| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,§
*
Section of Immunobiology and
Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06520; and
Memorial Sloan Kettering Cancer Center and
§
Cornell University Graduate School of Medical Sciences, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß and 
T cell lineages is dependent
upon the rearrangement and expression of the TCR and ß or and
genes, respectively. Although the timing and sequence of
rearrangements of the TCR and TCRß loci in adult murine thymic
precursors has been characterized, no similar information is available
for the TCR and TCR loci. In this report, we show that
approximately half of the total TCR alleles initiate rearrangements
at the CD44highCD25+ stage, whereas the
TCRß locus is mainly in germline configuration. In the subsequent
CD44lowCD25+ stage, most TCR alleles are
fully recombined, whereas TCRß rearrangements are only complete on
10–30% of alleles. These results indicate that rearrangement at the
TCR locus can precede that of TCRß locus recombination by one
developmental stage. In addition, we find a bias toward productive
rearrangements of both TCR and TCR genes among
CD44highCD25+ thymocytes, suggesting that
functional TCR complexes can be formed before the rearrangement
of TCRß. These data support a model of lineage commitment in which
sequential TCR gene rearrangements may influence ß/ lineage
decisions. Further, because TCR gene rearrangements are generally
limited to T lineage cells, these analyses provide molecular evidence
that irreversible commitment to the T lineage can occur as early as the
CD44highCD25+ stage of
development. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß and , depending upon expression of the
respective TCRs 2, 3 . Expression of the -, ß-, -, and
-chains of the TCR requires somatic recombination of the V, D, and J
genes encoding the V domain of the corresponding TCR proteins 2, 3, 4 .
Because the TCR is thought to play an important role in the maturation,
expansion, and possibly lineage decisions of T cells 5, 6, 7 , the
relationship of intrathymic differentiation and proliferation to TCR
gene recombination has been the subject of considerable interest
(reviewed in 8 .
The successive steps of immature,
CD4-/CD8- thymocyte differentiation
have been characterized by surface expression of CD44 in the absence
(stage 1) or presence (stage 2) of CD25 followed by an initial
down-regulation of CD44 (stage 3) and subsequently of CD25 (stage 4)
9 . Stages 1 and 2 have been shown to have the TCRß and
TCR loci in germline configuration 10, 11 . Both partial (D to J)
and complete (V to DJ) rearrangements of the TCRß locus as well as V
to J rearrangements of the TCR locus occur primarily in stage 3 10, 12 . No further rearrangements of these loci (ß, , and ) are
known to occur after the transition to stage 4, which marks the onset
of TCR locus recombination and commitment to the ß lineage
13 .
Stage 1 precursors can give rise to multiple lineages, including both T
lineages 8 , NK cells 14 , and dendritic cells
(DCs)3, 15 , but not B cells
or myeloid cells 8 . Functional assays indicate that stage 3
thymocytes can no longer give rise to non-T lineage cells 1 , although
they retain the bipotential capacity to develop into both ß and
T cells 16 . Consequently, these studies illustrate the
progressive loss of multilineage potential during thymocyte
differentiation. However, the point of irreversible commitment within
the T lineages (i.e., ß or ) has not been determined.
Furthermore, the relationship between individual TCR gene
rearrangements and ß/ lineage divergence has not been
established. To address these questions, we characterized the
association of specific TCR gene rearrangements to cellular
differentiation in the adult murine thymus. Because non-T lineages
(i.e., B cells, NK cells, and DCs) do not undergo TCR gene
rearrangements 1, 17 , we reasoned that initiation of TCR locus
recombination would mark irreversible commitment to the T cell lineage.
Furthermore, such studies would be expected to provide additional
insights into the relationship between TCR expression and ß/
lineage decision. Our results indicate that TCR gene rearrangements
on most alleles initiate during stage 2, suggesting that T lineage
commitment can occur as early as this stage. Analysis of the relative
distribution of productive TCR and TCR rearrangements further
suggests that commitment to the lineage can occur one
developmental stage earlier than that of ß lineage cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For the preparation of triple-negative (TN) thymocytes and peripheral lymph node (LN) B and T cells, C57BL/6 mice were used; these mice were originally purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained at the Animal Facilities of Memorial Sloan Kettering Cancer Center. TCRß-deficient and SCID mutant mice were purchased from the Jackson Laboratory.
Cell preparation and flow cytometric analyses
Preparation of thymocytes lacking CD3/CD4/CD8 expression was
performed as described previously 18 . Briefly,
CD3+/CD4+/CD8+ cells from
pools of 20 freshly isolated thymi were depleted by two sequential
rounds of treatment with mAbs specific for each of these proteins
followed by anti-Ig-coated paramagnetic beads.
CD3-/CD4-/CD8- cells were
then stained with fluorochrome-conjugated mAbs specific for CD24, CD25,
and CD44 and purified by cell sorting. For analysis of TCR
expression on early thymocyte precursors, CD3 was omitted from the
depletion steps; Ab specific for TCR (GL3) was included in the
immunofluorescent staining. LN B and T cells from individual mice were
purified by cell sorting after staining with fluorochrome-conjugated
mAbs specific for CD24 and TCRß, respectively.
Nucleic acid preparation and hybridization
High-m.w. DNA was prepared from total single-cell suspensions
embedded in low melting point agarose plugs 12 , EcoRI
digested, and Southern blotted 18 . The same membrane hybridized to
TCRß locus-specific probes and published previously 18 was
hybridized first to a mixture of radiolabeled probe 4 and
recombination-activating gene (RAG)-1 19 , followed by hybridization
to a mixture of V4- and V7-specific probes. The V probes were
generated by PCR amplification of C57BL/6 kidney DNA with the following
primers: 5V4, GGGGATCCAACCTGGCAGATGAGA; 3V4,
TCTGGATCCAAGGAATATATTGTCA; 5V7, CTCGGATCCTACTTCTAGCTTTCT; and
3V7, GCGGATCCAGGAGGCACAGTAGTA. Rehybridization using only the
V4 probe (data not shown) unambiguously identified the two
polymorphic germline and rearranged bands that are marked as "A"
and "B" on Fig. 2
. Quantitative analysis was performed on a
PhosphorImager using ImageQuant 3.0 software (Molecular Dynamics,
Sunnyvale, CA).
|
High-m.w. DNA prepared from various thymocyte populations 20
was amplified for 30 cycles with Taq DNA polymerase in a
thermocycler using V gene-specific forward and J gene-specific reverse
primers 19, 21 . The following primers were used to amplify TCRß
locus rearrangements: 5Vß8, GCATTCTAGATGGTCCCAAGATGGGC; 5Dß1,
GTGAATTCTTCCAGCCCTCAA; and 3Jß1.6,
GGCGAATTCCAAAGGACAATGGTCCC. The PCR products were separated by
sieving agarose electrophoresis, Southern blotted, and hybridized to
radiolabeled oligonucleotide probes identical with the specific 3'
primer sequences. Parallel reactions with nonlymphoid kidney DNA also
ensured that the bands detected in thymocyte subsets were specific for
TCR gene rearrangements (data not shown). The nonrearranging RAG-2 gene
was amplified with primers 22 that generate an 
1600-bp product;
this product is expected to amplify less efficiently than the smaller
rearranged TCR gene products.
PCR restriction fragment length polymorphism (RFLP) analysis
PCR RFLP analysis was performed using 5' end radiolabeled
reverse primers specific for the J1, J1, and J4 genes 19, 21
and V gene-specific forward primers (see above). The purified PCR
products were digested with AluI (V4),
Eco47III (V5), BbsI (V6), Bsu36I
(V1), or ClaI (V4) restriction enzymes, separated on
6% denaturing polyacrylamide gels, and imaged with a PhosphorImager.
The relative intensity of the rearranged bands was calculated with
ImageQuant 3.0 software.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and TCR loci in adult TN
thymocytes
Previously, we have described quantitative Southern blot assays
that can accurately measure the extent of partial D to J or D to
Jß rearrangements and full V to DJ or V to DJß rearrangements in
murine thymocytes 18, 19 . Highly purified CD3, CD4, and CD8 TN
thymocytes from adult mice were electronically sorted into four subsets
according to the surface expression of the CD24, CD25, and CD44
proteins 9 as described previously 18 . Genomic DNA was digested
with EcoRI, Southern blotted, and hybridized sequentially to
the following probes: a Vß-specific probe proximal to the D/Jß
cluster (see Ref. 18 for results); a mixture of probe 4, which is
specific to sequences between J1 and J2 19 and RAG-1, a probe
that detects a nonrearranging gene and serves as a control for DNA
loading differences (Fig. 1); and finally
a mixture of probes corresponding to the V4 and V7 genes (Fig. 2
).
|
. In non-T cell samples (such as LN B cells), probe 4 detects a single
germline EcoRI fragment (Fig. 1, lane 1). In
contrast, in mature LN T cells or in TCRß-deficient immature
thymocytes, virtually no germline hybridization signal can be observed,
whereas numerous non-germline (i.e., rearranged) bands appear (Fig. 1, lanes 6 and 7); these bands can be assigned to
specific partial (D-J) or complete (V-DJ) rearrangements (Fig. 1
and 19 . The least mature population of TN thymocytes (stage 1)
contains >95% of the TCR alleles in germline configuration as
determined by quantitative comparison with a non-T cell sample (Fig. 1, compare lane 2 with lanes 1 and 6). In
contrast, stage 2 thymocytes exhibit substantial amounts of partial
D1 and D2 to J1 rearrangements and few complete V4 and
V5 to DJ rearrangements (Fig. 1, lane 3); quantitative
analysis shows that approximately half of the TCR alleles have
undergone recombination at this stage. Stage 3 and 4 thymocytes exhibit
a TCR gene rearrangement pattern similar to that seen in mature T
cells (Fig. 1, compare lanes 4 and 5 with
lane 9), with the proportion of germline alleles reduced to
<5%. The total amount of germline and partial D1 and/or
D2-J1 rearrangement hybridization signal is 25% (i.e., 75%
of the alleles carry complete V-DJ rearrangements). These results
are in sharp contrast to those found for the TCRß locus, where >95%
of the alleles are still in germline configuration at stage 2 10, 12
and only 10–30% of the alleles contain complete V-DJß
rearrangements at stage 3 18 . In summary, it appears that at least
half of adult murine intrathymic precursors initiate TCR locus
recombination at stage 2, when the TCRß locus is still mainly in
germline configuration, and 75–100% have completed V-DJ
rearrangements at stage 3, when only a minority of the cells have full
V-DJß rearrangements. Importantly, because no TCR gene rearrangements
are detected in non-T lineage cells 1, 17 , these results argue that
irreversible commitment to the T cell lineage occurs as early as stage
2 in many cells.
Analysis of the TCR locus reveals an essentially similar pattern of
kinetics of V-J rearrangements. Due to a previously unknown
polymorphism, this hybridization shows one V7 and two polymorphic
V4 germline bands (Fig. 2, lanes 1 and 8).
Although the samples shown on lanes 1–6 are all derived
from the same group of C57BL/6 mice, the TN subsets were generated from
pools of thymi, whereas LN B and T cells were obtained from individual
mice. Therefore, the appearance of the two V4 germline bands
(tentatively marked as A and B on Fig. 2) varies from lane to lane.
However, hybridization to the V4 probe only (data not shown) allows
the V to J1 rearrangements to be unambiguously assigned to one of
the three upper bands (Fig. 2, compare lane 6 with
lane 7). In stage 2 thymocytes, there is a clear appearance
of V4-J1 recombination that rapidly increases to a maximum level
in stage 3 and 4 cells; this increase is accompanied by a reduction of
the corresponding germline hybridization signal. V7
rearrangements are only detectable from stage 3, but their level never
reaches the same amount observed for V4 rearrangements (Fig. 2).
PCR analysis of TCR and TCR gene rearrangements
To analyze TCR and TCR gene rearrangements with greater
sensitivity, genomic DNA from purified TN subpopulations was amplified
by PCR using primers designed to detect the three most common
adult-type V to DJ gene rearrangements and the three most common
adult-type V to J gene rearrangements. Amplification of a
nonrearranging gene (RAG-2) indicates that the input amount of DNA was
similar in all of the reactions (see Fig. 3C). The rearrangement of
V1 to J4 and V4 to J1 genes (Fig. 3A) and of
V4, V5, and V6 genes to J1 (Fig. 3B) can be
detected at low levels in stage 2 thymocytes. The signal corresponding
to rearranged V and V genes in stage 1 most likely derives from
trace numbers of mature contaminants that share the
CD24/CD25/CD44 phenotype of stage 1 TN cells 23 . All major V and
V genes were found to be rearranged in stages 3 or 4 at levels as
high as those seen in total thymocytes (Figs. 3, A and
B), indicating that recombination of the majority of TCR
and TCR loci is completed by stage 3. In contrast, analysis of TN
subsets shows negligible amounts of TCRß rearrangements in stage 2
and intermediate levels of V to DJß recombination at stage 3.
Completion of V-DJß rearrangement to the maximum extent is not seen
until more advanced stages. (Fig. 3C, and see Refs. 10, 12,
and 18). This analysis further demonstrates that the initiation of V to
DJ and V to J rearrangements precedes V to DJß recombination.
The detection of a few complete TCR and TCR rearrangements at
stage 2 also suggests the possibility that functional TCRs may
be generated at this early stage of TN thymocyte differentiation.
|
and TCR gene rearrangements
Due to the random, imprecise joining of V, D, and J coding
segments, only one-third of TCR gene rearrangements are expected to
retain the continuous reading frame with the C domain. Direct
sequencing or PCR RFLP analysis 24 can determine the proportion of
productive joints within the total pool of rearranged genes. It is
expected that any significant deviation from the random 33%
distribution of productive joints within a given population of
thymocytes results from the effect of a functional TCR on
differentiation. Therefore, we performed PCR RFLP analysis for V4,
V5, and V6 to J1 rearrangements (Fig. 4A) and V1 to J4
rearrangements (Fig. 4B) on DNA from stage 2–4 TN
thymocytes. V7 and V4 rearrangements were not analyzed; V7
rearrangements are not apparent at stage 2 (Fig. 3A),
whereas the V4 gene contains an in-frame stop codon at the 3' end of
the gene 25 , which means that productive joints would have to be
identified by direct DNA sequencing. The proportion of
productive rearrangements of V4/5-J1 and V1-J4 joints in
total thymocytes has been shown previously to be significantly less
than the random 33% distribution (Fig. 4, and see Refs. 19, 21, and
26). In stage 2 thymocytes, we observed a modest increase from the 33%
proportion of in-frame rearrangements for all four joints (Fig. 4, A (lanes 2, 7, and
12) and B (lanes 2 and
7)). Some of these joints are less evenly distributed in
stage 2 than in subsequent stages, presumably due to the limited number
of independent rearranged alleles present at this early stage. In
contrast, there is a reduction in the percentage of productive
V4/5-J1 (Fig. 4A, lanes 3, 4,
8, and 9) and V1-J4 (Fig. 4B,
lanes 3 and 4) joints in stage 3 and 4 TN
thymocytes, although this reduction is less apparent than that observed
in the total thymus. The reason for the difference is not known, but
may be related to the presence of a recently identified ß-like
thymocyte population among stage 3 and 4 TN cells that is selected for
in-frame V-DJ rearrangements 21, 27 but accounts only for a very
small fraction of the total thymus 28 . Despite being selected for
productive joints in stage 2 and TCRß-deficient (mainly
lineage) thymocytes, V6-DJ1 rearrangements are randomly
distributed in stage 3 and 4 TN thymocytes as well as in the total
thymus 21 . The reason for the lack of
underrepresentation of productive joints for these rearrangements in
ß lineage T cells is currently unknown.
|
and TCR joints were both enriched at stage
2, it is possible that functional TCRs may positively influence
lineage differentiation at this early stage. In support of this
concept, surface immunofluorescence staining of
CD4-/CD8- thymocytes showed that,
although the vast majority of stage 2 cells did not express the
TCR, a small fraction of cells (1%) are TCR-positive (data
not shown). The finding that productive TCR and TCR gene
rearrangements are depleted in stages 3 and 4 further suggests that
TCR expression in the previous stages may divert cells into the
lineage 26 . |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
vs ß lineages, as is implicit in a variety of models 5, 21, 26, 29, 30 . The data contained in this manuscript are relevant to both of
these purposes, as is discussed in further detail below.
It has been demonstrated previously that TCRß rearrangements initiate
only during TN stage 3 10, 18 , suggesting that conclusive T lineage
commitment does not occur until this point. Functional studies of
lineage potential support the exclusive T lineage commitment of stage 3
cells (Ref. 1 and references contained therein). These same studies,
however, yielded equivocal results regarding the lineage potential of
the earlier stage 2 TN cells 1, 31 . The quantitative Southern blot
analysis presented here indicates that more than half of the TCR
alleles in stage 2 cells show D2 to J1 rearrangements; therefore,
by this criteria, at least half of these cells are T lineage-committed.
It remains possible that some stage 2 cells have both TCR alleles
(and, by default, all other TCR loci) in germline configuration.
Therefore, we cannot rule out the possibility that cells with
multilineage potential (i.e., to T cell and DC or NK cell lineages)
persist at this stage. Nonetheless, our findings suggest that the
majority of thymocytes commit exclusively to the T lineage by the time
they have reached stage 2.
Analysis of the relationship between TCR gene rearrangements and
the segregation of ß vs lineage T cells has fostered two
general models of TCR-dependent T lineage divergence 19, 26, 28, 30, 32, 33 , generally referred to as the sequential or competitive models.
In the former, a hierarchical rearrangement of TCR genes before
that of ß would lead to the early divergence of T cells,
whereas the latter allows that TCR, TCR, and TCRß
rearrangements may occur simultaneously, with lineage outcome being
influenced by whichever receptor ( or ß/pT) is expressed
first. To help distinguish between these possibilities, we analyzed the
order of specific TCR and TCR gene rearrangements during the
defined stages of adult T lymphopoiesis, where TCRß and TCR
rearrangements have been characterized previously 10, 12, 34, 35 . We
find that full recombination of the TCR and TCR loci can precede
that of the TCRß locus by as much as one developmental stage during
adult murine T cell development; recombination of the TCR and TCR
loci initiates during TN stage 2 and is completed by stage 3, whereas
V-DJß rearrangement initiates during TN stage 3 and is completed by
stage 4. These results are consistent with the predictions of lineage
models in which sequential TCR gene rearrangements influence T lineage
divergence. However, it is important to note that recombination of
specific TCR loci does not obligate lineage commitment per se, because
rearrangement of the TCR and TCR loci occurs in most ß
lineage T cells 19, 25, 30, 36 , and productive TCRß rearrangements
can be found in T cells 29 . Transgenic experiments have also
shown that the TCR cannot exclusively determine commitment to either
the or ß lineages 21, 27, 37, 38 , although it can
dramatically influence this commitment 5, 6, 28, 39, 40 . Thus, the
experiments described here do not necessarily rule out the possibility
that factors other than the TCR can direct lineage commitment, so much
as they do support the notion that sequential rearrangements may play a
role in this decision. Additional experiments will be required to
determine the exact role of TCR-mediated signals in directing
commitment among the two T cell lineages.
The finding of an ordered rearrangement of adult TCR vs TCRß
genes reported here parallels the sequential order observed previously
in the fetal thymus 33 . However, early fetal TCR and TCR gene
rearrangements are highly restricted with regard to receptor diversity
and V gene utilization 41 and show nonrandom junctional sequences
irrespective of cellular selection 5 . Fetal thymocytes also differ
from their adult counterparts in other aspects of differentiation 8, 42, 43 . Therefore, it is remarkable that although adult thymic
precursors use V and V genes that are different from those
in early fetal thymocytes (Ref. 2 and references contained therein),
the primary accessibility of the TCR and TCR loci to the VDJ
recombinase machinery is retained throughout ontogenesis. Whether
distinct waves of V or V gene rearrangements occur in adult
thymic precursors, similar to early fetal differentiation 2 , remains
to be seen. The data contained here do not reveal striking differences
in the usage of various adult-type V and V genes throughout the
progression of stages 2 and 3. Although V-J4 and V4-J1
rearrangements appear earlier than V7-J1 rearrangements (see
Figs. 2 and 3A), the lesser abundance of V7-J1
rearrangements throughout thymocyte differentiation precludes us from
concluding that distinct waves of T cells emerge during adult
thymic development. The identification of phenotypically distinct
subpopulations of stage 2 and 3 thymocytes will be required to further
separate precursors with nonoverlapping rearrangements of the TCR,
TCR, and TCRß genes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ferenc Livák, Section of Immunobiology, Yale University School of Medicine, 310 Cedar Street, Box 208011, New Haven, CT 06520-8011. E-mail address:
3 Abbreviations used in this paper: DC, dendritic cell; LN, lymph node; RAG, recombination-activating gene; RFLP, restriction fragment length polymorphism; TN, CD3/CD4/CD8 triple-negative.
Received for publication August 10, 1998. Accepted for publication November 13, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T-cell development. Immunol. Rev. 120:185.[Medline]
gene mutant mice: independent generation of ß T cells and programmed rearrangements of TCR genes. Cell 72:337.[Medline]
and ß block thymocyte development at different stages. Nature 360:225.[Medline]
-chain genes maximize the production of useful thymocytes. J. Exp. Med. 178:615.RII/III contains precursors of T lymphocytes and natural killer cells. Cell 69:139.[Medline]
ß or - lineages can occur just prior to the onset of CD4 and CD8 expression among immature thymocytes. Eur. J. Immunol. 22:2185.[Medline]
gene rearrangements play a critical role in the ß/ T cell lineage decision. Immunity 2:617.[Medline]
ß lineage-committed thymocytes can be rescued by the TCR in the absence of TCR-ß. Eur. J. Immunol. 27:2948.[Medline]
T cells in the adult murine thymus. Eur. J. Immunol. 23:1655.[Medline]
genes influence the commitment of progenitor cells to differentiate into ß or T cells. Eur. J. Immunol. 25:2706.[Medline]
ß and T cells can share a late common precursor. Curr. Biol. 5:659.[Medline]
selection events in cell development. Immunity 7:83.[Medline]
expression. Immunity 8:427.[Medline]
ß/ lineage divergence. J. Immunol. 157:4293.[Abstract]
gene rearrangement and T early (TEA) expression in immature ß lineage thymocytes: implications for ß/ lineage commitment. Immunity 4:37.[Medline]
gene: rearrangement and cell lineages. Immunol. Today 8:293.
and ß T cell receptor alleles. Cell 69:529.[Medline]
and TCR-ß gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
locus in mouse thymocytes of the ß lineage. Immunity 3:609.[Medline]
ß lineage thymocytes to the CD4+CD8+ stage in the absence of TCR-ß rearrangement. J. Immunol. 154:5706.[Abstract]
ß T cell receptor can replace the receptor in the development of lineage cells. Immunity 5:343.[Medline]
gene in development of ß but not T cells. Nature 375:795.[Medline]
cells are eliminated in the thymus. Nature 343:714.[Medline]
genes: implications for T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859.[Medline]
chain in fetal and adult thymocyte development revealed by analysis of interleukin-7 receptor -deficient mice. Eur. J. Immunol. 28:1859.[Medline]
This article has been cited by other articles:
|
|
 |
|
  B. del Blanco, J. L. Roberts, N. Zamarreno, N. Balmelle-Devaux, and C. Hernandez-Munain Flexible Stereospecific Interactions and Composition within Nucleoprotein Complexes Assembled on the TCR{alpha} Gene Enhancer J. Immunol., August 1, 2009; 183(3): 1871 - 1883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Ueda-Hayakawa, J. Mahlios, and Y. Zhuang Id3 Restricts the Developmental Potential of {gamma}{delta} Lineage during Thymopoiesis J. Immunol., May 1, 2009; 182(9): 5306 - 5316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. Veinotte, T. Y. F. Halim, and F. Takei Unique subset of natural killer cells develops from progenitors in lymph node Blood, April 15, 2008; 111(8): 4201 - 4208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Masuda, K. Kakugawa, T. Nakayama, N. Minato, Y. Katsura, and H. Kawamoto T Cell Lineage Determination Precedes the Initiation of TCRbeta Gene Rearrangement J. Immunol., September 15, 2007; 179(6): 3699 - 3706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. L. Veinotte, C. P. Greenwood, N. Mohammadi, C. A. Parachoniak, and F. Takei Expression of rearranged TCR{gamma} genes in natural killer cells suggests a minor thymus-dependent pathway of lineage commitment Blood, April 1, 2006; 107(7): 2673 - 2679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Joachims, J. L. Chain, S. W. Hooker, C. J. Knott-Craig, and L. F. Thompson Human {alpha}beta and {gamma}{delta} Thymocyte Development: TCR Gene Rearrangements, Intracellular TCRbeta Expression, and {gamma}{delta} Developmental Potential--Differences between Men and Mice J. Immunol., February 1, 2006; 176(3): 1543 - 1552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Olaru, H. T. Petrie, and F. Livak Beyond the 12/23 Rule of VDJ Recombination Independent of the Rag Proteins J. Immunol., May 15, 2005; 174(10): 6220 - 6226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Boucontet, N. Sepulveda, J. Carneiro, and P. Pereira Mechanisms Controlling Termination of V-J Recombination at the TCR{gamma} Locus: Implications for Allelic and Isotypic Exclusion of TCR{gamma} Chains J. Immunol., April 1, 2005; 174(7): 3912 - 3919. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Balmelle, N. Zamarreno, M. S. Krangel, and C. Hernandez-Munain Developmental Activation of the TCR {alpha} Enhancer Requires Functional Collaboration among Proteins Bound Inside and Outside the Core Enhancer J. Immunol., October 15, 2004; 173(8): 5054 - 5063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hoflinger, K. Kesavan, M. Fuxa, C. Hutter, B. Heavey, F. Radtke, and M. Busslinger Analysis of Notch1 Function by In Vitro T Cell Differentiation of Pax5 Mutant Lymphoid Progenitors J. Immunol., September 15, 2004; 173(6): 3935 - 3944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Pereira and L. Boucontet Rates of Recombination and Chain Pair Biases Greatly Influence the Primary {gamma}{delta} TCR Repertoire in the Thymus of Adult Mice J. Immunol., September 1, 2004; 173(5): 3261 - 3270. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Schmitt, M. Ciofani, H. T. Petrie, and J. C. Zuniga-Pflucker Maintenance of T Cell Specification and Differentiation Requires Recurrent Notch Receptor-Ligand Interactions J. Exp. Med., August 16, 2004; 200(4): 469 - 479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Gerber, L. Boucontet, and P. Pereira Early Expression of a Functional TCR{beta} Chain Inhibits TCR{gamma} Gene Rearrangements without Altering the Frequency of TCR{gamma}{delta} Lineage Cells J. Immunol., August 15, 2004; 173(4): 2516 - 2523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tabrizifard, A. Olaru, J. Plotkin, M. Fallahi-Sichani, F. Livak, and H. T. Petrie Analysis of Transcription Factor Expression during Discrete Stages of Postnatal Thymocyte Differentiation J. Immunol., July 15, 2004; 173(2): 1094 - 1102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krotkova, E. Smith, G. Nerz, I. Falk, and K. Eichmann Delayed and Restricted Expression Limits Putative Instructional Opportunities of V{gamma}1.1/V{gamma}2 {gamma}{delta} TCR in {alpha}{beta}/{gamma}{delta} Lineage Choice in the Thymus J. Immunol., July 1, 2004; 173(1): 25 - 32. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Ward, B. Reina-San-Martin, A. Olaru, K. Minn, K. Tamada, J. S. Lau, M. Cascalho, L. Chen, A. Nussenzweig, F. Livak, et al. 53BP1 is required for class switch recombination J. Cell Biol., May 24, 2004; 165(4): 459 - 464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ciofani, T. M. Schmitt, A. Ciofani, A. M. Michie, N. Cuburu, A. Aublin, J. L. Maryanski, and J. C. Zuniga-Pflucker Obligatory Role for Cooperative Signaling by Pre-TCR and Notch during Thymocyte Differentiation J. Immunol., May 1, 2004; 172(9): 5230 - 5239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Couedel, E. Lippert, K. Bernardeau, M. Bonneville, and F. Davodeau Allelic Exclusion at the TCR{delta} Locus and Commitment to {gamma}{delta} Lineage: Different Modalities Apply to Distinct Human {gamma}{delta} Subsets J. Immunol., May 1, 2004; 172(9): 5544 - 5552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Ryu, B. B. Haines, D. D. Draganov, Y. H. Kang, C. E. Whitehurst, T. Schmidt, H. J. Hong, and J. Chen The T cell receptor {beta} enhancer promotes access and pairing of D{beta} and J{beta} gene segments during V(D)J recombination PNAS, November 11, 2003; 100(23): 13465 - 13470. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hamrouni, A. Aublin, P. Guillaume, and J. L. Maryanski T Cell Receptor Gene Rearrangement Lineage Analysis Reveals Clues for the Origin of Highly Restricted Antigen-specific Repertoires J. Exp. Med., March 3, 2003; 197(5): 601 - 614. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. King, M. Kondo, D. C. Scherer, and I. L. Weissman Lineage infidelity in myeloid cells with TCR gene rearrangement: A latent developmental potential of proT cells revealed by ectopic cytokine receptor signaling PNAS, April 2, 2002; 99(7): 4508 - 4513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Lambolez, O. Azogui, A.-M. Joret, C. Garcia, H. von Boehmer, J. Di Santo, S. Ezine, and B. Rocha Characterization of T Cell Differentiation in the Murine Gut J. Exp. Med., February 11, 2002; 195(4): 437 - 449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. C. Mancini, S. M. Candeias, J. P. Di Santo, P. Ferrier, P. N. Marche, and E. Jouvin-Marche TCRA Gene Rearrangement in Immature Thymocytes in Absence of CD3, Pre-TCR, and TCR Signaling J. Immunol., October 15, 2001; 167(8): 4485 - 4493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. P. Hochberg, A. C. Chillemi, C. J. Wu, D. Neuberg, C. Canning, K. Hartman, E. P. Alyea, R. J. Soiffer, S. A. Kalams, and J. Ritz Quantitation of T-cell neogenesis in vivo after allogeneic bone marrow transplantation in adults Blood, August 15, 2001; 98(4): 1116 - 1121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. F. Lind, S. E. Prockop, H. E. Porritt, and H. T. Petrie Mapping Precursor Movement through the Postnatal Thymus Reveals Specific Microenvironments Supporting Defined Stages of Early Lymphoid Development J. Exp. Med., July 16, 2001; 194(2): 127 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Petersson and F. Ivars Early TCR {{alpha}}{{beta}} Expression Promotes Maturation of T Cells Expressing Fc{{epsilon}}RI{{gamma}} Containing TCR/CD3 Complexes J. Immunol., June 1, 2001; 166(11): 6616 - 6624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kang, A. Volkmann, and D. H. Raulet Evidence That {gamma}{delta} versus {alpha}{beta} T Cell Fate Determination Is Initiated Independently of T Cell Receptor Signaling J. Exp. Med., March 19, 2001; 193(6): 689 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. D. Lacorazza, C. Tucek-Szabo, L. V. Vasovic, K. Remus, and J. Nikolich-Zugich Premature TCR{{alpha}}{{beta}} Expression and Signaling in Early Thymocytes Impair Thymocyte Expansion and Partially Block Their Development J. Immunol., March 1, 2001; 166(5): 3184 - 3193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Terrence, C. P. Pavlovich, E. O. Matechak, and B.J. Fowlkes Premature Expression of T Cell Receptor (Tcr){alpha}{beta} Suppresses Tcr{gamma}{delta} Gene Rearrangement but Permits Development of {gamma}{delta} Lineage T Cells J. Exp. Med., August 21, 2000; 192(4): 537 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Leduc, W. M. Hempel, N. Mathieu, C. Verthuy, G. Bouvier, F. Watrin, and P. Ferrier T Cell Development in TCR{beta} Enhancer-Deleted Mice: Implications for {alpha}{beta} T Cell Lineage Commitment and Differentiation J. Immunol., August 1, 2000; 165(3): 1364 - 1373. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. K. Tripathi, N. Mathieu, S. Spicuglia, D. Payet, C. Verthuy, G. Bouvier, D. Depetris, M.-G. Mattei, W. M. HempeL, and P. Ferrier Definition of a T-Cell Receptor beta Gene Core Enhancer of V(D)J Recombination by Transgenic Mapping Mol. Cell. Biol., January 1, 2000; 20(1): 42 - 53. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Wilson, M. Capone, and H. R. MacDonald Unexpectedly late expression of intracellular CD3{epsilon} and TCR {gamma}{delta} proteins during adult thymus development Int. Immunol., October 1, 1999; 11(10): 1641 - 1650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. King, M. Kondo, D. C. Scherer, and I. L. Weissman Lineage infidelity in myeloid cells with TCR gene rearrangement: A latent developmental potential of proT cells revealed by ectopic cytokine receptor signaling PNAS, April 2, 2002; 99(7): 4508 - 4513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. P. Sleckman, C. H. Bassing, M. M. Hughes, A. Okada, M. D'Auteuil, T. D. Wehrly, B. B. Woodman, L. Davidson, J. Chen, and F. W. Alt Mechanisms that direct ordered assembly of T cell receptor beta locus V, D, and J gene segments PNAS, July 5, 2000; 97(14): 7975 - 7980. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
