL-2R should attenuate GPCRs that result in competitive or
counteractive signaling pathways. Therefore, Gq
activation and resultant Ca2+ flux and PKC activation would
necessarily generate biochemical events that may counteract IL-2R
signaling. The attenuation of Gi
by RGS16 is more
difficult to understand, given that elevated intracellular cAMP
inhibits IL-2-promoted G1 progression 25, 32 .
IL-2-induced RGS16 expression in T cells is transient, peaking at 24
h and declining rapidly thereafter 15 . Therefore, it is possible that
the turnover of RGS16 in early G1 promotes late
G1 progression.
The pharmacologic effect of dibutyryl cAMP and the physiologic effect
of PGE1 and PGE2 on RGS2 and RGS16 expression
are of interest in that the regulation of RGS gene expression by cAMP
provides for an interconnection between Gs
and the other
G
subunits. Both PGE1 and PGE2
trigger activation of adenylate cyclase and elevation of intracellular
cAMP, through the Gs-coupled EP2 and EP4 receptors 33, 34 . Recently, elevation of cAMP has been shown to decrease RGS4 mRNA
levels, and augment RGS2 levels, in PC12 cells. This effect could be
achieved by pharmacological elevation of cAMP with forskolin or cAMP
analogues, and also by ligand stimulation of the Gs-coupled
adenosine receptor A2a 35 . To date, no RGS protein has
been identified that acts as a GAP toward Gs
, so that
the regulation of RGS genes by Gs-coupled stimuli may serve
to modulate signaling by other GPCRs, rather than in an autoregulatory
loop. Clearly, there are several different levels of control, whereby
both GPCRs and non-GPCRs can regulate one another via the RGS proteins.
The most well-characterized GPCRs in lymphocytes are those that bind
chemokines. In vitro analyses 36 , as well as in vivo studies with
transplanted pertussis toxin-treated cells 37 and with transgenic
mice expressing the catalytic subunit of pertussis toxin under the
control of the lck promoter 38, 39 , have demonstrated that
lymphocyte migration is sensitive to the toxin. Pertussis toxin
ADP-ribosylates and inactivates Gi
subunits, indicating
that the chemotactic response requires Gi
. As
Gi
subunits are targets of RGS16, it would be predicted
that IL-2-triggered RGS16 expression could serve to attenuate the
chemotactic signaling pathway. Notably, IL-2 has been reported to
inhibit the chemotactic response of CD4+ and
CD8+ T cells to both IL-8 and RANTES 40 . This inhibition
may well be effected by the IL-2-mediated induction of RGS16.
Focusing only on G
signaling gives an incomplete
treatment of the potential effects of the RGS proteins, in that there
are 6 ß-chain gene products and 12
-chain gene products, in
addition to the >20
-chain gene products that comprise the four
main functional groups of G
proteins. Thus far, effector
proteins of the Gß
complex include phospholipases,
adenylate cyclases, ion channels, G-protein-coupled kinases,
phosphoinositol 3-kinases, and the nonreceptor tyrosine protein
kinases, Btk and Tsk 3 . Accordingly, to understand the role that RGS
proteins play in T cell activation, proliferation, and differentiation,
it will be necessary to identify exactly which G protein
, ß, and
subunits are expressed in T cells and to delineate which signaling
pathways are coupled with both the G
and the
Gß
subunits. In this regard, the discovery that the
RGS2 and RGS16 genes are regulated by mitogen and IL-2, respectively,
provides for a starting point for such an experimental dissection.
| Footnotes |
|---|
2 Current address: Dr. Gunther Richter, Max Delbruck Centrum fur Molekulare Medizin, 13125 Berlin, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Kendall A. Smith, Division of Immunology, LC-907, Cornell University Medical College, 525 East 68th Street, New York, NY 10021. E-mail address: ![]()
4 Abbreviations used in this paper: GPCR, G protein-coupled receptors; RGS, regulators of G protein signaling; GAP, GTPase-activating protein; MAP, mitogen-activated protein; CREB, cAMP-response-element-binding protein; ß-gal, ß-galactosidase; HA, hemagglutinin; ERK, extracellular signal-regulated kinase; CR1, cytokine-responsive gene 1; ß2-m, ß2-microglobulin. ![]()
Received for publication September 17, 1998. Accepted for publication November 23, 1998.
