The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kishore, R.
Right arrow Articles by Hamilton, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kishore, R.
Right arrow Articles by Hamilton, T. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 1999, 162: 2457-2461.
Copyright © 1999 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: Clustered AU-Rich Elements Are the Target of IL-10-Mediated mRNA Destabilization in Mouse Macrophages1

Raj Kishore, Julie M. Tebo, Mikhail Kolosov and Thomas A. Hamilton2

Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44122


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study we show that IL-10-mediated inhibition of inflammatory gene expression can be mediated by an AU-rich element (ARE) cluster present in the 3' untranslated region (3'UTR) of sensitive genes. A series of chloramphenicol acetyl transferase (CAT) reporter gene constructs were prepared in which different fragments from the IL-10-sensitive KC mRNA 3'UTR were placed downstream of the coding region of the reporter gene CAT. CAT mRNA containing the KC 3'UTR was markedly destabilized as compared with the control CAT mRNA, and the decay rate was further increased in cells stimulated with IL-10. The KC 3'UTR contains an ARE cluster and three isolated ARE motifs. The ARE cluster spanning nucleotides 378–399 appeared to be both necessary and sufficient to mediate sensitivity to IL-10 because a 116-nucleotide fragment that contains the cluster conferred sensitivity, while mutation of the sequence between positions 378 and 399 eliminated sensitivity. The destabilizing effect of IL-10 was relatively selective, as the stability of chimeric CAT mRNAs was not modulated in cells treated with IFN-{gamma} or IL-4.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The inflammatory response is a key component of host defense that is tightly regulated in vivo 1, 2 . Mononuclear phagocytes participate in the host immune response, at least in part, through production of cytokines and chemokines that is initiated in response to an array of extracellular stimuli 1, 2, 3 . Because the inflammatory process may generate significant tissue injury, it is necessarily subject to negative control through the action of anti-inflammatory cytokines like IL-4 and IL-10 3, 4 .

IL-10, initially identified as a Th2 product that inhibited Th1 cell proliferation, has pleiotropic activities 5 . Although IL-10 can serve as a stimulatory factor for B cells and mast cells, it is known to inhibit the production of multiple cytokines, including IL-1ß, TNF-{alpha}, IFN-{gamma}, IL-4, IL-5, IL-6, IL-8, macrophage inflammatory protein (MIP)3-1{alpha}, MIP-1ß, and KC in macrophages and other inflammatory cell types 6, 7, 8, 9, 10, 11 . The importance of IL-10 in regulating inflammatory responses in vivo is indicated by the phenotype of the IL-10 knockout mouse, which develops chronic enterocolitis as well as other inflammation-related abnormalities 12, 13 .

Mechanisms of IL-10-suppressive action, though incompletely characterized, appear to be diverse and depend upon the gene of interest, the nature of the stimulus, and the cell type. Various studies have demonstrated that IL-10 can reduce the level of gene transcription, decrease the stability of specific mRNAs, and reduce their translation 11, 14, 15, 16 .

There is abundant evidence indicating that AU-rich elements (AREs) found in the 3' untranslated region (3'UTR) of short-lived mRNAs are important in determining mRNA stability and translation 17, 18 . In previous work using primary mouse macrophages, we have observed that IL-10 suppressed TNF-{alpha}, IL-1{alpha}, IL-1ß, and KC gene expression through selective destabilization of mRNA (Ref. 11 and H. S. Kim, J.M.T., and T.A.H., unpublished observations). A common feature of all of these mRNAs is their short half-life and the presence of multiple ARE sequences. In this study, we have asked whether nucleotide sequences contained in the 3'UTR of an IL-10-sensitive gene (KC) are able to confer IL-10 sensitivity to an otherwise stable reporter mRNA. Utilizing chimeric constructs containing various regions of the KC 3'UTR linked to the chloramphenicol acetyltransferase (CAT) gene, we have systematically defined the ARE motif in the 3'UTR as both necessary and sufficient for IL-10-mediated destabilization of reporter mRNA.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Mouse rIFN-{gamma}, DMEM, Dulbecco’s PBS, antibiotics, glutamine, guanidine isothiocyanate, and cesium chloride were obtained from Life Technologies (Gaithersburg, MD). FBS was purchased from BioWhittaker (Walkersville, MD). Transfast transfection reagent and plasmid pCATcontrol and CAT template DNA were purchased from Promega (Madison, WI). Maxiscript in vitro transcription kit and ribonuclease protection assay kit (RPA II) were obtained from Ambion (Austin, TX). Mouse rIL-10 and rIL-4 were purchased from Genzyme (Cambridge, MA). Dupont/New England Nuclear (Boston, MA) was the source of {alpha}-[32P]-UTP. Polyacrylamide gel electrophoresis and protein assay reagents were purchased from Bio-Rad Laboratories (Richmond, CA). Actinomycin-D was purchased from Sigma (St. Louis, MO). TLC plates (silica gel 60) were obtained from Merck (Darmstadt, Germany).

Cell culture

The RAW264.7 mouse macrophage-like cell line was maintained as described previously 19 .

Preparation of reporter plasmids

The following chimeric constructs were used in this study: pCAT3'UTR 289–889(289–889), pCAT-AREmu 289–889(289–889), and pCAT-ARE 341–457(341–457). Numbers in parentheses denote nucleotide position as defined from the KC cDNA sequence in the GenBank database. The fragments of the KC 3'UTR were prepared using PCR. The pCAT-AREmu was generated by substituting nucleotides between positions 382 and 394 (wild-type ARE cluster sequence, 378-ATTTATTTATGTATTTATTTA-398; mutant sequence (underlined), ATTTCGATCGAGATATCTTTA). PCR products were subcloned into pCAT3-control vector (Promega) at the XbaI site immediately downstream of the CAT-coding region. Orientation and sequence of cloned fragments were determined by sequencing in the Molecular Biotechnology Core Facility of the Lerner Research Institute.

Transfection

Reporter plasmids and a ß-galactosidase expression plasmid were transiently cotransfected into RAW264.7 cells using Transfast transfection reagent following the manufacturer’s instructions. Stable transfectants were established using a similar transfection protocol using cotransfection with a plasmid (pBABEpuromycin)-encoding puromycin resistance and were selected in 8 µg/ml of puromycin. CAT activity was measured as previously described 19 .

Ribonuclease protection assay (RPA)

Template DNA (1 µg) for CAT and ß-actin (Ambion) were subjected to in vitro transcription to generate {alpha}-[32P]-UTP-radiolabeled single-stranded RNA hybridization probe, using Maxiscript kit. Total cellular RNA (20 µg) from transfected cells treated with or without stimulus for indicated times were hybridized with labeled probe (5 x 104 cpm) following the manufacturer’s instructions. Protected fragments were electrophoresed on a 5% denaturing polyacrylamide gel containing 8 M urea in 1x TBE buffer (90 mM Tris, 64.6 mM boric acid, and 2.5 mM EDTA (pH 8.3)). Gels were exposed to x-ray film and quantified by phosphorescence analysis as described previously 19 .


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of the KC 3'UTR in determining sensitivity to IL-10 was examined using a chimeric reporter plasmid construct in which the 3'UTR of the KC gene (nucleotides (nt) 289–889) was inserted just downstream from the CAT-coding sequence (pCAT-3'UTR). RAW264.7 cells were transiently transfected with either unmodified pCATcontrol or pCAT-3'UTR, stimulated or not with IL-10, and treated with actinomycin D to prevent further transcription. Levels of CAT mRNA were measured immediately and following 30, 60, or 120 min of further incubation (Fig. 1Go). CAT mRNA transcribed from pCATcontrol was highly stable over the 2-h period of the experiment (t1/2 ~8 h) while the half-life of CAT mRNA containing the KC 3'UTR was reduced to ~75 min. IL-10 treatment did not alter the stability of control CAT mRNA but further destabilized mRNA containing the KC 3'UTR (t1/2 < 30 min). Enzyme activity in cells transfected with pCAT3'UTR was reduced by 90% in cells treated with IL-10 for 12 h (Fig. 2Go).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. The KC 3'UTR confers mRNA instability and sensitivity to IL-10 on CAT mRNA. RAW264.7 cells tranfected with pCATcontrol or pCAT3'UTR were treated with actinomycin D and stimulated or not with IL-10 (10 ng/ml). Cultures were harvested either immediately or following 30, 60, and 120 min of further incubation. Total cellular RNA was prepared, and levels of CAT and ß-actin mRNA were assayed by RPA. Levels of CAT mRNA were quantified by phosphorimage analysis and were normalized to those of ß-actin levels in the same experiment. Similar results were obtained in at least three independent experiments.

 


View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 2. CAT enzyme activity in cells transfected with pCAT3'UTR is reduced by treatment with IL-10. RAW264.7 cells transfected either with pCATcontrol or pCAT3'UTR were treated or not with IL-10 (10 ng/ml) for 12 h. Cytoplasmic extracts were prepared and assayed for CAT enzyme activity as described in Materials and Methods. Similar results were obtained in at least three separate experiments.

 
These results indicate that the 3'UTR of the KC gene contains nucleotide sequence that can confer constitutive instability and IL-10 sensitivity to an otherwise stable mRNA. Experiments using two plasmid constructs that encoded nt 289–504 and nt 405–889 of the KC 3'UTR, respectively, revealed that sensitivity to IL-10 was retained only in the 289–504 fragment (data not shown). On the basis of these observations, we hypothesized that the cluster of AREs spanning nt 378–398 might be responsible for regulating mRNA stability and IL-10 sensitivity. To test this possibility, two plasmid constructs were analyzed. The first, termed pCAT-ARE, contained a 116-nt fragment (nt 341–457) that includes the ARE cluster, while the second, termed pCAT-AREmu, contained the full KC 3'UTR in which the ARE cluster was mutated by nucleotide substitution at positions 382–394. Enzyme and RPA assays for CAT mRNA decay were conducted on cells transfected with each of these two plasmids either with or without IL-10 treatment. Cells transfected with pCAT-AREmu had high levels of CAT activity that was not altered by IL-10 (data not shown). Furthermore, CAT mRNA decay patterns were very similar to those seen in cells transfected with pCATcontrol (Fig. 3Go). In contrast, CAT activity and mRNA decay curves (Fig. 3Go) in pCAT-ARE-transfected cells were virtually the same as seen when cells were transfected with pCAT3'UTR. Since pCAT-AREmu differs from pCAT3'UTR only at positions 382–394, it is clear that both constitutive and IL-10-mediated mRNA destabilization are dependent upon the four clustered AUUUA motifs. These results suggest that the three additional AREs (located between nt 405 and 889) in the KC 3'UTR are not necessary for destabilization or IL-10 sensitivity.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. Four clustered ARE motifs in KC 3'UTR are necessary and sufficient to confer sensitivity to IL-10-mediated mRNA destabilization to CAT mRNA. RAW264.7 cells were transfected with pCAT-ARE and pCAT-AREmu and treated with actinomycin D and with or without IL-10 as described in Fig. 1Go. RPA assays were conducted on total RNA and were quantified by phosphor image analysis. Similar results were obtained in two separate experiments.

 
The results presented in Figs. 1–3GoGoGo were obtained under conditions of transient transfection. To eliminate possible artifacts that might be related to the high levels of expression for transfected sequences, we prepared permanently transfected cultures using each of the plasmid constructs described above. The behavior of each CAT mRNA was essentially identical to that described above and, thus, fully confirmed the studies using transient transfections (data not shown).

To determine whether the ability of IL-10 to destabilize mRNA was stimulus-specific, CAT mRNA decay was monitored in cells treated with IL-10, IL-4, or IFN-{gamma}. RAW264.7 cells stably transfected with pCAT-ARE were treated with IL-10, IL-4, or IFN-{gamma} in the presence of actinomycin D for 30, 60, or 120 min. CAT mRNA containing the ARE cluster decayed with a half-life of ~60–70 min, similar to that seen in Fig. 3Go (Fig. 4Go). In cells treated with either IL-4 or IFN-{gamma}, the half-life was unaltered while IL-10 treatment resulted in rapid destabilization and a half-life of <30 min. Thus, the effects of IL-10 on mRNA stability are relatively specific.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. The mRNA-destabilizing activity of IL-10 is selective. Cultures of puromycin-resistant RAW264.7 cells expressing CAT from pCAT-ARE were untreated or treated with IL-10 (10 ng/ml), IL-4 (10 ng/ml), or IFN-{gamma} (25 ng/ml) in the presence of actinomycin D for 30, 60, or 120 min, and levels of CAT mRNA were measured by RPA and quantified as described in Fig. 1Go. Similar results were obtained in two separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In prior work, we have demonstrated that IL-10 can selectively regulate the stability of the mouse KC mRNA in primary mouse macrophages 11 . To identify mRNA sequences that determine the sensitivity to IL-10-mediated destabilization, we have prepared plasmids encoding CAT-expression cassettes that contain sequences corresponding to different regions of the 3'UTR of the mouse KC gene. The stability of transfected plasmid-encoded CAT sequences have been examined in untreated and IL-10-treated RAW264.7 macrophages. On the basis of mutational analysis, we propose that a cluster of four overlapping AUUUA motifs within the 3'UTR of the KC gene is both necessary and sufficient to confer sensitivity to IL-10-induced mRNA destabilization. This conclusion is supported by two lines of evidence: 1) CAT mRNAs that contain either the complete 3'UTR or the ARE cluster (nt 341–457) confer both mRNA instability and IL-10 sensitivity, and 2) mRNA containing the full 3'UTR in which the ARE cluster has been mutated is stable and insensitive to IL-10.

The hypothesis that IL-10-mediated mRNA destabilization depends upon the presence of specific ARE sequence motifs in the 3'UTR of target mRNAs is consistent with the spectrum of genes that have been reported to exhibit enhanced decay in response to IL-10. Thus, mRNAs encoding TNF-{alpha}, IL-1{alpha}, IL-1ß, granulocyte-macrophage colony-stimulating factor, and the chemokine genes KC, MIP-1{alpha}, MIP-1ß, and IL-8 have all been reported to be destabilized in IL-10-treated cells 6, 9, 11, 14, 20, 21, 22 . A common feature of all of these mRNAs is the presence of multiple clusters of AU-rich sequences in their 3'UTR. In concert with the data presented above, these collective findings suggest the possibility that such ARE clusters may be a common target for the action of IL-10. Support for this is provided by the observation that TNF-{alpha} expression in transgenic mice whose TNF-{alpha} gene contains a mutant ARE cluster have lost sensitivity to regulation by IL-10 in vivo 23 . The effect of IL-10 appears to be relatively specific. Treatment of macrophages with IFN-{gamma} or IL-4 did not alter the stability of CAT mRNA containing the IL-10-sensitive ARE sequence.

ARE motifs vary considerably in size and spacing. The features of an ARE required for specific functional effects also vary, and the presence of an ARE motif does not necessarily predict alterations in mRNA stability. The pentameric sequence AUUUA was initially identified as the basic core of the ARE motif 17, 18 . Previous studies by Zubiaga et al. 24 and Lagnado et al. 25 , however, have shown that a single or isolated pentamer is not sufficient for mRNA destabilization. These investigators identified the minimal sequence motif required for destabilization of mRNA to be a nonameric sequence: UUAUUUA(U/A)(U/A). While multiple copies of this nonameric sequence were used in artificial plasmid constructs, a recent study has reported that the presence of a single nonameric motif in the 3'UTR of the gene encoding urokinase plasminogen activator receptor is sufficient to destabilize a reporter gene and confer sensitivity to integrin-mediated signaling 26 . According to our results, a single nonameric ARE (position 579–588) in the mouse KC 3'UTR is neither necessary nor sufficient to cause destabilization or confer sensitivity to IL-10 (data not shown). Similarly, IL-3 mRNA is destabilized by a series of isolated (nonoverlapping) pentameric AUUUA motifs 27 . Though the KC 3'UTR contains three isolated AUUUAs (one of which is part of the nonameric motif mentioned above), these do not appear to alter reporter mRNA decay either in untreated or IL-10-treated cells.

To understand the mechanism of ARE-mediated mRNA decay, a considerable effort has been invested to identify proteins that interact with ARE motifs; indeed, multiple ARE-binding proteins have now been cloned 28, 29 . While there are several reports linking ARE-binding proteins to stimulus-dependent change in the stability of ARE-containing mRNAs, little is known of the mechanisms involved 30, 31, 32 . Preliminary experiments have identified a protein that binds to the ARE cluster in IL-10-dependent fashion R.K. and T.A.H., unpublished observations). In this regard, the data presented above indicate that the ARE cluster motif in the KC 3'UTR determines both basal and IL-10-mediated KC mRNA stability. Whether both basal and IL-10-enhanced mRNA decay involve the action of the same ARE-binding proteins cannot be discerned from the available data.

The IL-10-induced signaling pathways through which the destabilizing effects are mediated are only poorly defined. Binding of IL-10 with the receptor chain results in phosphorylation and activation of the Janus family protein tyrosine kinases, TYK2 and Jak1, followed by activation of STAT1{alpha} and STAT3 33, 34 . While the participation of STAT3 appears to be required for the suppressive action of IL-10 (removal of STAT3 docking sites on the intracellular domain of the IL-10 receptor abrogate suppression), activation of STAT3 alone does not block IL-10 inhibitory function 35 . In a separate report, IL-10 suppressed protein tyrosine phosphorylation in LPS-treated macrophages 36 . Determining which, if any, of these signaling events are linked with control of mRNA stability will, however, require additional experiments.


    Footnotes
 
1 This work was supported by U.S. Public Health Service Grant CA39621. Back

2 Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Department of Immunology Cleveland Clinic Foundation NN10, 9500 Euclid Avenue, Cleveland, OH 44122. E-mail address: Back

3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; nt, nucleotide; 3'UTR, 3'untranslated region; ARE, AU-rich element; CAT, chloramphenicol acetyltransferase; RPA, RNase protection assay Back

Received for publication November 12, 1998. Accepted for publication December 30, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Adams, D. O., T. A. Hamilton. 1992. Macrophages as destructive cells in host defense. J. I. Gallin, and I. M. Goldstein, and R. Snyderman, eds. Inflammation: Basic Principles and Clinical Correlates 637. Raven Press, New York.
  2. Nathan, C. F., Z. A. Cohn. 1995. Cellular components of inflammation: monocytes and macrophages. W. Kelly, and E. Harris, and S. Ruddy, and R. Hedge, eds. Textbook of Rheumatology 144. W. B. Saunders, New York.
  3. Ohmori, Y., T. A. Hamilton. 1994. Regulation of macrophage gene expression by T cell derived lymphokines. Pharmacol. Ther. 63:235.[Medline]
  4. Street, N. E., T. R. Mosmann. 1991. Functional diversity of T lymphocytes due to secretion of different cytokine patterns. FASEB J. 5:171.[Abstract]
  5. Moore, K. W., A. O’Garra, R. De Waal Malefyt, P. Vieira, T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11:165.[Medline]
  6. Bogdan, C., Y. Vodovotz, C. Nathan. 1991. Macrophage deactivation by interleukin 10. J. Exp. Med. 174:1549.[Abstract/Free Full Text]
  7. Oswald, I. P., T. A. Wynn, A. Sher, S. L. James. 1992. Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor {alpha} required as a costimulatory factor for interferon {gamma}-induced activation. Proc. Natl. Acad. Sci. USA 89:8676.[Abstract/Free Full Text]
  8. Wang, P., P. Wu, J. C. Anthes, M. I. Siegel, R. W. Egan, M. M. Billah. 1994. Interleukin-10 inhibits interleukin-8 production in human neutrophils. Blood 83:2678.[Abstract/Free Full Text]
  9. Kasama, T., R. M. Strieter, N. W. Lukacs, M. D. Burdick, S. L. Kunkel. 1994. Regulation of neutrophil-derived chemokine expression by IL-10. J. Immunol. 152:3559.[Abstract]
  10. Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, A. O’Garra. 1991. Il-10 inhibits cytokine production by activated macrophages. J. Immunol. 147:3815.[Abstract]
  11. Kim, H. S., D. Armstrong, T. A. Hamilton, J. M. Tebo. 1998. IL-10 suppresses LPS-induced KC mRNA expression via a translation-dependent decrease in mRNA stability. J. Leukocyte Biol. 64:33.[Abstract]
  12. Berg, D. J., M. W. Leach, R. Kühn, K. Rajewsky, W. Müller, N. J. Davidson, D. Rennick. 1995. Interleukin 10 but not interleukin 4 is a natural suppressant of cutaneous inflammatory responses. J. Exp. Med. 182:99.[Abstract/Free Full Text]
  13. Rennick, D. M., M. M. Fort, N. J. Davidson. 1997. Studies with IL-10-/- mice: An overview. J. Leukocyte Biol. 61:389.[Abstract]
  14. Bogdan, C., J. Paik, Y. Vodovotz, C. Nathan. 1992. Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-ß and interleukin-10. J. Biol. Chem. 267:23301.[Abstract/Free Full Text]
  15. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, M. M. Billah. 1994. IL-10 inhibits transcription of cytokine genes in human peripheral blood mononuclear cells. J. Immunol. 153:811.[Abstract]
  16. Aste-Amezaga, M., X. Ma, A. Sartori, G. Trinchieri. 1998. Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10. J. Immunol. 160:5936.[Abstract/Free Full Text]
  17. Shaw, G., R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:659.[Medline]
  18. Ross, J.. 1995. mRNA stability in mammalian cells. Microbiol. Rev. 3:423.
  19. Ohmori, Y., T. A. Hamilton. 1995. The interferon-stimulated response element and a {kappa}B site mediate synergistic induction of murine IP-10 gene transcription by IFN-{gamma} and TNF{alpha}. J. Immunol. 154:5235.[Abstract]
  20. De Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, J. E. De Vries. 1991. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J. Exp. Med. 174:1209.[Abstract/Free Full Text]
  21. Levitz, S. M., A. Tabuni, S. H. Nong, D. T. Golenbock. 1996. Effects of interleukin-10 on human peripheral blood mononuclear cell responses to Cryptococcus neoformans, Candida albicans, and lipopolysaccharide. Infect. Immun. 64:945.[Abstract]
  22. Brown, C. Y., C. A. Lagnado, M. A. Vadas, G. J. Goodall. 1996. Differential regulation of the stability of cytokine mRNAs in lipopolysaccharide-activated blood monocytes in response to interleukin-10. J. Biol. Chem. 271:20108.[Abstract/Free Full Text]
  23. Kontoyiannis, D., M. Pasparakis, and G. Kollias. 1996. Generation and initial characterization of mice lacking TNF AU rich control elements. J. Leukocyte Biol. Supplement: (Abstract).
  24. Zubiaga, A. M., J. G. Belasco, M. E. Greenberg. 1995. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell Biol. 15:2219.[Abstract]
  25. Lagnado, C. A., C. Y. Brown, G. J. Goodall. 1994. AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A). Mol. Cell Biol. 14:7984.[Abstract/Free Full Text]
  26. Wang, G. J., M. Collinge, F. Blasi, R. Pardi, J. R. Bender. 1998. Posttranscriptional regulation of urokinase plasminogen activator receptor messenger RNA levels by leukocyte integrin engagement. Proc. Natl. Acad. Sci. USA 95:6296.[Abstract/Free Full Text]
  27. Stoecklin, G., S. Hahn, C. Moroni. 1994. Functional hierarchy of AUUUA motifs in mediating rapid interleukin-3 mRNA decay. J. Biol. Chem. 269:28591.[Abstract/Free Full Text]
  28. Bohjanen, P. R., B. Petryniak, C. H. June, C. B. Thompson, T. Lindsten. 1992. AU RNA-binding factors differ in their binding specificities and affinities. J. Biol. Chem. 267:6302.[Abstract/Free Full Text]
  29. Zhang, W., B. J. Wagner, K. Ehrenman, A. W. Schaefer, C. T. De Maria, D. Crater, K. De Haven, L. Long, G. Brewer. 1993. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol. Cell Biol. 13:7652.[Abstract/Free Full Text]
  30. Bohjanen, P. R., B. Petryniak, C. H. June, C. B. Thompson, T. Lindsten. 1991. An inducible cytoplasmic factor (AU-B) binds selectively to AUUUA multimers in the 3' untranslated region of lymphokine mRNA. Mol. Cell Biol. 11:3288.[Abstract/Free Full Text]
  31. Pande, A., K. D. Tremmel, C. T. DeMaria, B. C. Blaxall, W. A. Minobe, J. A. Sherman, J. D. Bisognano, M. R. Bristow, G. Brewer, J. D. Port. 1996. Regulation of the mRNA-binding protein AUF1 by activation of the ß-adrenergic receptor signal transduction pathway. J. Biol. Chem. 271:8493.[Abstract/Free Full Text]
  32. Sirenko, O. I., A. K. Lofquist, C. T. De Maria, J. S. Morris, G. Brewer, J. S. Haskill. 1997. Adhesion-dependent regulation of an A+U-rich element-binding activity associated with AUF1. Mol. Cell Biol. 17:3898.[Abstract]
  33. Finbloom, D. S., K. D. Winestock. 1995. IL-10 induces the tyrosine phosphorylation of Tyk2 and Jak1 and the differential assembly of STAT1{alpha} and STAT3 complexes in human T cells and monocytes. J. Immunol. 155:1079.[Abstract]
  34. Weber-Nordt, R. M., J. K. Riley, A. C. Greenlund, K. W. Moore, J. E. Darnell, B. D. Schreiber. 1996. Stat-3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J. Biol. Chem. 271:27954.[Abstract/Free Full Text]
  35. O’Farrell, A. M., Y. Lui, K. W. Moore, A. L. F. Mui. 1998. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for STAT3-dependent and independent pathways. EMBO J. 17:1006.[Medline]
  36. Geng, Y., E. Gulbins, A. Altmon, M. Lotz. 1994. Monocyte deactivation by interleukin 10 via inhibition of tyrosine kinase activity and the Ras signaling pathway. Proc. Natl. Acad. Sci. USA 91:8602.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
P.-h. Park, H. Huang, M. R. McMullen, K. Bryan, and L. E. Nagy
Activation of cyclic-AMP response element binding protein contributes to adiponectin-stimulated interleukin-10 expression in raw 264.7 macrophages
J. Leukoc. Biol., May 1, 2008; 83(5): 1258 - 1266.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Qin, C. A. Wilson, K. L. Roberts, B. J. Baker, X. Zhao, and E. N. Benveniste
IL-10 Inhibits Lipopolysaccharide-Induced CD40 Gene Expression through Induction of Suppressor of Cytokine Signaling-3
J. Immunol., December 1, 2006; 177(11): 7761 - 7771.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Rajasingh, E. Bord, C. Luedemann, J. Asai, H. Hamada, T. Thorne, G. Qin, D. Goukassian, Y. Zhu, D. W. Losordo, et al.
IL-10-induced TNF-alpha mRNA destabilization is mediated via IL-10 suppression of p38 MAP kinase activation and inhibition of HuR expression
FASEB J, October 1, 2006; 20(12): 2112 - 2114.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
J. Fan, N. M. Heller, M. Gorospe, U. Atasoy, and C. Stellato
The role of post-transcriptional regulation in chemokine gene expression in inflammation and allergy
Eur. Respir. J., November 1, 2005; 26(5): 933 - 947.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Novotny, S. Datta, R. Biswas, and T. Hamilton
Functionally Independent AU-rich Sequence Motifs Regulate KC (CXCL1) mRNA
J. Biol. Chem., August 26, 2005; 280(34): 30166 - 30174.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Grutz
New insights into the molecular mechanism of interleukin-10-mediated immunosuppression
J. Leukoc. Biol., January 1, 2005; 77(1): 3 - 15.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Zhou, A. A. Nazarian, and S. T. Smale
Interleukin-10 Inhibits Interleukin-12 p40 Gene Transcription by Targeting a Late Event in the Activation Pathway
Mol. Cell. Biol., March 15, 2004; 24(6): 2385 - 2396.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Dai, S. Datta, M. Novotny, and T. A. Hamilton
TGF{beta} inhibits LPS-induced chemokine mRNA stabilization
Blood, August 15, 2003; 102(4): 1178 - 1185.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Biswas, S. Datta, J. D. Gupta, M. Novotny, J. Tebo, and T. A. Hamilton
Regulation of Chemokine mRNA Stability by Lipopolysaccharide and IL-10
J. Immunol., June 15, 2003; 170(12): 6202 - 6208.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Williams, G. Jarai, A. Smith, and P. Finan
IL-10 expression profiling in human monocytes
J. Leukoc. Biol., October 1, 2002; 72(4): 800 - 809.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Berlato, M. A. Cassatella, I. Kinjyo, L. Gatto, A. Yoshimura, and F. Bazzoni
Involvement of Suppressor of Cytokine Signaling-3 as a Mediator of the Inhibitory Effects of IL-10 on Lipopolysaccharide-Induced Macrophage Activation
J. Immunol., June 15, 2002; 168(12): 6404 - 6411.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. MacKenzie, N. Fernandez-Troy, and E. Espel
Post-transcriptional regulation of TNF-{alpha} during in vitro differentiation of human monocytes/macrophages in primary culture
J. Leukoc. Biol., June 1, 2002; 71(6): 1026 - 1032.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Motomura, M. Ohata, M. Satre, and H. Tsukamoto
Destabilization of TNF-{alpha} mRNA by retinoic acid in hepatic macrophages: implications for alcoholic liver disease
Am J Physiol Endocrinol Metab, September 1, 2001; 281(3): E420 - E429.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Xu, T. Yen, and C. L. Geczy
IL-10 Up-Regulates Macrophage Expression of the S100 Protein S100A8
J. Immunol., May 15, 2001; 166(10): 6358 - 6366.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Tedgui and Z. Mallat
Anti-Inflammatory Mechanisms in the Vascular Wall
Circ. Res., May 11, 2001; 88(9): 877 - 887.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Balto, H. Sasaki, and P. Stashenko
Interleukin-6 Deficiency Increases Inflammatory Bone Destruction
Infect. Immun., February 1, 2001; 69(2): 744 - 750.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Bakheet, M. Frevel, B. R. G. Williams, W. Greer, and K. S. A. Khabar
ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins
Nucleic Acids Res., January 1, 2001; 29(1): 246 - 254.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Sasaki, L. Hou, A. Belani, C.-Y. Wang, T. Uchiyama, R. Muller, and P. Stashenko
IL-10, But Not IL-4, Suppresses Infection-Stimulated Bone Resorption In Vivo
J. Immunol., October 1, 2000; 165(7): 3626 - 3630.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. M. Weber and S. M. Levitz
Chloroquine Interferes with Lipopolysaccharide-Induced TNF-{alpha} Gene Expression by a Nonlysosomotropic Mechanism
J. Immunol., August 1, 2000; 165(3): 1534 - 1540.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
C.-Y. Chen, R. Gherzi, J. S. Andersen, G. Gaietta, K. Jürchott, H.-D. Royer, M. Mann, and M. Karin
Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation
Genes & Dev., May 15, 2000; 14(10): 1236 - 1248.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. M. Tebo, S. Datta, R. Kishore, M. Kolosov, J. A. Major, Y. Ohmori, and T. A. Hamilton
Interleukin-1-mediated Stabilization of Mouse KC mRNA Depends on Sequences in both 5'- and 3'-Untranslated Regions
J. Biol. Chem., April 21, 2000; 275(17): 12987 - 12993.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. A. Terkeltaub
IL-10: An "Immunologic Scalpel" for Atherosclerosis?
Arterioscler Thromb Vasc Biol, December 1, 1999; 19(12): 2823 - 2825.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. D'Orso and A. C. C. Frasch
TcUBP-1, a Developmentally Regulated U-rich RNA-binding Protein Involved in Selective mRNA Destabilization in Trypanosomes
J. Biol. Chem., September 7, 2001; 276(37): 34801 - 34809.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kishore, R.
Right arrow Articles by Hamilton, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kishore, R.
Right arrow Articles by Hamilton, T. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS