|
|
||||||||
CUTTING EDGE |
Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44122
| Abstract |
|---|
|
|
|---|
or IL-4. | Introduction |
|---|
|
|
|---|
IL-10, initially identified as a Th2 product that inhibited Th1
cell proliferation, has pleiotropic activities 5 . Although IL-10 can
serve as a stimulatory factor for B cells and mast cells, it is known
to inhibit the production of multiple cytokines, including IL-1ß,
TNF-
, IFN-
, IL-4, IL-5, IL-6, IL-8, macrophage inflammatory
protein (MIP)3-1
,
MIP-1ß, and KC in macrophages and other inflammatory cell
types 6, 7, 8, 9, 10, 11 . The importance of IL-10 in regulating inflammatory
responses in vivo is indicated by the phenotype of the IL-10 knockout
mouse, which develops chronic enterocolitis as well as other
inflammation-related abnormalities 12, 13 .
Mechanisms of IL-10-suppressive action, though incompletely characterized, appear to be diverse and depend upon the gene of interest, the nature of the stimulus, and the cell type. Various studies have demonstrated that IL-10 can reduce the level of gene transcription, decrease the stability of specific mRNAs, and reduce their translation 11, 14, 15, 16 .
There is abundant evidence indicating that AU-rich elements (AREs)
found in the 3' untranslated region (3'UTR) of short-lived mRNAs are
important in determining mRNA stability and translation 17, 18 . In
previous work using primary mouse macrophages, we have observed that
IL-10 suppressed TNF-
, IL-1
, IL-1ß, and KC gene expression
through selective destabilization of mRNA (Ref. 11 and H. S.
Kim, J.M.T., and T.A.H., unpublished observations). A common
feature of all of these mRNAs is their short half-life and the presence
of multiple ARE sequences. In this study, we have asked whether
nucleotide sequences contained in the 3'UTR of an IL-10-sensitive gene
(KC) are able to confer IL-10 sensitivity to an otherwise stable
reporter mRNA. Utilizing chimeric constructs containing various regions
of the KC 3'UTR linked to the chloramphenicol acetyltransferase (CAT)
gene, we have systematically defined the ARE motif in the 3'UTR as both
necessary and sufficient for IL-10-mediated destabilization of reporter
mRNA.
| Materials and Methods |
|---|
|
|
|---|
Mouse rIFN-
, DMEM, Dulbeccos PBS, antibiotics, glutamine,
guanidine isothiocyanate, and cesium chloride were obtained from Life
Technologies (Gaithersburg, MD). FBS was purchased from BioWhittaker
(Walkersville, MD). Transfast transfection reagent and plasmid
pCATcontrol and CAT template DNA were purchased from Promega (Madison,
WI). Maxiscript in vitro transcription kit and ribonuclease protection
assay kit (RPA II) were obtained from Ambion (Austin, TX). Mouse rIL-10
and rIL-4 were purchased from Genzyme (Cambridge, MA).
Dupont/New England Nuclear (Boston, MA) was the source of
-[32P]-UTP. Polyacrylamide gel electrophoresis and
protein assay reagents were purchased from Bio-Rad Laboratories
(Richmond, CA). Actinomycin-D was purchased from Sigma (St. Louis, MO).
TLC plates (silica gel 60) were obtained from Merck (Darmstadt,
Germany).
Cell culture
The RAW264.7 mouse macrophage-like cell line was maintained as described previously 19 .
Preparation of reporter plasmids
The following chimeric constructs were used in this study: pCAT3'UTR 289889(289889), pCAT-AREmu 289889(289889), and pCAT-ARE 341457(341457). Numbers in parentheses denote nucleotide position as defined from the KC cDNA sequence in the GenBank database. The fragments of the KC 3'UTR were prepared using PCR. The pCAT-AREmu was generated by substituting nucleotides between positions 382 and 394 (wild-type ARE cluster sequence, 378-ATTTATTTATGTATTTATTTA-398; mutant sequence (underlined), ATTTCGATCGAGATATCTTTA). PCR products were subcloned into pCAT3-control vector (Promega) at the XbaI site immediately downstream of the CAT-coding region. Orientation and sequence of cloned fragments were determined by sequencing in the Molecular Biotechnology Core Facility of the Lerner Research Institute.
Transfection
Reporter plasmids and a ß-galactosidase expression plasmid were transiently cotransfected into RAW264.7 cells using Transfast transfection reagent following the manufacturers instructions. Stable transfectants were established using a similar transfection protocol using cotransfection with a plasmid (pBABEpuromycin)-encoding puromycin resistance and were selected in 8 µg/ml of puromycin. CAT activity was measured as previously described 19 .
Ribonuclease protection assay (RPA)
Template DNA (1 µg) for CAT and ß-actin (Ambion) were
subjected to in vitro transcription to generate
-[32P]-UTP-radiolabeled single-stranded RNA
hybridization probe, using Maxiscript kit. Total cellular RNA (20 µg)
from transfected cells treated with or without stimulus for indicated
times were hybridized with labeled probe (5 x 104
cpm) following the manufacturers instructions. Protected fragments
were electrophoresed on a 5% denaturing polyacrylamide gel containing
8 M urea in 1x TBE buffer (90 mM Tris, 64.6 mM boric acid, and 2.5 mM
EDTA (pH 8.3)). Gels were exposed to x-ray film and quantified
by phosphorescence analysis as described previously 19 .
| Results |
|---|
|
|
|---|
8 h) while the half-life of CAT
mRNA containing the KC 3'UTR was reduced to
75 min. IL-10 treatment
did not alter the stability of control CAT mRNA but further
destabilized mRNA containing the KC 3'UTR
(t1/2 < 30 min). Enzyme activity in
cells transfected with pCAT3'UTR was reduced by 90% in cells treated
with IL-10 for 12 h (Fig. 2
|
|
|
To determine whether the ability of IL-10 to destabilize mRNA was
stimulus-specific, CAT mRNA decay was monitored in cells treated with
IL-10, IL-4, or IFN-
. RAW264.7 cells stably transfected with
pCAT-ARE were treated with IL-10, IL-4, or IFN-
in the presence of
actinomycin D for 30, 60, or 120 min. CAT mRNA containing the ARE
cluster decayed with a half-life of
6070 min, similar to that seen
in Fig. 3
(Fig. 4
). In cells treated with
either IL-4 or IFN-
, the half-life was unaltered while IL-10
treatment resulted in rapid destabilization and a half-life of <30
min. Thus, the effects of IL-10 on mRNA stability are relatively
specific.
|
| Discussion |
|---|
|
|
|---|
The hypothesis that IL-10-mediated mRNA destabilization depends upon
the presence of specific ARE sequence motifs in the 3'UTR of target
mRNAs is consistent with the spectrum of genes that have been reported
to exhibit enhanced decay in response to IL-10. Thus, mRNAs encoding
TNF-
, IL-1
, IL-1ß, granulocyte-macrophage colony-stimulating
factor, and the chemokine genes KC, MIP-1
, MIP-1ß, and IL-8 have
all been reported to be destabilized in IL-10-treated cells 6, 9, 11, 14, 20, 21, 22 . A common feature of all of these mRNAs is the presence of
multiple clusters of AU-rich sequences in their 3'UTR. In concert with
the data presented above, these collective findings suggest the
possibility that such ARE clusters may be a common target for the
action of IL-10. Support for this is provided by the observation that
TNF-
expression in transgenic mice whose TNF-
gene contains a
mutant ARE cluster have lost sensitivity to regulation by IL-10 in vivo
23 . The effect of IL-10 appears to be relatively specific. Treatment
of macrophages with IFN-
or IL-4 did not alter the stability of CAT
mRNA containing the IL-10-sensitive ARE sequence.
ARE motifs vary considerably in size and spacing. The features of an ARE required for specific functional effects also vary, and the presence of an ARE motif does not necessarily predict alterations in mRNA stability. The pentameric sequence AUUUA was initially identified as the basic core of the ARE motif 17, 18 . Previous studies by Zubiaga et al. 24 and Lagnado et al. 25 , however, have shown that a single or isolated pentamer is not sufficient for mRNA destabilization. These investigators identified the minimal sequence motif required for destabilization of mRNA to be a nonameric sequence: UUAUUUA(U/A)(U/A). While multiple copies of this nonameric sequence were used in artificial plasmid constructs, a recent study has reported that the presence of a single nonameric motif in the 3'UTR of the gene encoding urokinase plasminogen activator receptor is sufficient to destabilize a reporter gene and confer sensitivity to integrin-mediated signaling 26 . According to our results, a single nonameric ARE (position 579588) in the mouse KC 3'UTR is neither necessary nor sufficient to cause destabilization or confer sensitivity to IL-10 (data not shown). Similarly, IL-3 mRNA is destabilized by a series of isolated (nonoverlapping) pentameric AUUUA motifs 27 . Though the KC 3'UTR contains three isolated AUUUAs (one of which is part of the nonameric motif mentioned above), these do not appear to alter reporter mRNA decay either in untreated or IL-10-treated cells.