| References |
|---|
|
|
|---|
i2-deficient mice. Nat. Genet. 10:143.[Medline]
subunits. Cell 86:445.[Medline]
helical basic phosphoprotein. Biochim. Biophys. Acta 1216:314.[Medline]
proteins and inhibits pheromone signaling in yeast. J. Biol. Chem. 272:8679.
function. Proc. Natl. Acad. Sci. USA 94:14389.
and block activation of phospholipase Cß by
-thio-GTP-Gq
. Proc. Natl. Acad. Sci. USA 94:428.
-subunits. Nature 383:172.[Medline]
-subunits. FEBS Lett. 411:179.[Medline]
-subunits. J. Biol. Chem. 267:18263.
, IL-4, IL-10 and IL-13. J. Immunol. 154:3742.[Abstract]
This article has been cited by other articles:
![]() |
Z. Xie, M. C. Gong, W. Su, J. Turk, and Z. Guo Group VIA Phospholipase A2 (iPLA2beta) Participates in Angiotensin II-induced Transcriptional Up-regulation of Regulator of G-protein Signaling-2 in Vascular Smooth Muscle Cells J. Biol. Chem., August 31, 2007; 282(35): 25278 - 25289. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Timmusk, C. Fossum, and M. Berg Porcine circovirus type 2 replicase binds the capsid protein and an intermediate filament-like protein. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3215 - 3223. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Romero, M. W. Plonczynski, E. P. Gomez-Sanchez, L. L. Yanes, and C. E. Gomez-Sanchez RGS2 Is Regulated by Angiotensin II and Functions as a Negative Feedback of Aldosterone Production in H295R Human Adrenocortical Cells Endocrinology, August 1, 2006; 147(8): 3889 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Berthebaud, C. Riviere, P. Jarrier, A. Foudi, Y. Zhang, D. Compagno, A. Galy, W. Vainchenker, and F. Louache RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes Blood, November 1, 2005; 106(9): 2962 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schwable, C. Choudhary, C. Thiede, L. Tickenbrock, B. Sargin, C. Steur, M. Rehage, A. Rudat, C. Brandts, W. E. Berdel, et al. RGS2 is an important target gene of Flt3-ITD mutations in AML and functions in myeloid differentiation and leukemic transformation Blood, March 1, 2005; 105(5): 2107 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Estes, T. C. Thacker, D. L. Hampton, S. A. Kell, B. F. Keele, E. A. Palenske, K. M. Druey, and G. F. Burton Follicular Dendritic Cell Regulation of CXCR4-Mediated Germinal Center CD4 T Cell Migration J. Immunol., November 15, 2004; 173(10): 6169 - 6178. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Moratz, J. R. Hayman, H. Gu, and J. H. Kehrl Abnormal B-Cell Responses to Chemokines, Disturbed Plasma Cell Localization, and Distorted Immune Tissue Architecture in Rgs1-/- Mice Mol. Cell. Biol., July 1, 2004; 24(13): 5767 - 5775. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lippert, D. L. Yowe, J.-A. Gonzalo, J. P. Justice, J. M. Webster, E. R. Fedyk, M. Hodge, C. Miller, J.-C. Gutierrez-Ramos, F. Borrego, et al. Role of Regulator of G Protein Signaling 16 in Inflammation- Induced T Lymphocyte Migration and Activation J. Immunol., August 1, 2003; 171(3): 1542 - 1555. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, P. E. Massa, A. Hanidu, G. W. Peet, P. Aro, A. Savitt, S. Mische, J. Li, and K. B. Marcu IKKalpha , IKKbeta , and NEMO/IKKgamma Are Each Required for the NF-kappa B-mediated Inflammatory Response Program J. Biol. Chem., November 15, 2002; 277(47): 45129 - 45140. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hollinger and J. R. Hepler Cellular Regulation of RGS Proteins: Modulators and Integrators of G Protein Signaling Pharmacol. Rev., September 1, 2002; 54(3): 527 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Johnson and K. M. Druey Functional Characterization of the G Protein Regulator RGS13 J. Biol. Chem., May 3, 2002; 277(19): 16768 - 16774. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Derrien and K. M. Druey RGS16 Function Is Regulated by Epidermal Growth Factor Receptor-mediated Tyrosine Phosphorylation J. Biol. Chem., December 14, 2001; 276(51): 48532 - 48538. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Lombardi, A. Kavelaars, P. M. Cobelens, R. E. Schmidt, M. Schedlowski, and C. J. Heijnen Adjuvant Arthritis Induces Down-Regulation of G Protein-Coupled Receptor Kinases in the Immune System J. Immunol., February 1, 2001; 166(3): 1635 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. S. Kabarowski, J. D. Feramisco, L. Q. Le, J. L. Gu, S.-W. Luoh, M. I. Simon, and O. N. Witte Direct genetic demonstration of Galpha 13 coupling to the orphan G protein-coupled receptor G2A leading to RhoA-dependent actin rearrangement PNAS, October 24, 2000; 97(22): 12109 - 12114. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Oliveira-dos-Santos, G. Matsumoto, B. E. Snow, D. Bai, F. P. Houston, I. Q. Whishaw, S. Mariathasan, T. Sasaki, A. Wakeham, P. S. Ohashi, et al. Regulation of T cell activation, anxiety, and male aggression by RGS2 PNAS, October 4, 2000; (2000) 220414397. [Abstract] [Full Text] |
||||
![]() |
B. M. Sullivan, K. J. Harrison-Lavoie, V. Marshansky, H. Y. Lin, J. H. Kehrl, D. A. Ausiello, D. Brown, and K. M. Druey RGS4 and RGS2 Bind Coatomer and Inhibit COPI Association with Golgi Membranes and Intracellular Transport Mol. Biol. Cell, September 1, 2000; 11(9): 3155 - 3168. [Abstract] [Full Text] |
||||
![]() |
K. Reif and J. G. Cyster RGS Molecule Expression in Murine B Lymphocytes and Ability to Down-Regulate Chemotaxis to Lymphoid Chemokines ,2 J. Immunol., May 1, 2000; 164(9): 4720 - 4729. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Grant, B. Lassègue, K. K. Griendling, M. Ushio-Fukai, P. R. Lyons, and R. W. Alexander Specific Regulation of RGS2 Messenger RNA by Angiotensin II in Cultured Vascular Smooth Muscle Cells Mol. Pharmacol., March 1, 2000; 57(3): 460 - 467. [Abstract] [Full Text] |
||||
![]() |
L. Song, P. De Sarno, and R. S. Jope Muscarinic Receptor Stimulation Increases Regulators of G-protein Signaling 2 mRNA Levels through a Protein Kinase C-dependent Mechanism J. Biol. Chem., October 15, 1999; 274(42): 29689 - 29693. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-K. Park, C. A. Klug, K. Li, L. Jerabek, L. Li, M. Nanamori, R. R. Neubig, L. Hood, I. L. Weissman, and M. F. Clarke Molecular Cloning and Characterization of a Novel Regulator of G-protein Signaling from Mouse Hematopoietic Stem Cells J. Biol. Chem., January 5, 2001; 276(2): 915 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Heximer, H. Lim, J. L. Bernard, and K. J. Blumer Mechanisms Governing Subcellular Localization and Function of Human RGS2 J. Biol. Chem., April 20, 2001; 276(17): 14195 - 14203. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, G. W. Peet, D. Balzarano, X. Li, P. Massa, R. W. Barton, and K. B. Marcu Novel NEMO/Ikappa B Kinase and NF-kappa B Target Genes at the Pre-B to Immature B Cell Transition J. Biol. Chem., May 18, 2001; 276(21): 18579 - 18590. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Oliveira-dos-Santos, G. Matsumoto, B. E. Snow, D. Bai, F. P. Houston, I. Q. Whishaw, S. Mariathasan, T. Sasaki, A. Wakeham, P. S. Ohashi, et al. Regulation of T cell activation, anxiety, and male aggression by RGS2 PNAS, October 24, 2000; 97(22): 12272 - 12277. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |