| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology, Juntendo University School of Medicine, Tokyo, Japan; and
Core Research for Evolutional Science and Technology (CREST) of Japan Science and Technology Corp., Tokyo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Fas ligand
(FasL)3/CD95L induce
apoptotic cell death via their specific receptors (TNFR-I and Fas/CD95,
respectively), which contain structurally and functionally homologous
death domains 1, 2 . TNF-related apoptosis-inducing ligand
(TRAIL)/APO-2L is a recently identified type II integral membrane
protein belonging to the TNF family and induces apoptosis in various
tumor cell lines 3, 4 . TRAIL mRNA were detected in a variety of
tissues and cells as estimated by Northern blot analysis 3, 4 . Recent
molecular cloning of the TRAIL receptors (TRAIL-Rs) elucidated that
TRAIL binds to at least four receptors, TRAIL-R1/DR4,
TRAIL-R2/DR5/TRICK2/killer, TRAIL-R3/TRID/DcR1/LIT, and
TRAIL-R4/TRUNDD/DcR2, with similar affinities 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 . These receptors
could be classified into two groups, death-inducing receptors (TRAIL-R1
and -R2) and death-inhibitory receptors (TRAIL-R3 and -R4). Both
TRAIL-R1 and TRAIL-R2 contain the death domain homologous to that in
TNFR-I, DR3/TRAMP/APO-3/WSL-1, or Fas and appear to be responsible for
the TRAIL-induced apoptotic cell death in a variety of tumor cells
5, 6, 7, 8, 10 . In contrast to these death-inducing receptors, TRAIL-R3 is
devoid of cytoplasmic domain and exists as a glycophospholipid-anchored
protein on the cell surface. It has been suggested that TRAIL-R3
competes with the death-inducing TRAIL-Rs for TRAIL binding and may
work as a decoy receptor 9, 10, 11, 12, 13 . Since TRAIL-R3 mRNA was
preferentially found in normal cells but not in transformed cells, it
is thought that TRAIL-R3 might be responsible for the cellular
resistance of normal cells to TRAIL-mediated cytotoxicity 9, 13 .
TRAIL-R4 has the cytoplasmic domain containing a truncated death domain
that cannot transmit a death signal but can activate NF-
B, which may
protect the cells from TRAIL-mediated apoptosis 14, 15, 16 . These
findings suggested a complex regulation of cellular susceptibility to
the TRAIL-mediated apoptosis at the level of multiple receptor
expression. In contrast to this progress in the receptors, little is
known about the expression of TRAIL at the protein level and its
physiological functions.
T cell-mediated cytotoxicity not only plays an important role in immune
surveillance against virus-infected or transformed cells but also has
been implicated in the tissue damage associated with diseases, such as
graft-vs-host disease and organ-specific autoimmune diseases. It has
been generally accepted that CTL kill target cells via two major
effector pathways, perforin- and FasL-mediated pathways 17, 18, 19 . The
effector molecules in the former, such as perforin and granzymes, are
secreted from cytoplasmic granules of CTL into an intercellular space
after contact with target cells. Locally secreted perforin molecules
form a channel in the target cell membrane, resulting in osmotic lysis
and influx of granzymes that activate caspases and lead to nuclear
disintegration 20, 21 . In the latter pathway, the intercellular
interaction between FasL on CTL and its receptor, Fas, on target cells,
induces apoptotic target cell death via the death domain-mediated
recruitment of the caspases 1, 2 . It has been demonstrated that these
two pathways are required for the clearance of certain pathogens and
tumors 22, 23, 24, 25 . It has also been indicated that these pathways are
involved in the pathogenesis of hepatitis and graft-vs-host disease
26, 27, 28, 29, 30 . In addition to these two pathways, however, previous studies
have suggested the possible existence of some other effector mechanisms
for CTL cytotoxicity. For example, Braun et al. demonstrated that CTL
from mice deficient in both FasL and perforin lysed some kinds of tumor
cells in an in vitro assay 30 . Furthermore, it has also been reported
that when perforin-knockout mice were injected with a low number of
syngeneic Fas-negative tumor cells, these mice could reject them like
wild-type mice 24 . In our preliminary studies, we also found that
some CD4+ T cell clones spontaneously lysed certain target
cells in a FasL- and perforin-independent manner. The molecules on
effector and target cells responsible for such a FasL- and
perforin-independent cytotoxicity have not been defined. It is known
that membrane-bound or soluble TNF- could contribute to the
cytotoxicity exerted by some CTL or lymphokine-activated killer cells
31, 32, 33 . However, the TNF--mediated cytotoxicity appeared not to be
relevant to the cytotoxicity reported by Braun et al., since
neutralizing anti-TNF- Abs only partially blocked this
cytotoxicity 30 .
In the present study, to elucidate the physiological expression and function of TRAIL in immune system, we generated neutralizing mAbs against human TRAIL (hTRAIL) and estimated whether a TRAIL pathway may be involved in the T cell-mediated cytotoxicity. We found that TRAIL is constitutively expressed on human CD4+ T cell clones and is responsible for spontaneous cytotoxicity against certain tumor target cells that are susceptible to TRAIL-mediated apoptosis. In contrast, FasL was inducible upon anti-CD3 stimulation, and bystander cytotoxicity by activated CD4+ T cell clones was mediated by both TRAIL and FasL. These results indicated the involvement of TRAIL in T cell cytotoxicity and a differential regulation of TRAIL and FasL expression in human CD4+ T cell clones.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A mouse B lymphoma cell line, 2PK-3, was obtained from American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 containing 10% FCS, 100 µg/ml streptomycin and penicillin, and 2 mM glutamine (culture medium). The human T lymphomas Jurkat and HUT78, a chronic myelogenous leukemia K562, and a monocytic leukemia THP-1 were obtained from Japan Cancer Research Bank (Osaka, Japan) and maintained in culture medium. A human T lymphoma, PEER, was kindly provided by Dr. J. Minowada (Hayashibara Biochemical Laboratories, Fujisaki, Japan) and maintained in culture medium. A spontaneously transformed human keratinocyte cell line, HaCaT 34 , was kindly provided by Dr. N. E. Fusenig (German Cancer Research Center, Heidelberg, Germany) and cultured in DMEM containing 10% FCS, 100 µg/ml streptomycin and penicillin, and 2 mM glutamine. Human CD4+ T cell clones (HK12, 4HM1, HK1, HK11, HK15, and HK101) that had been established from PHA blasts as described before 35 were provided by Dr. M. Azuma (National Children’s Medical Research Center, Tokyo, Japan) and maintained in culture medium supplemented with 10 U/ml of recombinant IL-2. The Ag specificity of these clones has not been determined. For the preparation of anti-CD3-activated CD4+ T cell clones, these cells (2 x 106/ml) were cultured for 3 h on six-well plates precoated with 10 µg/ml anti-CD3 mAb (OKT-3) and then washed twice with culture medium.
Reagents
A hydroxamic acid-based metalloproteinase inhibitor (KB-R8301) that inhibits the processing of FasL 36 was provided by Dr. K. Yoshino (Kanebo, Osaka, Japan). Concanamycin A (CMA), which inhibits perforin-mediated cytotoxicity 37 , was purchased from Wako Pure Chemicals (Osaka, Japan). PMA and ionomycin were purchased from Sigma Chemical Co. (St. Louis, MO). OKT-3 was prepared from the hybridoma obtained from ATCC. An anti-human FasL mAb (NOK-2) was prepared as described before 36 . A heteroconjugated bispecific Ab (OKT-3Xanti-NP) was prepared by chemically conjugating OKT-3 and an anti-nitrophenol (NP) hapten mAb with N-succinimidyl-3-(2-pyridyldithiol)propionate (Pharmacia, Tokyo, Japan) as described previously 38 .
Construction and preparation of DR5-Ig chimera protein
A cDNA fragment encoding the extracellular domain (amino acids
1–183) of human DR5/TRAIL-R2 was amplified by PCR from the full-length
human DR5 cDNA kindly provided by Dr. J. Ni (Human Genome Science,
Rockville, MD) 13 using ATGGAACAACGGGGACAG as the 5' primer and
GCCTGATTCTTTGTGGACAC as the 3' primer. The 5' and 3' primers were
tagged with an EcoRI and a BamHI site,
respectively. The 550-bp PCR product was digested with EcoRI
and BamHI and then introduced into the EcoRI and
BamHI sites of pBluescript II carrying the human C
1
genomic sequence as described previously 39 . This results in
in-frame fusion of the extracellular region of DR5 to the Fc
portion of human IgG1 (DR5-Ig). After confirmation of the nucleotide
sequence, the EcoRI- and NotI-digested fragment
encoding DR5-Ig was transferred into the EcoRI and
NotI sites of the PSG5 expression vector (Stratagene, La
Jolla, CA). COS7 cells were transfected with DR5-Ig/PSG5 as described
before 40 . At 16 h after transfection, the culture medium was
changed to a serum-free medium (ASF-104, Ajinomoto, Tokyo, Japan) and
further cultured for 96 h. DR5-Ig fusion protein in the
supernatant was purified with a protein G column as described before
41 .
Preparation of hTRAIL or FasL transfectants
hTRAIL cDNA was prepared by RT-PCR amplification of total RNA from anti-CD3-activated 4HM1 cells, with an oligonucleotide primer corresponding to the first six codons as the 5' primer and that corresponding to the last six codons as the 3' primer, according to the published sequence 3, 4 . The 5' and 3' primers were tagged with a XhoI and a NotI site, respectively. After XhoI and NotI digestion, the PCR product of 850 bp was subcloned into pBluescript II SK(+), and the nucleotide sequence was confirmed by using an Applied Biosystems (Foster City, CA) 373A automated sequencer and fluoresceinated dye terminator cycle sequencing method. The 850-bp cDNA was then transferred into the XhoI and NotI sites of the pMKITneo expression vector, kindly provided by Dr. K. Maruyama (Tokyo Medical and Dental University, Tokyo, Japan). For generating hTRAIL transfectants, hTRAIL/pMKITneo was transfected into 2PK-3 cells by electroporation (290 V, 960 µF) using a Gene Pulser (Bio-Rad, Hercules, CA). After selection with 1 mg/ml G418 and cloning by limiting dilution, a stable transfectant (hTRAIL/2PK-3) expressing a high level of TRAIL was selected by staining with DR5-Ig. In a similar way, BHK cells stably expressing hTRAIL (hTRAIL/BHK) were prepared. Generation of human FasL (hFasL)-expressing 2PK-3 cells (hFasL/2PK-3) was performed as described before 36 .
Generation of anti-hTRAIL mAbs
Six-week-old female BALB/c mice (Clear Japan, Tokyo, Japan) were
immunized by i.p. injection of hTRAIL/2PK-3 (1 x 107
cells) several times at 10-day intervals. Three days after the final
immunization, the splenocytes were fused with P3U1 mouse myeloma cells
as described previously 39 . After HAT
(hypoxanthine/aminopterin/thymidine) selection, the Abs that
inhibit cytotoxic activity of hTRAIL/2PK-3 against Jurkat cells were
screened. Two mAbs (RIK-1 and RIK-2) were identified by their strong
inhibitory effects and cloned by limiting dilution. RIK-1 and RIK-2
(both mouse IgG1) were purified from culture supernatant with
the protein G column.
Cytotoxic assays
A [3H]TdR release assay was performed as described previously 18 with [3H]TdR-labeled Jurkat cells (1 x 104) and effector cells at the indicated E:T ratios. After 8 h, intact nuclei were harvested using a Micro 96 harvester (Skatron, Lier, Norway), and radioactivity was measured on a microplate beta counter (Micro ß Plus; Wallac, Turku, Finland). The percentage TdR release was calculated as follows: [(cpm without effector - cpm with effector)/cpm without effector] x 100.
A 51Cr release assay was performed as described previously 41 . Briefly, 51Cr-labeled target cells (1 x 104) and effector cells were mixed in the U-bottomed wells of a 96-well microtiter plate at the indicated E:T ratios. After 8 h of incubation, cell-free supernatants were collected and counted on a gamma counter. The percentage specific 51Cr release was calculated as described before 38 . In some experiments the effector cells were pretreated with 20 nM CMA for 2 h to inactivate perforin 37 . Anti-FasL mAb (NOK-2) and/or RIK-2 were added to a final concentration of 10 µg/ml at the start of the cytotoxic assay. In some experiments, cytotoxicity of CD4+ T cell clones against NP-modified HaCaT cells was tested in the presence of 1 µg/ml OKT-3Xanti-NP in an 8-h 51Cr release assay. NP modification of target cells was conducted with NP-O-succinimide as described previously 38 .
Flow cytometric analysis
2PK-3, hTRAIL/2PK-3, and hFasL/2PK-3 cells (1 x 106) were incubated with l µg of biotinylated mAbs or DR5-Ig for 1 h at 4°C followed by phycoerythrin (PE)-labeled avidin or PE-labeled anti-human IgG (PharMingen, San Diego, CA), respectively. After washing with PBS, the cells were analyzed on a FACScan (Becton Dickinson, San Jose, CA), and data were processed by using the CELLQuest program (Becton Dickinson). Expression of TRAIL and FasL on resting or anti-CD3-activated CD4+ T cell clones was analyzed in a similar way with biotinylated anti-TRAIL (RIK-2) or anti-FasL (NOK-2) mAbs. For the analysis of FasL expression, 10 µM KB-R8301 was added to the stimulation culture to avoid the release of FasL from the cell surface.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To generate and characterize the mAbs to hTRAIL, we first
established stable cDNA transfectants expressing full-length hTRAIL.
Mouse B lymphoma 2PK-3 cells, which were totally resistant to
recombinant TRAIL (rTRAIL) (unpublished data), were transfected
with hTRAIL cDNA in the pMKITneo expression vector by electroporation
to make hTRAIL/2PK-3. After G418 selection, cell surface expression of
TRAIL on the hTRAIL/2PK-3 cells was verified by staining with DR5-Ig.
hTRAIL/2PK-3 cells, but not 2PK-3 or hFasL/2PK-3 cells, were stained by
DR5-Ig (Fig. 1
A). An
anti-hFasL mAb (NOK-2) that we previously generated 36 stained
hFasL/2PK-3, but not hTRAIL/2PK-3, indicating that NOK-2 does not
cross-react with TRAIL.
|
B). Similarly, hTRAIL/BHK cells, but not BHK cells,
exhibited potent cytotoxicity against Jurkat cells (not shown).
Previously, we and others have reported that some other members of the
TNF family, such as TNF- and FasL, undergo processing by some
metalloproteinase(s) and are released from the cell surface in a
soluble form 36, 43, 44, 45, 46 . We again observed that culture supernatant
of the hFasL/2PK-3 cells exhibited specific cytotoxicity against
Fas-transfected cells (not shown), as we previously demonstrated for
hFasL/BHK cells 36 . In contrast, no detectable level of cytotoxic
activity against Jurkat cells was found in the supernatant of
hTRAIL/2PK-3 or hTRAIL/BHK cells (not shown).
We also tested the cytotoxic activities of hTRAIL/2PK-3 and hFasL/2PK-3
cells against various cell lines (Fig. 1C). A human
keratinocyte cell line, HaCaT, was sensitive to both TRAIL and FasL, as
was the Jurkat cell line. A T lymphoma cell line, PEER, was sensitive
to TRAIL but not to FasL. A T lymphoma cell line, HUT78, was sensitive
to FasL but not to TRAIL. A chronic myelogenous leukemia cell line,
K562, and a monocytic leukemia cell line, THP-1, were resistant to both
TRAIL and FasL.
Characterization of anti-hTRAIL mAbs
To characterize the expression and function of hTRAIL, we
generated two mAbs that specifically bind to hTRAIL and block the
cytotoxic activity. Hybridomas were prepared from splenocytes from mice
immunized with the hTRAIL/2PK-3 cells. Two hybridomas, producing RIK-1
and RIK-2 mAbs (both mouse IgG1), were selected by their strong
ability to block the hTRAIL/2PK-3 cytotoxicity against Jurkat cells.
Both RIK-1 and RIK-2 reacted with hTRAIL/2PK-3, but not with 2PK-3 or
hFasL/2PK-3 cells, as estimated by cell surface staining (Fig. 2A). These mAbs also reacted
with hTRAIL/BHK but not with BHK cells (not shown). Previously, we
demonstrated that the treatment with a hydroxamic acid-based
metalloproteinase inhibitor, KB-R8301, led to accumulation of membrane
FasL on the cell surface of FasL transfectants 36 . This was again
observed with the hFasL/2PK-3 cells (not shown). In contrast, the same
treatment with 10 µM KB-R8301 or various inhibitors of other
proteinases, including metalloendopeptidases (phosphoramidon, 100
µM), serine proteinases (aprotinin, 10 µM), serine/cysteine
proteinases (leupeptin, 100 µM), cysteine proteinases (E64, 100
µM), aspartate proteinases (pepstatin, 100 µM), and aminopeptidases
(Bestatin, 100 µM), did not affect the expression of TRAIL on the
hTRAIL/2PK-3 and hTRAIL/BHK cells (data not shown).
|
B, both RIK-1 and RIK-2
inhibited the hTRAIL/2PK-3 cytotoxicity against Jurkat cells as
efficiently as DR5-Ig in the 8-h [3H]TdR release assay. CD4+ T cell clones spontaneously lysed certain target cells via a FasL- and perforin-independent pathway
CD4+ T cells exhibit cytotoxic activity against
certain target cells in an Ag-specific or -nonspecific manner 18, 41, 47, 48, 49, 50 . As represented in Fig. 3, we
observed that human CD4+ T cell clones (HK12 and 4HM1)
exhibited spontaneous cytotoxicity against Jurkat, HaCaT, and PEER
cells but not against HUT78, THP-1, or K562 cells in an 8-h
51Cr release assay without an anti-CD3 stimulation. A
similar target specificity was also observed for all of the other
CD4+ T cell clones tested in the present study (a total of
six clones from two healthy donors; data not shown). None of these
CD4+ T cell clones expressed a detectable level of perforin
(not shown), and the treatment with CMA, which has been successfully
used to inhibit the perforin-mediated cytotoxicity 37 , failed to
inhibit the spontaneous cytotoxicity of these clones (Fig. 3).
Furthermore, the addition of a neutralizing mAb against hFasL (NOK-2)
hardly inhibited the cytotoxicity exerted by these cells (Fig. 3).
These results suggest the contribution of a perforin- and
FasL-independent cytotoxic pathway against these target cells. Since
all the CD4+ T cell clones used in the present study
originated from PHA blasts, their antigenic specificities are unknown.
However, these CD4+ T cell clones efficiently lysed MHC
class II-negative targets (Jurkat and PEER cells), and the addition of
anti-CD3 failed to inhibit the cytotoxicity (not shown), suggesting
that they lysed the targets in a TCR/CD3-independent and
MHC-unrestricted manner.
|
C). In contrast, HUT78, K562, and THP-1 cells, which were
not lysed by the CD4+ T cell clones, were resistant to the
hTRAIL/2PK-3-mediated cytotoxicity. These results suggest a possible
involvement of TRAIL in the CD4+ T cell-mediated
cytotoxicity against Jurkat, HaCaT, and PEER cells. Expression of TRAIL on CD4+ T cell clones
Although the expression of TRAIL at the mRNA level has been
demonstrated in various tissues and cells, including activated T cells
3, 4, 51 , little is known about its expression and regulation at the
protein level. Therefore, we examined the cell-surface expression of
TRAIL on CD4+ T cell clones by flow cytometry using the
RIK-2 mAb. As represented in Fig. 4,
substantial expression of TRAIL was detected on the surface of resting
CD4+ T cell clones without anti-CD3 stimulation. We
previously demonstrated that the expression of FasL was inducible on
the T cell surface in response to cross-linking of TCR/CD3 or
stimulation with PMA + ionomycin 36, 41 . Consistent with this,
substantial levels of FasL expression were observed on HK12 and 4HM1
cells 3 h after the anti-CD3 stimulation, while resting HK12
and 4HM1 cells expressed only marginal levels of FasL on the surface
(Fig. 4). In contrast to FasL, the anti-CD3 stimulation hardly
affected the expression level of TRAIL as compared with the resting
state (Fig. 4). Even after a longer, 24-h culture, the cell surface
level of TRAIL was not significantly changed by the stimulation with
anti-CD3, anti-CD3 + anti-CD28, or PMA + ionomycin (not
shown). Similar results were obtained with all the other
CD4+ T cell clones tested (not shown). These results
indicated a differential regulation of the FasL and TRAIL expression on
CD4+ T cell clones, with the former being inducible upon
TCR/CD3 stimulation but the latter appearing constitutive and
unresponsive to TCR/CD3 stimulation.
|
We finally addressed whether TRAIL is involved in the spontaneous
cytotoxic activity of CD4+ T cell clones against Jurkat,
HaCaT, and PEER cells. As represented in Fig. 5, A through C,
spontaneous cytotoxicity exerted by resting HK12 cells against Jurkat
cells (Fig. 5A), HaCaT cells (Fig. 5B), and PEER
cells (Fig. 5C) was almost completely abrogated by the
addition of the anti-TRAIL mAb (RIK-2) alone. In contrast, only
marginal inhibition was observed in the presence of anti-FasL mAb
(NOK-2). A similar inhibition by RIK-2 but not by NOK-2 was also
observed for all of the other CD4+ T cell clones tested
(data not shown). These results clearly indicated that the TRAIL
expressed on these CD4+ T cell clones (Fig. 4) was fully
responsible for their spontaneous cytotoxic activity against Jurkat,
HaCaT, and PEER target cells.
|
. As represented in
Fig. 5, A and B (bottom), NOK-2 alone, but not
RIK-2 alone, partially inhibited the cytotoxicity, and the combination
of RIK-2 and NOK-2 almost completely abrogated the cytotoxic activities
of anti-CD3-activated HK12 cells against Jurkat (A) and
HaCaT (B) target cells. In contrast, when a FasL-resistant
cell line, PEER, was used as the target, the addition of RIK-2
alone but not NOK-2 alone almost completely abrogated the cytotoxic
activity of anti-CD3-activated HK12 cells (Fig. 5C).
Similar results were obtained with all of the other CD4+ T
cell clones tested (data not shown). These results indicated that both
the TRAIL and the FasL expressed on the anti-CD3-activated
CD4+ T cell clones (Fig. 4) were responsible for mediating
the cytotoxic activities against Jurkat and HaCaT target cells and that
TRAIL, but not FasL, mediated cytotoxic activity of these cells against
PEER target cells.
We finally examined whether TRAIL can participate in the Ag-specific
cytotoxicity of CD4+ T cell clones. Since the antigenic
specificities of the T cell clones used in the present study were
unknown, we used the (OKT-3Xanti-NP)-redirected cytotoxicity
against NP-labeled HaCaT cells to mimic the TCR/CD3-mediated cognate
interaction with target cells. As represented in Fig. 5D,
RIK-2 and NOK-2, each used alone, partially inhibited the cytotoxicity,
and the combination of RIK-2 and NOK-2 almost completely abrogated the
redirected cytotoxic activity of HK12 cells against HaCaT cells. These
results suggest that when HK12 cells encounter the TRAIL- and
FasL-sensitive target bearing specific Ag, both TRAIL and FasL can
participate in the Ag-specific cytotoxicity.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, Jeremias et al. reported the expression of TRAIL mRNA in human peripheral blood T cells following activation with anti-CD3 mAb or PMA + ionomycin, but they did not address the protein expression and function 51 . More recently, Mariani and Krammer demonstrated expression of the TRAIL protein on murine activated T cells by utilizing a rabbit polyclonal Ab to a peptide sequence in the extracellular region of hTRAIL 52 . In the present study, we observed that all six human CD4+ T cell clones that we tested constitutively expressed TRAIL on cell surface. A very recent study by Thomas and Hersey 53 demonstrated that each of four human CD4+ T cell clones that had been raised against autologous melanoma cells exhibited TRAIL-mediated cytotoxicity against Jurkat cells in an Ag-nonspecific and MHC-unrestricted manner, as we observed with our T cell clones in the present study. Although they did not examine the possibly constitutive expression of TRAIL on their T cell clones, their results also suggest that TRAIL can be generally expressed on long-term cultured human CD4+ T cell clones without specific Ag stimulation. In our ongoing study with RIK-2 mAb, surface expression of TRAIL is not detectable on freshly isolated peripheral blood T cells but is inducible upon continuous stimulation with anti-CD3, especially in the presence of IL-2, suggesting a critical contribution of cytokines (unpublished data). Therefore, it is possible that the constitutive expression of TRAIL observed on the CD4+ T cell clones was due to a continuous stimulation with IL-2 supplemented to the culture. Further studies are now under way to characterize the cytokines that regulate the TRAIL expression.
The apparently differential regulation of FasL and TRAIL expression on T cells may be relevant to their differential roles in the immune system. It is well known that FasL plays critical roles, not only in mediating T cell cytotoxicity but also in maintaining T cell homeostasis and tolerance 1, 17, 18, 19 . Preactivated T cells up-regulate Fas expression and undergo apoptosis in response to FasL expressed on neighboring T cells or APCs. In contrast, preactivated T cells appear to be highly resistant to TRAIL-induced apoptosis. Jeremias et al. reported that peripheral blood T cells remained resistant to rTRAIL even after prolonged activation with PHA and IL-2 51 . We also observed that neither T cell blasts nor the CD4+ T cell clones used in this study were sensitive to the TRAIL transfectant- or rTRAIL-mediated cytotoxicity (our unpublished data). Moreover, the addition of NOK-2, but not RIK-2, almost completely inhibited the activation-induced cell death (AICD) of anti-CD3-stimulated HK12 cells, suggesting little if any contribution of TRAIL to AICD. Some other possible contributions of TRAIL to immune responses are now under investigation.
Possibly another way of differential regulation of TRAIL and FasL at
the posttranslational processing has been recently suggested by Mariani
and Krammer 54 . They reported that hTRAIL might be processed to be a
19–20-kDa soluble form by leupeptin- and E64-sensitive cysteine
proteases, in contrast to FasL, which is processed by E64-resistant
metalloproteases, and that cell surface staining with a rabbit
anti-TRAIL polyclonal Ab was enhanced by treatment of Jurkat cells
with the cysteine protease inhibitors 54 . However, they did not
address cytotoxic activity of the naturally processed soluble TRAIL. In
reference to their results, we examined the effect of various protease
inhibitors, including leupeptin, E64, and a metalloproteinase inhibitor
(KB-R8301) that inhibited the processing of TNF- and FasL 36 , but
we could not detect the enhancement of surface TRAIL expression on our
hTRAIL transfectants or human CD4+ T cell clones (data not
shown). We also could not detect cytotoxic activity against Jurkat or
HaCaT cells in supernatants of the TRAIL transfectants or the human
CD4+ T cell clones (data not shown), but this does not
formally exclude the presence of weakly cytotoxic soluble TRAIL, as has
been observed with soluble FasL that could not efficiently lyse Jurkat
cells 42, 55, 56 . Therefore, while further biochemical analysis will
be needed to characterize the processing, TRAIL appears to act as a
proapoptotic ligand primarily in the membrane-bound form, as does FasL.
Our present study supplements TRAIL as an additional effector molecule
mediating T cell cytotoxicity. It has been suggested that perforin and
FasL constitute two predominant pathways of T cell-mediated
cytotoxicity 17, 18, 19 . TNF- and lymphotoxin also participate in the
T cell cytotoxicity against certain target cells 31, 32, 33 . The relative
contribution of these multiple effector molecules appears to be
variable depending on their expression in the effector T cells and
susceptibility of the target cells to these molecules. Perforin can be
expressed in almost all CD8+ T cells and a minor population
of CD4+ T cells 38 . FasL can be expressed on almost all
CD4+ T cells and CD8+ T cells, except for some
Th2 clones 57, 58 . The possibly differential expression of TRAIL
among T cell subpopulations remains to be determined. With respect to
target susceptibility, perforin can potentially lyse any target cells
by making pores in the plasma membrane. In contrast, FasL and TRAIL
require expression of the death-inducing receptors on the target cells.
FasL induces target cell apoptosis via its receptor, Fas, which
recruits FADD (Fas-associated death domain) and activates FLICE
(FADD-like IL-1ß-converting enzyme; caspase 8) and the
subsequent caspase cascade 1, 2 . However, it is known that solely the
expression of Fas does not always determine the susceptibility to
FasL-induced apoptosis, which may be explained by the expression of
antiapoptotic molecules such as Bcl-2 or FLIP, which antagonizes FLICE
1, 2, 59, 60 . The TRAIL case is more complicated. TRAIL induces
target cell apoptosis via TRAIL-R1 and TRAIL-R2, which recruit FADD or
a FADD-like adapter and activate FLICE or FLICE-2 (caspase-10) and the
subsequent caspase cascade, as does Fas. However, it has been shown
that TRAIL-R1 and TRAIL-R2 also recruit TRADD and activate NF-B,
which may act protectively against apoptosis 61 . Moreover, TRAIL also
binds to antagonistic receptors, including TRAIL-R3, which lacks a
cytoplasmic domain, and TRAIL-R4, which does not induce apoptosis but
activates NF-B and protects against TRAIL-R1- and TRAIL-R2-mediated
apoptosis 9, 10, 11, 12, 13, 14, 15, 16 . Therefore, the susceptibility to TRAIL would be
determined primarily by the relative expression of these agonistic and
antagonistic receptors, and secondarily by cellular resistance to the
FADD-mediated apoptosis pathway, as in the case of FasL. RT-PCR
analysis for expression of the TRAIL-R mRNA in the TRAIL-susceptible
target cell lines used in this study showed that Jurkat cells expressed
TRAIL-R2 and TRAIL-R3 but not TRAIL-R1 or TRAIL-R4 and that both HaCaT
and PEER cells expressed TRAIL-R2, TRAIL-R3, and TRAIL-R4 but not
TRAIL-R1 (data not shown). The relative contribution of each agonistic
or antagonistic receptor to TRAIL sensitivity remains to be determined
by using the mAb specific to each receptor.
It has been suggested that TRAIL induces apoptosis preferentially in transformed cells but not in normal cells, possibly because of preferential expression of TRAIL-R3 in the latter 9, 13 . Consistent with this, we also found that cells of the transformed keratinocyte cell line HaCaT, but not normal keratinocytes, were sensitive to TRAIL (unpublished data). Therefore, it is possible that FasL and TRAIL may act complementarily to eliminate a variety of transformed cells in an immune surveillance system. In this respect, it is noteworthy that TRAIL-R2 has been also identified as a p53-inducible tumor suppressor gene 6 , suggesting a contribution of TRAIL to the elimination of DNA-damaged cells. In the present study, we showed that TRAIL can mediate CD4+ T cell cytotoxicity against a FasL-resistant lymphoma cell line, PEER. Furthermore, a recent study demonstrated that 7 of 10 FasL-resistant human melanoma cell lines were susceptible to TRAIL-induced apoptosis and that TRAIL at least partly mediated Ag-specific cytotoxicity of human CD4+ T cell clones against FasL-resistant melanoma cells 53 . Therefore, it is possible that the TRAIL-mediated cytotoxicity by CD4+ T cells might play an important role, especially in the elimination of such FasL-resistant tumor cells.
Physiological and pathological roles of TRAIL remain to be determined. The TRAIL-mediated T cell cytotoxicity may be involved in the clearance of virus- or intracellular pathogen-infected cells and the rejection of allografts, which were independent of either perforin or FasL 22, 23, 62, 63, 64 . It is also interesting to note that TRAIL may be involved in the pathogenesis of AIDS. Recently, Jeremias et al. 51 reported that peripheral blood T cells from HIV-infected patients were susceptible to TRAIL-induced apoptosis, and Katsikis et al. 65 reported that anti-CD3-induced AICD of peripheral blood T cells from some HIV-infected patients was inhibited by an anti-TRAIL mAb but not by anti-FasL mAb. The anti-TRAIL mAbs generated in the present study will be useful for investigating further the expression and function of TRAIL in HIV infection.
The Ag specificity of T cell-mediated cytotoxicity is a favorable feature that can selectively eliminate the Ag-presenting target cells without damaging bystander normal cells. However, it is well known that Ag-specific CTL can cause bystander lysis of certain target cells once activated by specific target cells 33, 66 . We previously demonstrated that the perforin-mediated cytotoxicity is highly Ag-specific, but the FasL-mediated cytotoxicity participates in both Ag-specific and bystander cytotoxicities 33 . In the present study, we also demonstrated that TRAIL can also participate in both Ag-specific and bystander T cell cytotoxicities against TRAIL-sensitive target cells but apparently without stimulation with specific Ag. This difference results from the constitutive nature of TRAIL expression on the T cell clones, which appears to be primarily regulated by cytokines. It has been also shown by others that Ag-specific CD4+ T cell clones exhibited Ag-nonspecific and MHC-unrestricted cytotoxicity against certain target cells when cultured with IL-2, some of which might be partly mediated by FasL 67 . Such an Ag-nonspecific cytotoxicity mediated by TRAIL and FasL may be relevant to unfavorable consequences of chronic activation of CD4+ T cells that lead to inflammatory tissue damages in pathological situations, including some autoimmune diseases and infections. On the other hand, the TRAIL-mediated MHC-unrestricted cytotoxicity of CD4+ T cells may be more useful for the eradication of MHC class II-negative tumor cells than the FasL-mediated cytotoxicity, because the latter can cause a serious liver damage, whereas the former does not 56 . Further studies on the regulation of TRAIL expression in T cells will provide new insights into physiological and pathological roles of TRAIL-mediated cytotoxicity and its potential application to tumor immunotherapy.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hideo Yagita, Department of Immunology, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan. E-mail address:
3 Abbreviations used in this paper: FasL, Fas ligand; hFasL, human FasL; TRAIL, TNF-related apoptosis-inducing ligand; TRAIL-R, TRAIL receptor; h, human; CMA, concanamycin A; NP, nitrophenol; PE, phycoerythrin; AICD, activation-induced cell death.
Received for publication July 10, 1998. Accepted for publication November 18, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 7:813.[Medline]
pathways as specific and bystander killing mechanisms of hepatitis C virus-specific human CTL. J. Immunol. 158:5283.[Abstract]
precursor by metalloproteinases. Nature 370:555.[Medline]
processing by a metalloproteinase inhibitor. Nature 370:558.[Medline]
elicits antitumor CD4+ MHC class II-restricted T cells that are cytolytic in vitro and tumoricidal in vivo. J. Immunol. 154:4613.[Abstract]
B pathway. Immunity 7:821.[Medline]
This article has been cited by other articles:
|
|
 |
|
  K. Haraguchi, T. Suzuki, N. Koyama, K. Kumano, F. Nakahara, A. Matsumoto, Y. Yokoyama, M. Sakata-Yanagimoto, S. Masuda, T. Takahashi, et al. Notch Activation Induces the Generation of Functional NK Cells from Human Cord Blood CD34-Positive Cells Devoid of IL-15 J. Immunol., May 15, 2009; 182(10): 6168 - 6178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Umeshappa, H. Huang, Y. Xie, Y. Wei, S. J. Mulligan, Y. Deng, and J. Xiang CD4+ Th-APC with Acquired Peptide/MHC Class I and II Complexes Stimulate Type 1 Helper CD4+ and Central Memory CD8+ T Cell Responses J. Immunol., January 1, 2009; 182(1): 193 - 206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. J. Wang, K.-i. Hanada, and J. C. Yang Characterization of a Novel Nonclassical T Cell Clone with Broad Reactivity against Human Renal Cell Carcinomas J. Immunol., September 15, 2008; 181(6): 3769 - 3776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. K. Persson, A. M. Agnarson, H. Lambert, N. Hitziger, H. Yagita, B. J. Chambers, A. Barragan, and A. Grandien Death Receptor Ligation or Exposure to Perforin Trigger Rapid Egress of the Intracellular Parasite Toxoplasma gondii J. Immunol., December 15, 2007; 179(12): 8357 - 8365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sun and P. J. Fink A New Class of Reverse Signaling Costimulators Belongs to the TNF Family J. Immunol., October 1, 2007; 179(7): 4307 - 4312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-X. Du, H.-Q. Wang, H.-Y. Zhang, and D.-X. Gao Involvement of Glyceraldehyde-3-Phosphate Dehydrogenase in Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Mediated Death of Thyroid Cancer Cells Endocrinology, September 1, 2007; 148(9): 4352 - 4361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Rus, V. Nguyen, R. Puliaev, I. Puliaeva, V. Zernetkina, I. Luzina, J. C. Papadimitriou, and C. S. Via T Cell TRAIL Promotes Murine Lupus by Sustaining Effector CD4 Th Cell Numbers and by Inhibiting CD8 CTL Activity J. Immunol., March 15, 2007; 178(6): 3962 - 3972. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Eidsmo, C. Fluur, B. Rethi, S. Eriksson Ygberg, N. Ruffin, A. De Milito, H. Akuffo, and F. Chiodi FasL and TRAIL Induce Epidermal Apoptosis and Skin Ulceration Upon Exposure to Leishmania major Am. J. Pathol., January 1, 2007; 170(1): 227 - 239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Heemskerk, T. van Vreeswijk, L. A. Veltrop-Duits, C. C. Sombroek, K. Franken, R. M. Verhoosel, P. S. Hiemstra, D. van Leeuwen, M. E. Ressing, R. E. M. Toes, et al. Adenovirus-Specific CD4+ T Cell Clones Recognizing Endogenous Antigen Inhibit Viral Replication In Vitro through Cognate Interaction J. Immunol., December 15, 2006; 177(12): 8851 - 8859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Berent-Maoz, A. M. Piliponsky, I. Daigle, H.-U. Simon, and F. Levi-Schaffer Human Mast Cells Undergo TRAIL-Induced Apoptosis J. Immunol., February 15, 2006; 176(4): 2272 - 2278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Sato, A. Niessner, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque J. Exp. Med., January 23, 2006; 203(1): 239 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. K. Rowinsky Targeted Induction of Apoptosis in Cancer Management: The Emerging Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor Activating Agents J. Clin. Oncol., December 20, 2005; 23(36): 9394 - 9407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Clancy, K. Mruk, K. Archer, M. Woelfel, J. Mongkolsapaya, G. Screaton, M. J. Lenardo, and F. K.-M. Chan Preligand assembly domain-mediated ligand-independent association between TRAIL receptor 4 (TR4) and TR2 regulates TRAIL-induced apoptosis PNAS, December 13, 2005; 102(50): 18099 - 18104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-P. Herbeuval, J.-C. Grivel, A. Boasso, A. W. Hardy, C. Chougnet, M. J. Dolan, H. Yagita, J. D. Lifson, and G. M. Shearer CD4+ T-cell death induced by infectious and noninfectious HIV-1: role of type 1 interferon-dependent, TRAIL/DR5-mediated apoptosis Blood, November 15, 2005; 106(10): 3524 - 3531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Wang, Z. Cao, J. M. Wolf, M. Van Antwerp, and J. R. Baker Jr. Death Ligand Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Inhibits Experimental Autoimmune Thyroiditis Endocrinology, November 1, 2005; 146(11): 4721 - 4726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Abraham, J. Schafer, M. Rothe, J. Bange, P. Knyazev, and A. Ullrich Identification of MMP-15 as an Anti-apoptotic Factor in Cancer Cells J. Biol. Chem., October 7, 2005; 280(40): 34123 - 34132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kuwashima, F. Nishimura, J. Eguchi, H. Sato, M. Hatano, T. Tsugawa, T. Sakaida, J. E. Dusak, W. K. Fellows-Mayle, G. D. Papworth, et al. Delivery of Dendritic Cells Engineered to Secrete IFN-{alpha} into Central Nervous System Tumors Enhances the Efficacy of Peripheral Tumor Cell Vaccines: Dependence on Apoptotic Pathways J. Immunol., August 15, 2005; 175(4): 2730 - 2740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Matsuda, A. Almasan, M. Tomita, K. Tamaki, M. Saito, M. Tadano, H. Yagita, T. Ohta, and N. Mori Dengue virus-induced apoptosis in hepatic cells is partly mediated by Apo2 ligand/tumour necrosis factor-related apoptosis-inducing ligand J. Gen. Virol., April 1, 2005; 86(4): 1055 - 1065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sato, T. Nakaoka, N. Yamashita, H. Yagita, H. Kawasaki, C. Morimoto, M. Baba, and T. Matsuyama TRAIL-Transduced Dendritic Cells Protect Mice from Acute Graft-versus-Host Disease and Leukemia Relapse J. Immunol., April 1, 2005; 174(7): 4025 - 4033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-P. Herbeuval, A. Boasso, J.-C. Grivel, A. W. Hardy, S. A. Anderson, M. J. Dolan, C. Chougnet, J. D. Lifson, and G. M. Shearer TNF-related apoptosis-inducing ligand (TRAIL) in HIV-1-infected patients and its in vitro production by antigen-presenting cells Blood, March 15, 2005; 105(6): 2458 - 2464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-H. Chou, H.-F. Tsai, Y.-Y. Wu, C.-Y. Hu, L.-H. Hwang, P.-I. Hsu, and P.-N. Hsu Hepatitis C Virus Core Protein Modulates TRAIL-Mediated Apoptosis by Enhancing Bid Cleavage and Activation of Mitochondria Apoptosis Signaling Pathway J. Immunol., February 15, 2005; 174(4): 2160 - 2166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Matsuda, A. Almasan, M. Tomita, J.-n. Uchihara, M. Masuda, K. Ohshiro, N. Takasu, H. Yagita, T. Ohta, and N. Mori Resistance to Apo2 Ligand (Apo2L)/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL)-Mediated Apoptosis and Constitutive Expression of Apo2L/TRAIL in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines J. Virol., February 1, 2005; 79(3): 1367 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. Jellison, S.-K. Kim, and R. M. Welsh Cutting Edge: MHC Class II-Restricted Killing In Vivo during Viral Infection J. Immunol., January 15, 2005; 174(2): 614 - 618. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Poulaki, C. S. Mitsiades, C. McMullan, G. Fanourakis, J. Negri, A. Goudopoulou, I. X. Halikias, G. Voutsinas, S. Tseleni-Balafouta, J. W. Miller, et al. Human Retinoblastoma Cells Are Resistant to Apoptosis Induced by Death Receptors: Role of Caspase-8 Gene Silencing Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 358 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yamamoto, H. Nagano, M. Sakon, H. Wada, H. Eguchi, M. Kondo, B. Damdinsuren, H. Ota, M. Nakamura, H. Wada, et al. Partial Contribution of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL)/TRAIL Receptor Pathway to Antitumor Effects of Interferon-{alpha}/5-Fluorouracil against Hepatocellular Carcinoma Clin. Cancer Res., December 1, 2004; 10(23): 7884 - 7895. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Koga, A. Matsuzaki, A. Suminoe, H. Hattori, and T. Hara Neutrophil-Derived TNF-Related Apoptosis-Inducing Ligand (TRAIL): A Novel Mechanism of Antitumor Effect by Neutrophils Cancer Res., February 1, 2004; 64(3): 1037 - 1043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nikiforow, K. Bottomly, G. Miller, and C. Munz Cytolytic CD4+-T-Cell Clones Reactive to EBNA1 Inhibit Epstein-Barr Virus-Induced B-Cell Proliferation J. Virol., November 15, 2003; 77(22): 12088 - 12104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wang, Z. F. H. M. Boonman, H.-C. Li, Y. He, M. J. Jager, R. E. M. Toes, and J. Y. Niederkorn Role of TRAIL and IFN-{gamma} in CD4+ T Cell-Dependent Tumor Rejection in the Anterior Chamber of the Eye J. Immunol., September 15, 2003; 171(6): 2789 - 2796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kotelkin, E. A. Prikhod'ko, J. I. Cohen, P. L. Collins, and A. Bukreyev Respiratory Syncytial Virus Infection Sensitizes Cells to Apoptosis Mediated by Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand J. Virol., September 1, 2003; 77(17): 9156 - 9172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Uno, T. Inukai, N. Kayagaki, K. Goi, H. Sato, A. Nemoto, K. Takahashi, K. Kagami, N. Yamaguchi, H. Yagita, et al. TNF-related apoptosis-inducing ligand (TRAIL) frequently induces apoptosis in Philadelphia chromosome-positive leukemia cells Blood, May 1, 2003; 101(9): 3658 - 3667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Miura, N. Misawa, Y. Kawano, H. Okada, Y. Inagaki, N. Yamamoto, M. Ito, H. Yagita, K. Okumura, H. Mizusawa, et al. Tumor necrosis factor-related apoptosis-inducing ligand induces neuronal death in a murine model of HIV central nervous system infection PNAS, March 4, 2003; 100(5): 2777 - 2782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-Y. Dietrich, P. R. Walker, and P. Saas Death receptors on reactive astrocytes: A key role in the fine tuning of brain inflammation? Neurology, February 25, 2003; 60(4): 548 - 554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Washburn, M. A. Weigand, A. Grosse-Wilde, M. Janke, H. Stahl, E. Rieser, M. R. Sprick, V. Schirrmacher, and H. Walczak TNF-Related Apoptosis-Inducing Ligand Mediates Tumoricidal Activity of Human Monocytes Stimulated by Newcastle Disease Virus J. Immunol., February 15, 2003; 170(4): 1814 - 1821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Yanai, E. Ishii, K. Kojima, A. Hasegawa, T. Azuma, S. Hirose, N. Suga, A. Mitsudome, M. Zaitsu, Y. Ishida, et al. Essential Roles of Perforin in Antigen-Specific Cytotoxicity Mediated by Human CD4+ T Lymphocytes: Analysis Using the Combination of Hereditary Perforin-Deficient Effector Cells and Fas-Deficient Target Cells J. Immunol., February 15, 2003; 170(4): 2205 - 2213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakayama, K. Ishidoh, Y. Kojima, N. Harada, E. Kominami, K. Okumura, and H. Yagita Fibroblast Growth Factor-Inducible 14 Mediates Multiple Pathways of TWEAK-Induced Cell Death J. Immunol., January 1, 2003; 170(1): 341 - 348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Mahr, J. M. Boss, and L. R. Gooding The Adenovirus E3 Promoter Is Sensitive to Activation Signals in Human T Cells J. Virol., December 20, 2002; 77(2): 1112 - 1119. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Matysiak, A. Jurewicz, D. Jaskolski, and K. Selmaj TRAIL induces death of human oligodendrocytes isolated from adult brain Brain, November 1, 2002; 125(11): 2469 - 2480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Wang, X. Wang, A. Hernandez, M. R. Hellmich, Z. Gatalica, and B. M. Evers Regulation of TRAIL Expression by the Phosphatidylinositol 3-Kinase/Akt/GSK-3 Pathway in Human Colon Cancer Cells J. Biol. Chem., September 20, 2002; 277(39): 36602 - 36610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Soderstrom, M. Poukkula, T. H. Holmstrom, K. M. Heiskanen, and J. E. Eriksson Mitogen-Activated Protein Kinase/Extracellular Signal-Regulated Kinase Signaling in Activated T Cells Abrogates TRAIL-Induced Apoptosis Upstream of the Mitochondrial Amplification Loop and Caspase-8 J. Immunol., September 15, 2002; 169(6): 2851 - 2860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. VanLith, K. G. Kohlgraf, C. L. Sivinski, R. M. Tempero, and M. A. Hollingsworth MUC1-specific anti-tumor responses: molecular requirements for CD4-mediated responses Int. Immunol., August 1, 2002; 14(8): 873 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dorothee, I. Vergnon, J. Menez, H. Echchakir, D. Grunenwald, M. Kubin, S. Chouaib, and F. Mami-Chouaib Tumor-Infiltrating CD4+ T Lymphocytes Express APO2 Ligand (APO2L)/TRAIL upon Specific Stimulation with Autologous Lung Carcinoma Cells: Role of IFN-{alpha} on APO2L/TRAIL Expression and -Mediated Cytotoxicity J. Immunol., July 15, 2002; 169(2): 809 - 817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Lu, B. M. Janjic, J. Janjic, T. L. Whiteside, W. J. Storkus, and N. L. Vujanovic Innate Direct Anticancer Effector Function of Human Immature Dendritic Cells. II. Role of TNF, Lymphotoxin-{alpha}1{beta}2, Fas Ligand, and TNF-Related Apoptosis-Inducing Ligand J. Immunol., February 15, 2002; 168(4): 1831 - 1839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakayama, K. Ishidoh, N. Kayagaki, Y. Kojima, N. Yamaguchi, H. Nakano, E. Kominami, K. Okumura, and H. Yagita Multiple Pathways of TWEAK-Induced Cell Death J. Immunol., January 15, 2002; 168(2): 734 - 743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Siegmund, A. Hausser, N. Peters, P. Scheurich, and H. Wajant Tumor Necrosis Factor (TNF) and Phorbol Ester Induce TNF-related Apoptosis-inducing Ligand (TRAIL) under Critical Involvement of NF-kappa B Essential Modulator (NEMO)/IKKgamma J. Biol. Chem., November 16, 2001; 276(47): 43708 - 43712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Tollefson, K. Toth, K. Doronin, M. Kuppuswamy, O. A. Doronina, D. L. Lichtenstein, T. W. Hermiston, C. A. Smith, and W. S. M. Wold Inhibition of TRAIL-Induced Apoptosis and Forced Internalization of TRAIL Receptor 1 by Adenovirus Proteins J. Virol., October 1, 2001; 75(19): 8875 - 8887. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.-O. Vidalain, O. Azocar, H. Yagita, C. Rabourdin-Combe, and C. Servet-Delprat Cytotoxic Activity of Human Dendritic Cells Is Differentially Regulated by Double-Stranded RNA and CD40 Ligand J. Immunol., October 1, 2001; 167(7): 3765 - 3772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Baetu, H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott Disruption of NF-{kappa}B Signaling Reveals a Novel Role for NF-{kappa}B in the Regulation of TNF-Related Apoptosis-Inducing Ligand Expression J. Immunol., September 15, 2001; 167(6): 3164 - 3173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ogawa, K. Tanaka, A. Ishii, Y. Nakamura, S. Kondo, K. Sugamura, S. Takano, M. Nakamura, and K. Nagata A Novel Serum Protein That Is Selectively Produced by Cytotoxic Lymphocytes J. Immunol., May 15, 2001; 166(10): 6404 - 6412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nieda, A. Nicol, Y. Koezuka, A. Kikuchi, N. Lapteva, Y. Tanaka, K. Tokunaga, K. Suzuki, N. Kayagaki, H. Yagita, et al. TRAIL expression by activated human CD4+V{alpha}24NKT cells induces in vitro and in vivo apoptosis of human acute myeloid leukemia cells Blood, April 1, 2001; 97(7): 2067 - 2074. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Smyth, E. Cretney, K. Takeda, R. H. Wiltrout, L. M. Sedger, N. Kayagaki, H. Yagita, and K. Okumura Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (Trail) Contributes to Interferon {gamma}-Dependent Natural Killer Cell Protection from Tumor Metastasis J. Exp. Med., March 19, 2001; 193(6): 661 - 670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Miura, N. Misawa, N. Maeda, Y. Inagaki, Y. Tanaka, M. Ito, N. Kayagaki, N. Yamamoto, H. Yagita, H. Mizusawa, et al. Critical Contribution of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (Trail) to Apoptosis of Human Cd4+T Cells in HIV-1-Infected Hu-Pbl-Nod-Scid Mice J. Exp. Med., March 5, 2001; 193(5): 651 - 660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Wei, H. Yagita, M. G. Masucci, and V. Levitsky Different Programs of Activation-Induced Cell Death Are Triggered in Mature Activated CTL by Immunogenic and Partially Agonistic Peptide Ligands J. Immunol., January 15, 2001; 166(2): 989 - 995. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakayama, N. Kayagaki, N. Yamaguchi, K. Okumura, and H. Yagita Involvement of Tweak in Interferon {gamma}-Stimulated Monocyte Cytotoxicity J. Exp. Med., November 6, 2000; 192(9): 1373 - 1380. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Routes, S. Ryan, A. Clase, T. Miura, A. Kuhl, T. A. Potter, and J. L. Cook Adenovirus E1A Oncogene Expression in Tumor Cells Enhances Killing by TNF-Related Apoptosis-Inducing Ligand (TRAIL) J. Immunol., October 15, 2000; 165(8): 4522 - 4527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Griffith, R. D. Anderson, B. L. Davidson, R. D. Williams, and T. L. Ratliff Adenoviral-Mediated Transfer of the TNF-Related Apoptosis-Inducing Ligand/Apo-2 Ligand Gene Induces Tumor Cell Apoptosis J. Immunol., September 1, 2000; 165(5): 2886 - 2894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-i. Wakamatsu, M. Makino, C. Tei, and M. Baba Monocyte-Driven Activation-Induced Apoptotic Cell Death of Human T-Lymphotropic Virus Type I-Infected T Cells J. Immunol., October 1, 1999; 163(7): 3914 - 3919. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kayagaki, N. Yamaguchi, M. Nakayama, K. Takeda, H. Akiba, H. Tsutsui, H. Okamura, K. Nakanishi, K. Okumura, and H. Yagita Expression and Function of TNF-Related Apoptosis-Inducing Ligand on Murine Activated NK Cells J. Immunol., August 15, 1999; 163(4): 1906 - 1913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kayagaki, N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita Type I Interferons (IFNs) Regulate Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Expression on Human T Cells: A Novel Mechanism for the Antitumor Effects of Type I IFNs J. Exp. Med., May 3, 1999; 189(9): 1451 - 1460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Rivera-Walsh, M. Waterfield, G. Xiao, A. Fong, and S.-C. Sun NF-kappa B Signaling Pathway Governs TRAIL Gene Expression and Human T-cell Leukemia Virus-I Tax-induced T-cell Death J. Biol. Chem., October 26, 2001; 276(44): 40385 - 40388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Muhlenbeck, P. Schneider, J.-L. Bodmer, R. Schwenzer, A. Hauser, G. Schubert, P. Scheurich, D. Moosmayer, J. Tschopp, and H. Wajant The Tumor Necrosis Factor-related Apoptosis-inducing Ligand Receptors TRAIL-R1 and TRAIL-R2 Have Distinct Cross-linking Requirements for Initiation of Apoptosis and Are Non-redundant in JNK Activation J. Biol. Chem., October 6, 2000; 275(41): 32208 - 32213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Benedict, P. S. Norris, T. I. Prigozy, J.-L. Bodmer, J. A. Mahr, C. T. Garnett, F. Martinon, J. Tschopp, L. R. Gooding, and C. F. Ware Three Adenovirus E3 Proteins Cooperate to Evade Apoptosis by Tumor Necrosis Factor-related Apoptosis-inducing Ligand Receptor-1 and -2 J. Biol. Chem., January 26, 2001; 276(5): 3270 - 3278. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), hFasL/2PK-3 (•), or 2PK-3 (
) was tested
against Jurkat cells in an 8-h [3H]TdR release assay at
the indicated E:T ratios. Data represent means ± SD of triplicate
samples. Similar results were obtained in two independent experiments.
C, Cytotoxic activity of TRAIL or FasL transfectants
against tumor cell lines. Cytotoxic activity of hTRAIL/2PK-3 (black
bars), hFasL/2PK-3 (hatched bars), or 2PK-3 (white bars) was tested
against the indicated target cells in an 8-h 51Cr release
assay at an E:T ratio of 10. Data represent means ± SD of
triplicate samples. Similar results were obtained in two independent
experiments.
) or
presence of serially diluted RIK-1 (
) in an 8-h
51Cr release assay at the indicated E:T ratios. Data
represent means ± SD of triplicate samples. Similar results were
obtained in two independent experiments. D,
OKT-3Xanti-NP-redirected HK12 cytotoxicity against NP-labeled HaCaT
cells was tested in the absence (