To understand the mechanism of ARE-mediated mRNA decay, a considerable effort has been invested to identify proteins that interact with ARE motifs; indeed, multiple ARE-binding proteins have now been cloned 28, 29 . While there are several reports linking ARE-binding proteins to stimulus-dependent change in the stability of ARE-containing mRNAs, little is known of the mechanisms involved 30, 31, 32 . Preliminary experiments have identified a protein that binds to the ARE cluster in IL-10-dependent fashion R.K. and T.A.H., unpublished observations). In this regard, the data presented above indicate that the ARE cluster motif in the KC 3'UTR determines both basal and IL-10-mediated KC mRNA stability. Whether both basal and IL-10-enhanced mRNA decay involve the action of the same ARE-binding proteins cannot be discerned from the available data.
The IL-10-induced signaling pathways through which the destabilizing
effects are mediated are only poorly defined. Binding of IL-10 with the
receptor chain results in phosphorylation and
activation of the Janus family protein tyrosine kinases, TYK2 and Jak1,
followed by activation of STAT1
and STAT3 33, 34 . While the
participation of STAT3 appears to be required for the suppressive
action of IL-10 (removal of STAT3 docking sites on the intracellular
domain of the IL-10 receptor abrogate suppression), activation of STAT3
alone does not block IL-10 inhibitory function 35 . In a separate
report, IL-10 suppressed protein tyrosine
phosphorylation in LPS-treated macrophages 36 .
Determining which, if any, of these signaling events are linked
with control of mRNA stability will, however, require additional
experiments.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Department of Immunology Cleveland Clinic Foundation NN10, 9500 Euclid Avenue, Cleveland, OH 44122. E-mail address: ![]()
3 Abbreviations used in this paper: MIP, macrophage inflammatory protein; nt, nucleotide; 3'UTR, 3'untranslated region; ARE, AU-rich element; CAT, chloramphenicol acetyltransferase; RPA, RNase protection assay ![]()
Received for publication November 12, 1998. Accepted for publication December 30, 1998.
| References |
|---|
|
|
|---|
required as a costimulatory factor for interferon
-induced activation. Proc. Natl. Acad. Sci. USA 89:8676.
B site mediate synergistic induction of murine IP-10 gene transcription by IFN-
and TNF
. J. Immunol. 154:5235.[Abstract]
and STAT3 complexes in human T cells and monocytes. J. Immunol. 155:1079.[Abstract]
This article has been cited by other articles:
![]() |
P.-h. Park, H. Huang, M. R. McMullen, K. Bryan, and L. E. Nagy Activation of cyclic-AMP response element binding protein contributes to adiponectin-stimulated interleukin-10 expression in raw 264.7 macrophages J. Leukoc. Biol., May 1, 2008; 83(5): 1258 - 1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, C. A. Wilson, K. L. Roberts, B. J. Baker, X. Zhao, and E. N. Benveniste IL-10 Inhibits Lipopolysaccharide-Induced CD40 Gene Expression through Induction of Suppressor of Cytokine Signaling-3 J. Immunol., December 1, 2006; 177(11): 7761 - 7771. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rajasingh, E. Bord, C. Luedemann, J. Asai, H. Hamada, T. Thorne, G. Qin, D. Goukassian, Y. Zhu, D. W. Losordo, et al. IL-10-induced TNF-alpha mRNA destabilization is mediated via IL-10 suppression of p38 MAP kinase activation and inhibition of HuR expression FASEB J, October 1, 2006; 20(12): 2112 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fan, N. M. Heller, M. Gorospe, U. Atasoy, and C. Stellato The role of post-transcriptional regulation in chemokine gene expression in inflammation and allergy Eur. Respir. J., November 1, 2005; 26(5): 933 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Novotny, S. Datta, R. Biswas, and T. Hamilton Functionally Independent AU-rich Sequence Motifs Regulate KC (CXCL1) mRNA J. Biol. Chem., August 26, 2005; 280(34): 30166 - 30174. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Grutz New insights into the molecular mechanism of interleukin-10-mediated immunosuppression J. Leukoc. Biol., January 1, 2005; 77(1): 3 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhou, A. A. Nazarian, and S. T. Smale Interleukin-10 Inhibits Interleukin-12 p40 Gene Transcription by Targeting a Late Event in the Activation Pathway Mol. Cell. Biol., March 15, 2004; 24(6): 2385 - 2396. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dai, S. Datta, M. Novotny, and T. A. Hamilton TGF{beta} inhibits LPS-induced chemokine mRNA stabilization Blood, August 15, 2003; 102(4): 1178 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Biswas, S. Datta, J. D. Gupta, M. Novotny, J. Tebo, and T. A. Hamilton Regulation of Chemokine mRNA Stability by Lipopolysaccharide and IL-10 J. Immunol., June 15, 2003; 170(12): 6202 - 6208. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Williams, G. Jarai, A. Smith, and P. Finan IL-10 expression profiling in human monocytes J. Leukoc. Biol., October 1, 2002; 72(4): 800 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Berlato, M. A. Cassatella, I. Kinjyo, L. Gatto, A. Yoshimura, and F. Bazzoni Involvement of Suppressor of Cytokine Signaling-3 as a Mediator of the Inhibitory Effects of IL-10 on Lipopolysaccharide-Induced Macrophage Activation J. Immunol., June 15, 2002; 168(12): 6404 - 6411. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. MacKenzie, N. Fernandez-Troy, and E. Espel Post-transcriptional regulation of TNF-{alpha} during in vitro differentiation of human monocytes/macrophages in primary culture J. Leukoc. Biol., June 1, 2002; 71(6): 1026 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Motomura, M. Ohata, M. Satre, and H. Tsukamoto Destabilization of TNF-{alpha} mRNA by retinoic acid in hepatic macrophages: implications for alcoholic liver disease Am J Physiol Endocrinol Metab, September 1, 2001; 281(3): E420 - E429. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xu, T. Yen, and C. L. Geczy IL-10 Up-Regulates Macrophage Expression of the S100 Protein S100A8 J. Immunol., May 15, 2001; 166(10): 6358 - 6366. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tedgui and Z. Mallat Anti-Inflammatory Mechanisms in the Vascular Wall Circ. Res., May 11, 2001; 88(9): 877 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balto, H. Sasaki, and P. Stashenko Interleukin-6 Deficiency Increases Inflammatory Bone Destruction Infect. Immun., February 1, 2001; 69(2): 744 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bakheet, M. Frevel, B. R. G. Williams, W. Greer, and K. S. A. Khabar ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins Nucleic Acids Res., January 1, 2001; 29(1): 246 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sasaki, L. Hou, A. Belani, C.-Y. Wang, T. Uchiyama, R. Muller, and P. Stashenko IL-10, But Not IL-4, Suppresses Infection-Stimulated Bone Resorption In Vivo J. Immunol., October 1, 2000; 165(7): 3626 - 3630. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Weber and S. M. Levitz Chloroquine Interferes with Lipopolysaccharide-Induced TNF-{alpha} Gene Expression by a Nonlysosomotropic Mechanism J. Immunol., August 1, 2000; 165(3): 1534 - 1540. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Chen, R. Gherzi, J. S. Andersen, G. Gaietta, K. Jürchott, H.-D. Royer, M. Mann, and M. Karin Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation Genes & Dev., May 15, 2000; 14(10): 1236 - 1248. [Abstract] [Full Text] |
||||
![]() |
J. M. Tebo, S. Datta, R. Kishore, M. Kolosov, J. A. Major, Y. Ohmori, and T. A. Hamilton Interleukin-1-mediated Stabilization of Mouse KC mRNA Depends on Sequences in both 5'- and 3'-Untranslated Regions J. Biol. Chem., April 21, 2000; 275(17): 12987 - 12993. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Terkeltaub IL-10: An "Immunologic Scalpel" for Atherosclerosis? Arterioscler Thromb Vasc Biol, December 1, 1999; 19(12): 2823 - 2825. [Full Text] [PDF] |
||||
![]() |
I. D'Orso and A. C. C. Frasch TcUBP-1, a Developmentally Regulated U-rich RNA-binding Protein Involved in Selective mRNA Destabilization in Trypanosomes J. Biol. Chem., September 7, 2001; 276(37): 34801 - 34809. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |