| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Ludwig Institute for Cancer Research, Lausanne Branch, and
Institute for Biochemistry, University of Lausanne, Epalinges, Switzerland;
Department of Cell Biology, Faculty of Biology, Complutense University, Madrid, Spain; and
§
Institute of Microbiology, University of Lausanne, Lausanne, Switzerland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MMTV is transmitted through milk to newborn mice during the first 2 wk of life by initially infecting B cells in the Peyer’s patches 2 . Efficient MMTV infection is dependent upon the presentation of an MMTV-encoded superantigen (SAg) by the initial pool of infected B cells to SAg-reactive T cells 3 . The resulting SAg-specific Th cell response, mediated by the cross-linking of B cell MHC class II molecules with TCR Vß elements, leads to the amplification of the infected cells by inducing a strong B cell proliferation and differentiation response 4 . Immunohistochemical analysis of the draining lymph node after infection with MMTV has demonstrated that MMTV-SAg drives extrafollicular and follicular B cell differentiation, following a very similar pattern to that described for conventional Ags 5 .
The follicular phase of a B cell response comprises a complex series of events occurring during the germinal center reaction, implying the somatic hypermutation of Ig genes and the selection of high-affinity mutants 6 . In contrast, extrafollicular B cell differentiation involves an early Ag-specific proliferation and differentiation of B cells taking place within the so-called extrafollicular foci and leading to the generation of a first wave of plasmablasts 7 . These extrafollicular plasmablasts appear to display low levels of B220 and to express the proteoglycan molecule syndecan-1 (CD138) 8, 9 . Interestingly, although plasma cells have been considered to be short-lived cells, two recent reports have demonstrated that a substantial fraction of them can survive for periods of >1 yr 10, 11 .
Previous reports have demonstrated that very few B cells are infected
in the first days after MMTV injection. It was estimated that in the
draining popliteal lymph node (PO-LN), 
1 of 10,000 B cells
were infected 48 h after injection of the Swiss strain of MMTV,
MMTV(SW), into the footpad of BALB/c mice 12 . However,
between days 2 and 6 (i.e., during the extrafollicular phase of the B
cell response), the number of infected B cells increases >1000-fold by
cell division-mediated expansion of the initial number of infected
cells. This SAg-mediated B cell response has been demonstrated to be
required for a successful MMTV infection of the mammary gland 3, 13 .
However, the mechanism of virus transmission to the mammary gland is
still largely unknown, because the data dealing with the capacity of
different lymphocyte subsets to transmit MMTV infection after transfer
into appropriate hosts remain controversial (reviewed in 14 . In
addition, it has been reported that under physiological conditions,
large quantities of new virus particles are not produced during the
first phase of infection, but only by the infected epithelial cells of
the mammary and salivary glands under the control of the endocrine
system by pregnancy hormones (reviewed in 15 . Finally, the
characterization of the cell type responsible for virus transfer to the
mammary gland is further complicated by virus spread from the initially
infected B cells to T cells 16 . Therefore, to get new insights on the
transmission of the virus to the mammary gland, we have extensively
analyzed the B cell response induced upon infection by MMTV(SW). Our
results support the hypothesis that the MMTV(SW)-infected plasmablasts
differentiated during the early extrafollicular B cell response, which
can be identified and therefore traced during the infection process on
the basis of its phenotypic profile and which may be involved in MMTV
transmission to the mammary gland and to the offspring.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were purchased from Harlan Olac (Bicester, U.K.). In all experiments, 8- to 10-wk-old mice were used.
Antibodies
The following Abs were used in this study: FD11-54-3
(anti-MHC class II, biotin-conjugated; 17 , H1-2F3
(anti-CD69, biotin-conjugated; 18 , FD44.8 (anti-LFA-1
,
biotin-conjugated; 17 , Mel-14 (anti-CD62 ligand (CD62L),
biotin-conjugated; 19 , IM7.81 (anti-CD44, biotin-conjugated;
20 , FGK45 (anti-CD40, biotin-conjugated; 21 ,
44-22.1 (anti-Vß6, fluorescein-conjugated; 22 , GL1
(anti-B7-2, biotin-conjugated; PharMingen, San Diego,
CA), S7 (anti-CD43, biotin-conjugated; PharMingen), 281-2
(anti-syndecan-1, biotin-conjugated; PharMingen), AMS9.1
(anti-IgD, biotin-conjugated; PharMingen), LO-MM
(anti-IgM, biotin-conjugated; Caltag, San Francisco, CA),
RA3-6B2 (anti-B220, FITC-conjugated; Caltag), H129.19
(anti-CD4, phycoerythrin (PE)-conjugated; Boehringer
Mannheim, Mannheim, Germany), 53-6.7 (anti-CD8, PE-conjugated;
Boehringer Mannheim), and M5-114 (anti-MHC class II, PE-conjugated;
Boehringer Mannheim).
Virus isolation and in vivo treatment
MMTV(SW) was purified from milk as described previously 4 . Mice were given a 10 µl injection in the hind footpad with MMTV(SW) (109 virus particles, titered as described in 3 . After the indicated times, the popliteal, inguinal, and mesenteric lymph nodes, spleen, and Peyer’s patches were removed, and single cell suspensions were prepared.
Flow cytometry
The kinetics of B cell and T cell activation as well as the percentage of Vß6+ T cells were analyzed after triple-staining with biotinylated anti-CD69, followed by streptavidin (SA)-tricolor (Caltag, San Francisco, CA), PE-conjugated anti-CD4 and anti-CD8, and fluoresceinated anti-Vß6. CD4+ and CD8+ cells were separated in the FL2 channel using appropriate dilutions of the two mAbs. Analysis of the B220low and B220high B cells was performed after triple-staining with biotinylated mAbs against CD69, IgM, IgG2a, IgD, CD62L, CD43, syndecan-1, LFA-1, and CD44, followed by SA-tricolor (Caltag), PE-conjugated anti-MHC class II, and fluoresceinated anti-B220. Analysis was performed on a FACScan (Becton Dickinson, Mountain View, CA) cell analyzer, using Lysys II software for data evaluation.
MHC class II+ B220low and MHC class II+ B220high B cells from the draining PO-LN were FACS-sorted 6 days after MMTV injection on a FACStar (Becton Dickinson) flow cytometer after double staining with biotinylated anti-MHC class II followed by SA-PE (Caltag) and fluoresceinated anti-B220. After reanalysis, the sorted cell populations had a purity of >99% (data not shown).
Cell cycle analysis
The cell cycle was analyzed on FACS-sorted MHC class II+ B220low or MHC class II+ B220high B cells by cell nuclei DNA staining with propidium iodide (50 µg/ml), 0.1% Triton X-100, and 0.1% sodium citrate as described by Nicoletti et al. 23 . The percentage of apoptotic and blast cells within B cells was estimated on the basis of the forward scatter (FSC).
Polymerase chain reaction
DNA of 50,000 FACS-sorted MHC class II+
B220low or MHC class II+ B220high B
cells (purity of >99%) was amplified with MMTV long terminal repeat
(LTR) oligonucleotides that do not allow the distinction
between endogenous and exogenous MMTV sequences. The individual MMTV
sequences can be distinguished based on the length differences of the
amplified fragments, with Mtv-6 giving the shortest, Mtv-8 and -9 the
intermediate, and MMTV(SW) the longest fragments in
MMTV(SW)-infected BALB/c mice. The oligonucleotides to amplify all
LTR-sequences were chosen on the basis of the high degree of
conservation between the 3' LTR-open reading frames (ORFs). To amplify
Mtv ORFs from all Mtv-DNAs, the 5' oligonucleotide ORF-100
(CTCAGGAAGAAAAAGACGACAT) was used in combination with the 3'
oligonucleotide VJ71 (CCCAAACCAAGTCAGGAAACCACTTG), yielding a
250–290-kb PCR product. For PCR, the conditions were: 5 min at 95°C,
followed by 40 cycles of 1 min at 60°C, 1 min at 72°C, and
30 s at 95°C, and finally 7 min at 72°C in 1 x PCR
buffer containing 20 mM Tris-HCl (pH 8.55), 16 mM
(NH4)2SO4, 2.5 mM
MgCl2, 150 µg/ml BSA, and 0.2 mM of each of the four
2'-deoxynucleoside 5'-triphosphates (dNTPs). A total of 2.5 U of
Taq polymerase (BioTaq; Bioprobe Systems, Montreuil,
France), 3 µCi of [-32P]dATP (New
England Biolabs, Beverly, MA), and 0.5 µM of each oligonucleotide
were added per PCR. PCR products were separated on 6% polyacrylamide
gels, and the dried gels were autoradiographed on Kodak X-OMAT films
(Eastman Kodak Company, Rochester, NY).
Light and electron microscopy
After the indicated survival times, the PO-LN or B220low B cells sorted from PO-LN 6 days after MMTV(SW) injection were fixed with 1% glutaraldehyde and 1% paraformaldehyde in 0.1 M (pH 7.6) Sørensen phosphate buffer for 16 h at 4°C, postfixed with 1% OsO4 in the same buffer for 1 h at 4°C, dehydrated in graded acetone solutions, and embedded in Araldite. Semithin sections (1 µm) were stained with toluidine blue and photographed in an Zeiss Axioskop microscope (Zeiss, Oberkochen, Germany); ultrathin sections (70–80 nm) were counterstained with uranyl acetate and lead citrate and examined with a Jeol 1010 electron microscope (Tokyo, Japan).
Transfer of MMTV infection
B220low CD62L- CD43+
plasmablasts, B220high CD62L+
CD43- B cells, or total T cells were isolated from the
draining PO-LN of BALB/c mice 6 days after MMTV injection. For this
assay, the purification of the B220low and
B220high B cell subsets was performed on the basis of the
expression of CD62L and CD43, as a small proportion of
CD62L- CD43+-responding blast cells that have
not yet undergone the down-regulation of B220 and could be infected by
MMTV exists within the B220high B cell population at 6 days
after infection with MMTV (see Fig. 2
B). CD62L- CD43+
plasmablasts and CD62L+ CD43- B cells were purified by magnetic cell
sorting with MACS separation columns (Miltenyi Biotec, Bergisch,
Germany) after T cell depletion by complement mediated cytotoxicity.
For this purpose, purified total B cells obtained after T cell
depletion (purity >97%) were incubated with biotinylated anti-CD43 or
anti-CD62L mAbs, followed by streptavidin-conjugated MACS microbeads
(Miltenyi Biotec). After reanalysis, the purified CD62L-
CD43+ and CD62L+ CD43- B cell
populations had a purity of >98% (data not shown). Therefore, the
small proportion of CD62L- CD43+
B220high blast B cells (see Fig. 2B), which
could potentially contain MMTV-infected cells, is included in the
CD62L- CD43+ subset, but absent from the
CD62L+ CD43- B cell subpopulation. A total of
5 x 105 purified CD62L- CD43+
plasmablasts, CD62L+ CD43- B cells, or total T
cells from day 6 MMTV(SW)-injected mice or total PO-LN cells from
noninfected control mice were transferred i.v. into BALB/c females,
which were then crossed with noninfected BALB/c males. Deletion of
circulating Vß6+ CD4+ T cells in the mothers
and their offspring was monitored at the indicated times. Blood
leukocytes were removed by tail bleeding from heparinized blood samples
by centrifugation through a Ficoll (Pharmacia, Uppsala, Sweden)
cushion, and stained with PE-conjugated anti-CD4 and
fluoresceinated anti-Vß6.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Injection of MMTV(SW) into the footpad of BALB/c mice induced a strong B cell and T cell proliferative response in the draining PO-LN, as assessed by the analysis of the percentage of cycling cells and of B and T blast cells (data not shown). As previously reported, B cells underwent a biphasic activation: an initial transient T cell-independent B cell activation, occurring within the first 24 h, was followed by a second B cell activation phase starting 2 days after infection and reaching a peak by day 4 24 . This second B cell activation phase was accompanied by a strong B cell proliferative response that amplified the initial number of infected B cells and required the presentation by the infected cells of an MMTV(SW)-encoded SAg to the SAg-reactive Th cells 3 .
Analysis of the B220 vs MHC class II expression of the B cells during
the B cell response revealed the appearance by day 4 of a B cell
subpopulation expressing MHC class II levels that were similar to those
of control mice, but lower B220 expression (Fig. 1A). This B220low
B cell population, hardly detectable in the PO-LN of control mice, in
which it represented <3% of the total B cells (Fig. 1A),
reached a maximum by days 5 and 6, when it constituted 
40% of the B
cell subset, and returned to control levels by day 11 in the PO-LN of
MMTV(SW)-infected mice (Fig. 1B). Therefore, the kinetics of
the B220low B cells paralleled the B cell activation and
proliferation response induced by MMTV(SW). At 6 days after virus
injection, the B220low B cell population represented 40%
of the total lymph node B cells (i.e., 4–5 x 106
cells) and contained 90% of blast cells, whereas only 25% blast
cells were detected in the B220high B cell population (Fig. 1A). Analysis of the cell cycle of the B220low
and B220high B cell subpopulations sorted by FACS (Fig. 2
) showed that, although the
B220high B cell population had a basal level of cycling
cells (3%), the B220low B cells displayed a high
percentage of proliferating cells (19% cycling cells). These results
indicate that the B220low MHC class II+ B cell
subpopulation contains the vast majority of the dividing B cells during
the SAg-mediated B cell response induced by MMTV(SW).
|
As shown in Fig. 2, the analysis of cell surface marker expression
by the B220low and B220high B cells revealed
important phenotypic differences between both B cell subpopulations.
B220low B cells expressed high levels of the B cell
differentiation markers CD43 and syndecan, whereas only a small
proportion of B220high B cells expressed these markers.
B220low B cells did not express surface IgDs, whereas
B220high B cells were IgD+. Correspondingly,
B220low B cells were negative for the homing molecule CD62L
(L-selectin), whereas B220high B cells were
CD62L+. In addition, B220low B cells underwent
a strong CD44 up-regulation and displayed higher LFA-1 levels than the
B220high cells. Finally, 40% of B220high B
cells were positive for the early activation marker CD69, but this
marker was down-regulated in the B220low B cells. The
phenotype of B220low B cells corresponds to that of
plasmablasts, originated by extrafollicular differentiation of
MMTV-responding B cells, which have switched to downstream Ig classes.
Therefore, B220low B cells will hereafter be referred to as
B220low plasmablasts.
The kinetics of the B cell response, induced by MMTV as shown in Fig. 1, and the phenotypic characteristics of responding B cells described
above indicate that B220high B cells that become infected
differentiate into B220low plasmablasts during the
MMTV(SW)-encoded SAg-mediated B cell response. This early B cell
differentiation was accompanied by B220 and CD62L down-regulation and
by the up-regulation of CD43 and syndecan-1. Therefore,
B220low plasmablasts are IgD-
CD62L- CD43+ syndecan-1+, whereas
most B220high B cells are CD62L+
IgD+ CD43- syndecan-1-.
Interestingly, the B220 vs MHC II profile of PO-LN CD62L-
cells and CD43+ cells at day 6 after MMTV(SW) injection
(Fig. 2B) revealed that 8–10% of CD62L-
CD43+ B cells had not down-regulated B220 by day 6, and,
therefore, were found within the B220high B cell subset.
PCR analysis, using primers specific for endogenous as well as
exogenous MMTV sequences of the B220low and
B220high B cell subpopulations isolated on days 5–7 by
FACS, showed that viral DNA could be detected on the
B220low but not on the B220high B cells; two to
three copies of MMTV(SW) were found per B220low B cell. In
fact, as illustrated in Fig. 3, in which
the presence of viral DNA is shown for different cell subsets, when
total PO-LN cells from control mice or total PO-LN B220high
plasmablasts isolated at day 6 after MMTV infection were analyzed, no
viral DNA was detected, whereas a strong signal was obtained for day 6
PO-LN B220low plasmablasts. Interestingly, MMTV DNA could
be detected in sorted blast B220high B cells but not in
small B220high B cells. This is most likely due to the fact
that a small proportion of blast CD62L- CD43+
B cells containing MMTV-infected cells, which had not yet
down-regulated B220, was still present at day 6 within the
B220high B cell subset (see Fig. 2B). Analysis
of the kinetics of the B220low CD62L-
CD43+ B cell subset revealed that CD62L-
CD43+ blast cells were no longer present within
B220high B cells after day 7 (data not shown), indicating
that CD62L- CD43+ B cell blasts had
down-regulated B220 or had migrated from the lymph node at this time
point. Therefore, B220low plasmablasts represent the vast
majority of the infected B cell population amplified as a result of the
SAg-specific Th cell-mediated B cell proliferation response.
|
Analysis of the percentage of cycling cells, Vß6+
cells, and CD69+ cells within the B cell and T cell
compartments indicated that these parameters did not undergo
significant variations in the inguinal and mesenteric lymph nodes,
Peyer’s patches, and spleen after MMTV(SW) injection (data not shown),
and, therefore, that an immune response against the virus was not
mounted in these organs. However, there was a small but significant
increase in the percentage of B220low plasmablasts after
MMTV(SW) injection in the mesenteric lymph nodes (MS-LN) (Fig. 4) and spleen, but not in the inguinal
lymph nodes or in the Peyer’s patches (data not shown). Analysis of
the percentage of apoptotic cells within the B220low
population in the PO-LN during the B cell response to MMTV(SW) (Fig. 4, B and C) revealed an inverted correlation between
cycling and apoptotic cells (i.e., the peak of cycling cells coincided
with the lowest percentage of apoptotic cells). Interestingly, in the
MS-LN and spleen, the B220low plasmablast population
did not show variations in the percentage of blast and apoptotic
cells, which remained at the control levels found in the PO-LN before
and after the B220low B cell response. These data suggest
that no proliferation occurs in these locations within this B cell
population, and, therefore, that the increase in the number of
B220low plasmablasts in the MS-LN and spleen might be the
result of the migration of these cells from the responding PO-LN.
|
Fig. 5 shows the histological study
of PO-LN from control mice and from mice at days 6 and 11 after
injection of MMTV(SW). Although the deep cortical areas and the
medullary cords were occupied almost exclusively by small resting
lymphocytes in control mice (Fig. 5A), the vast majority of
the cells infiltrating these areas were lymphoblasts, plasmablasts, and
plasma cells at 6 days after MMTV(SW) injection (Fig. 5B).
Moreover, an important number of these cells were observed in the
vascular space of the medullary sinuses at this time point (Fig. 5D). Fig. 5C shows that in these same areas at 11
days after injection, macrophages, dead cells, and a few blast cells
were observed, indicating that the decline of the B and T cell response
was accompanied by a certain degree of cell death and by dead cell
removal by phagocytes.
|
E).
Interestingly, some of the B220low cells contained numerous
type-A viral particles of 65–75 nm in size in their cytoplasm (Fig. 5F), indicating that viral replication most likely occurs in
these cells after MMTV(SW) infection. Transmission of MMTV to the mammary gland
The data presented in this report, dealing with the detection of
MMTV DNA and MMTV type-A particles in B220low B cells,
suggest that this B cell population might be involved in virus
transmission to the mammary gland, and, therefore, to the offspring. To
test this hypothesis, we have analyzed the transmission of MMTV to the
offspring of females injected before mating with CD62L-
CD43+ plasmablasts, CD62L+ CD43- B
cells, or total T cells isolated from infected mice. MMTV(SW) SAg
presentation in the injected females and infection by MMTV of their
offspring were detected by analyzing the deletion of MMTV(SW)
SAg-reactive Vß6+ CD4+ T cells (Fig. 6). For this assay, the purification of
the B220low and B220high B cell subsets has
been performed by isolating CD62L- CD43+ and
CD62L+ CD43- B cells, respectively, because,
as shown in Fig. 2B, a small proportion of
CD62L- CD43+ B cells, which could potentially
contain MMTV-infected cells, exists at day 6 within the
B220high B cells (see Materials and Methods for
details). Females injected with CD62L- CD43+
plasmablasts but not with CD62L+ CD43- B
cells, T cells, or control total PO-LN cells (data not shown) underwent
a strong deletion of Vß6+ CD4+ T cells (Fig. 6A), suggesting that MMTV(SW) SAg-presenting plasmablasts
persisted for a long period of time or infected other cells upon
injection in an appropriate host. In addition, a strong deletion of
Vß6+ CD4+ T cells was observed in the
offspring of the females injected with CD62L-
CD43+ plasmablasts (Fig. 6B), indicating that
the litters were infected with MMTV. No Vß6+
CD4+ T cell deletion was observed in the offspring of
females injected with CD62L+ CD43- B cells, T
cells or control cells. These results demonstrate that MMTV replication
occurs in the CD62L- CD43+ B cell-injected
females, and that B220low plasmablasts can transmit MMTV
infection to the offspring.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The immune response induced by MMTV(SW) was characterized by the activation and proliferation of B cells and MMTV-SAg reactive Vß6+ CD4+ Th cells, as reported previously 4 . As indicated by the analysis of the total cell number in the draining PO-LN as well as the percentage of cycling cells, activated cells, and Vß6+ CD4+ T cells, the response peaked at days 6 and 7 after MMTV injection and then declined to control levels after 2 wk (data not shown). T cell help mediated by the SAg-specific Vß6+ CD4+ cells drives B cell activation, proliferation, and differentiation into Ab-forming cells, which lead to the expansion of the initial number of MMTV-infected B cells 3 . The pattern of the B cell response induced by MMTV correlated with the kinetics of Ab-forming cells described in the extrafollicular foci of secondary lymphoid organs 8, 9, 29 .
Our results show that the immune response to MMTV involves the
differentiation of plasmablasts with a high proliferation rate,
characterized phenotypically by high MHC class II levels but low
expression of the B cell marker B220. Down-regulation of B220 has been
described previously on 4-hydroxy-3-nitrophenyl nuclear protein
(NP)-specific APCs 8, 9 and after in vitro activation of B
cells 30 . These B220low plasmablasts were first detected
by day 4 postinjection, peaked by days 6 and 7 when they represented
40% of PO-LN B cells, and became barely detectable by day 9.
Interestingly, PCR analysis using MMTV-specific primers has shown that
viral DNA can be detected in B220low B cells but not in
B220high-resting B cells, indicating that the
B220low plasmablasts represent the bulk of MMTV-infected
cells during their proliferative phase.
Cell surface marker analysis of B220low plasmablasts has evidenced that these cells display high levels of the adhesion molecules LFA-1 and CD44 and low levels of CD62L (i.e., an activated phenotype) 31, 32 . By day 6 after MMTV injection, B220low B cells expressed the B cell differentiation markers CD43 and syndecan and were IgD-. These data indicate that by day 6, B220low B cells represent extrafollicular plasmablasts originated by SAg-mediated differentiation of MMTV-infected B220high B cells, which have switched to downstream Ig classes. Interestingly, their phenotypic profile allowed the detection and isolation of MMTV-infected cells and corresponded to that described previously for NP-specific Ab-forming cells of the splenic foci 8, 9 involved in the production of low-affinity Abs during the primary response to NP.
Electron microscopy studies of B220low FACS-sorted cells have shown that the B220low population is morphologically heterogeneous and includes blast and dividing cells, plasmablasts, and plasma cells. Analysis of the draining PO-LN at day 6 after MMTV injection revealed that most B220low plasmablasts were localized in the deep cortical areas and in the medullary cords and sinuses. Due to the lymph flow pattern in the mouse PO-LN 33 , B220low plasmablasts located within the medullary sinus vascular space will most likely exit the lymph node via the efferent lymphatic and, therefore, could migrate to other peripheral lymphoid organs. Interestingly, groups of viral particles corresponding to the MMTV type-A particles described in mammary tumor epithelial cells 34 were found in the cytoplasm of FACS-sorted B220low plasmablasts as well as in cells with similar morphological characteristics observed in sections of the draining PO-LN at day 6. This result suggests that viral replication can take place in these cells during the early phase of viral infection and contrasts with previous reports supporting the assertion that viral replication occurs only in later stages, when the mammary gland epithelial cells are infected. Importantly, although intracytoplasmic A particles are considered to be precursors of the core of the mature MMTV particles, it has been shown that, despite being devoid of the characteristic spikes of MMTV, they are capable of inducing mammary tumors in an appropriate host 35 .
The detection of MMTV DNA and MMTV viral particles in B220low plasmablasts reported here suggests that this cell population may be responsible for the transmission of MMTV. In this sense, the increase in B220low plasmablasts observed between days 6 and 8 after MMTV injection in the spleen and MS-LN, in which no detectable immune response to MMTV occurred, suggests that the B220low plasmablasts found in these lymphoid organs originate in the draining PO-LN, and, therefore, constitute a cell population with migratory capacity. This hypothesis is in agreement with our morphological studies, demonstrating the presence of cells morphologically similar to B220low plasmablasts in the medullary sinuses of the draining PO-LN. Interestingly, CD43 expression by B220low plasmablasts could be related to their recirculation potential, because this molecule has been demonstrated to participate in lymphocyte homing 36 .
The kinetics of Vß6+ CD4+ T cell deletion occurring in females injected with CD62L- CD43+ plasmablasts indicate that this cell population persisted for a long period of time after transfer and retained its SAg-presenting cell capacity or alternatively was capable of transferring infection to other lymphocyte subsets. In this sense, it has been recently reported that both B and T cells can shed infectious MMTV particles into the supernatant after in vitro culture 27 . Interestingly, challenging the classical immunological dogma that holds that plasma cells are short-lived cells, two recent reports examining the issue of the longevity of plasma cells have demonstrated that a substantial fraction of these cells are long-lived, and can survive for periods of >1 yr 10, 11 .
Finally, the transfer of CD62L- CD43+ plasmablasts, but not of CD62L+ CD43- B cells or T cells, into noninfected females caused a strong deletion of Vß6+ CD4+ T cells in the offspring, demonstrating that MMTV replication occurred in the females after injection of CD62L- CD43+ plasmablasts and, more importantly, that MMTV was transmitted to the offspring.
In conclusion, our results strongly support the hypothesis that the B220low plasmablasts generated during the extrafollicular B cell response to MMTV(SW) may play an important role in the transmission of the virus to the mammary gland and the offspring during infection by MMTV.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Dr. Carlos Ardavín, Department of Cell Biology, Faculty of Biology, Complutense University, 28040 Madrid, Spain.
3 Address correspondence and reprint requests to Dr. Hans Acha-Orbea, Ludwig Institute for Cancer Research, Lausanne Branch and Institute for Biochemistry, University of Lausanne, 1066 Epalinges Switzerland. E-mail address:
4 Abbreviations used in this paper: MMTV, mouse mammary tumor virus; PO-LN, popliteal lymph node(s); MS-LN, mesenteric lymph node(s); CD62L, CD62 ligand; SAg, superantigen; LTR, long terminal repeat; ORF, open reading frame; PE, phycoerythrin; SA, streptavidin; FSC, forward scatter.
Received for publication April 1, 1998. Accepted for publication October 30, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
heavy chain class switching. Immunity 5:319.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. Chevrier, C. Genton, A. Kallies, A. Karnowski, L. A. Otten, B. Malissen, M. Malissen, M. Botto, L. M. Corcoran, S. L. Nutt, et al. CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche PNAS, March 10, 2009; 106(10): 3895 - 3900. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Racine, M. Chatterjee, and G. M. Winslow CD11c Expression Identifies a Population of Extrafollicular Antigen-Specific Splenic Plasmablasts Responsible for CD4 T-Independent Antibody Responses during Intracellular Bacterial Infection J. Immunol., July 15, 2008; 181(2): 1375 - 1385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Belnoue, M. Pihlgren, T. L. McGaha, C. Tougne, A.-F. Rochat, C. Bossen, P. Schneider, B. Huard, P.-H. Lambert, and C.-A. Siegrist APRIL is critical for plasmablast survival in the bone marrow and poorly expressed by early-life bone marrow stromal cells Blood, March 1, 2008; 111(5): 2755 - 2764. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Courreges, D. Burzyn, I. Nepomnaschy, I. Piazzon, and S. R. Ross Critical Role of Dendritic Cells in Mouse Mammary Tumor Virus In Vivo Infection J. Virol., April 15, 2007; 81(8): 3769 - 3777. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kumazaki, B. Tirosh, R. Maehr, M. Boes, T. Honjo, and H. L. Ploegh AID-/-{micro}s-/- Mice Are Agammaglobulinemic and Fail to Maintain B220-CD138+ Plasma Cells J. Immunol., February 15, 2007; 178(4): 2192 - 2203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Iannello, O. Debbeche, E. Martin, L. H. Attalah, S. Samarani, and A. Ahmad Viral strategies for evading antiviral cellular immune responses of the host J. Leukoc. Biol., January 1, 2006; 79(1): 16 - 35. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ingold, A. Zumsteg, A. Tardivel, B. Huard, Q.-G. Steiner, T. G. Cachero, F. Qiang, L. Gorelik, S. L. Kalled, H. Acha-Orbea, et al. Identification of proteoglycans as the APRIL-specific binding partners J. Exp. Med., May 2, 2005; 201(9): 1375 - 1383. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Bromage, I. M. Kaattari, P. Zwollo, and S. L. Kaattari Plasmablast and Plasma Cell Production and Distribution in Trout Immune Tissues J. Immunol., December 15, 2004; 173(12): 7317 - 7323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hieshima, Y. Kawasaki, H. Hanamoto, T. Nakayama, D. Nagakubo, A. Kanamaru, and O. Yoshie CC Chemokine Ligands 25 and 28 Play Essential Roles in Intestinal Extravasation of IgA Antibody-Secreting Cells J. Immunol., September 15, 2004; 173(6): 3668 - 3675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Aurrekoetxea-Hernandez and E. Buetti Transforming Growth Factor {beta} Enhances the Glucocorticoid Response of the Mouse Mammary Tumor Virus Promoter through Smad and GA-Binding Proteins J. Virol., March 1, 2004; 78(5): 2201 - 2211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mpandi, L. A. Otten, C. Lavanchy, H. Acha-Orbea, and D. Finke Passive Immunization with Neutralizing Antibodies Interrupts the Mouse Mammary Tumor Virus Life Cycle J. Virol., September 1, 2003; 77(17): 9369 - 9377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vacheron, S. A. Luther, and H. Acha-Orbea Preferential Infection of Immature Dendritic Cells and B Cells by Mouse Mammary Tumor Virus J. Immunol., April 1, 2002; 168(7): 3470 - 3476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-I. Tschen, C. C. Bergmann, C. Ramakrishna, S. Morales, R. Atkinson, and S. A. Stohlman Recruitment Kinetics and Composition of Antibody-Secreting Cells Within the Central Nervous System Following Viral Encephalomyelitis J. Immunol., March 15, 2002; 168(6): 2922 - 2929. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Martin, S. R. Ruiz, G. M. del Hoyo, F. Anjuere, H. H. Vargas, M. Lopez-Bravo, and C. Ardavin Dramatic increase in lymph node dendritic cell number during infection by the mouse mammary tumor virus occurs by a CD62L-dependent blood-borne DC recruitment Blood, February 15, 2002; 99(4): 1282 - 1288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. P. Bowman, N. A. Kuklin, K. R. Youngman, N. H. Lazarus, E. J. Kunkel, J. Pan, H. B. Greenberg, and E. C. Butcher The Intestinal Chemokine Thymus-expressed Chemokine (CCL25) Attracts IgA Antibody-secreting Cells J. Exp. Med., January 22, 2002; 195(2): 269 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Finke, F. Baribaud, H. Diggelmann, and H. Acha-Orbea Extrafollicular Plasmablast B Cells Play a Key Role in Carrying Retroviral Infection to Peripheral Organs J. Immunol., May 15, 2001; 166(10): 6266 - 6275. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
