The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ågren, L. C.
Right arrow Articles by Lycke, N. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ågren, L. C.
Right arrow Articles by Lycke, N. Y.
The Journal of Immunology, 1999, 162: 2432-2440.
Copyright © 1999 by The American Association of Immunologists

Adjuvanticity of the Cholera Toxin A1-Based Gene Fusion Protein, CTA1-DD, Is Critically Dependent on the ADP-Ribosyltransferase and Ig-Binding Activity1

Lena C. Ågren*, Lena Ekman*, Björn Löwenadler{dagger}, John G. Nedrud{ddagger} and Nils Y. Lycke2,*

* Department of Medical Microbiology and Immunology, University of Göteborg, Göteborg, Sweden; {dagger} Department of Molecular Biology, Astra Hässle AB, Mölndal, Sweden; and {ddagger} Institute of Pathology, Case Western Reserve University, Cleveland, OH


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
The ADP-ribosylating enterotoxins, cholera toxin (CT) and Escherichia coli heat-labile toxin, are among the most powerful immunogens and adjuvants yet described. An innate problem, however, is their strong toxic effects, largely due to their promiscuous binding to all nucleated cells via their B subunits. Notwithstanding this, their exceptional immunomodulating ability is attracting increasing attention for use in systemic and mucosal vaccines. Whereas others have separated adjuvanticity from toxicity by disrupting the enzymatic activity of the A1 subunit by site-directed mutagenesis, we have constructed a nontoxic molecule that combines the full enzymatic activity of the A1 subunit with a B cell targeting moiety in a gene fusion protein, the CTA1-DD adjuvant. Despite its more selective binding properties, we found comparable adjuvant effects of the novel CTA1-DD adjuvant to that of CT. Here we unequivocally demonstrate, using a panel of mutant CTA1-DD molecules, that the immunomodulating ability of CTA1-DD is dependent on both an intact enzymatic activity and the Ig-binding ability of the DD dimer. Both agents, CT and CTA1-DD, ADP-ribosylate intact B cells. However, contrary to CT, no increase in intracellular cyclic AMP in the targeted cells was detected, suggesting that cyclic AMP may not be important for adjuvanticity. Most remarkably, CTA1-DD achieves similar immunomodulating effects to CT using a ganglioside-GM1 receptor-independent pathway for internalization.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 RESULTS
 Discussion
 References
 
Confusing and conflicting information regarding the mechanisms of adjuvanticity of cholera toxin (CT)3 and Escherichia coli heat-labile toxin (LT) has recently been presented 1, 2, 3, 4, 5, 6, 7, 8 . These structurally closely related and well defined molecules consist of a single enzymatically active A1 subunit linked to a pentamere of cell membrane binding B subunits via a connecting A2 subunit 9, 10, 11 . Whereas some investigators find intact adjuvanticity in mutants devoid of the ADP-ribosyltransferase activity, others have provided evidence suggesting that the enzymatic function is critically important 3, 4, 12 . Thus, the role of the A1 subunit for the adjuvant effect is poorly understood. In fact, mutant molecules with single amino acid changes in the A1 subunit, rendering the enzyme partially or even completely inactive, have demonstrated adjuvant function comparable with that of the intact holotoxin 2, 3, 6, 7, 13 . Therefore, it is not clear whether it is the ADP-ribosylating ability of the A1 subunit in the holotoxin or its structural role in the AB5 complex or both that is mediating the adjuvant effect.

Our laboratory achieved a major breakthrough in research on immunomodulation and vaccine adjuvant design when we constructed a gene fusion protein that combined the enzymatic activity of the A1 subunit of CT with a B cell targeting moiety derived from an Ig-binding fragment (D) of Staphylococcus aureus protein A. The novel immunomodulator, CTA1-DD, was found to exert adjuvant activity comparable with that of the intact CT after systemic as well as mucosal immunizations 14 . However, in contrast to CT, and as a consequence of the lack of receptor-binding B subunits, the CTA1-DD adjuvant was found to be completely nontoxic in vitro and in vivo. Thus, we had successfully separated the adjuvant function from the toxic side effects of the cholera holotoxin in this novel fusion protein. Furthermore, the CTA1-DD molecule not only represents a promising new strategy for vaccine adjuvant design but also proves the concept that novel immunomodulators can be constructed as gene fusion proteins that target powerful bacterial enzymes to selected groups of cells, thereby avoiding harmful side effects. We believe that among many diverse applications, this strategy has an obvious applicability in the treatment of autoimmune diseases as well as in future vaccine development.

CT and LT are among the most powerful immunoenhancing molecules we know of today, and their use in vaccines is currently being exploited 8, 15 . Since CT and LT have been intensely studied for several decades, our information on the structure and function of these toxins is extensive. For example, it is well documented that both CT and LT enter the cell via the ganglioside GM1-receptor, present on most nucleated mammalian cells, and that this binding appears to be central for immunogenicity as well as adjuvanticity 9, 16, 17, 18 . Furthermore, the toxins act via the A1 subunits to ADP-ribosylate GTP-binding proteins, of which the Gs{alpha} is thought to be most important, resulting in activation of adenylate cyclase and the subsequent increase in intracellular cyclic adenosine 3':5'-monophosphate (cAMP) 19, 20 . In addition, the toxins interact with yet other GTP-binding proteins known as ADP-ribosylation factors, ARFs, that are thought to augment ADP-ribosyltransferase activity as well as participate in endocytic and exocytic trafficking 21, 22 . For example, ARF1 is thought to engage in transport between the endoplasmic reticulum and the Golgi 21, 22 . Also, after internalization, CT itself is transported to the Golgi and endoplasmic reticulum, a process that is independent of the A subunit 23 . Thus, CTA1 may potentially have several functions that do not necessarily involve an enzymatic activity but merely are effects of other interactions that for example, might facilitate intracellular transport.

With the demonstration of a strong adjuvant function of the CTA1-DD molecule we have proved that CTA1, separate from the rest of the holotoxin, exerts immunomodulating ability. However, we did not assess whether the adjuvant activity was a result of ADP-ribosyltransferase activity and/or the effect of structural or binding properties of CTA1 in the fusion protein. To this end, we have now used site-directed mutagenesis to construct three enzymatically inactive mutants, CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD, and compared their adjuvant function to that of the native CTA1-DD molecule and CT 14 . Furthermore, we addressed the importance of the Ig-binding ability for the adjuvant function by introducing mutations in the Ig-binding D region of the CTA1-DD fusion protein. Using these newly constructed molecules, we now unequivocally demonstrate that the ADP-ribosyltransferase activity as well as the Ig-binding ability are critically required for the adjuvant function of the CTA1-DD fusion protein. These results also confirm the importance of ADP-ribosylation activity for the adjuvant function in intact CT or LT.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
RESULTS
 Discussion
 References
 
DNA constructions

A DNA fragment consisting of 582-bp-encoding amino acids 1–194 of CTA1 24 with flanking HindIII and BamHI sites was cloned into the pUC19 vector to generate pUC19-CTA1. This vector was used as a template for site-directed mutagenesis and subcloning of PCR products before sequencing. PCR was performed for mutagenesis of R7K in CTA1 with 5'-TTACGCCAAGCTTCTAATGATGATAAGTTATATAAGGCAGATTCGCGA-3' and 5'-TTGCATGATCATAAAGGTTGATATTCA-3' as forward and reverse primers, respectively. The CTA1 mutations D109A and E112K were constructed using the following oligonucleotides; D109A, 5'-ACCATCCATATATTTGGGAGTATGGAATCCCACCTAAAGCAGAAACTTCTTGTTCAGCTGGATGAGGACTG-3' (reverse) and 5'-ACAGGAAACAGCTATGAC-3' (forward); E112K, 5'-GATACCATCCATATATTTGGGAGTATGGAATCCCACCTAAAGCAGAAACTTTTTGT3' (reverse) and 5'-ACAGGAAACAGCTATGAC-3' (forward), respectively. The mutated CTA1-fragments were cloned into the expression vector pCTA1-DD as described earlier 14 to generate the vectors pCTA1-R7K-DD, pCTA1-D109A-DD, and pCTA1-E112K-DD. A CTA1-DD fusion protein lacking Fc-binding ability was prepared by substitution of Ile34 to Ala and Lys38 to Ala in both D fragments. These amino acid substitutions had previously been shown to strongly reduce the Fc-binding ability of the Z domain of staphylococcal protein A to Ig 25, 26 . Primers used for mutagenesis were 5'-ACTTAAACGAAGAGCAACGCAATGGTTTCGCTCAAAGTCTTGCAGACGATCCA-3' (forward) and 5'-ACAGGAAACAGCTATGAC-3' (reverse), respectively. The mutated D fragments were cloned into the pCTA1-DD expression vector 14 , cut with BspMI and BpuAI, to generate the pCTA1-DDI34A/K38A expression vector. To enable purification of these fusion proteins, plasmids were equipped with a C-terminal his-tag (his), pCTA1-DDhis and pCTA1-DDI34A/K38Ahis, by PCR using the following primers: 5'-GCTCCAAGATCATCGGGATCCGGAAG (forward) and 5'-GATCGAACAGTTTCCTAATGATGATGATGATGGTGCACCTGACCTGCTACCTCGGGTTT (reverse), respectively. The sequence and all DNA fragments obtained by PCR were confirmed 27 with a Taq DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) on an Applied Biosystems Model 373A DNA Sequencing system. Oligonucleotides were purchased from Scandinavian Gene Synthesis (Köping, Sweden). Low temperature melting agarose (NuSieve GTG; FMC Bioproducts, Rockland, MA) was used for preparative work, and Multi Purpose agarose (Boehringer Mannheim, Mannheim, Germany) was used for DNA analysis. PCR amplifications were performed using the DNA Thermal Cycler and Taq DNA polymerase (Perkin-Elmer, Foster City, CA). Restriction enzymes and T4 DNA ligase (Boehringer Mannheim and New England Biolabs, Beverly, MA) were used as recommended.

Expression and purification of fusion proteins

The CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD fusion proteins were produced in E. coli and affinity purified on an IgG column as described previously 14 . The CTA1-DDhis and CTA1-DDI34A/K38Ahis fusion proteins were expressed 14 and purified under reducing conditions (6 M guanidine-HCl). Denatured CTA1-DDhis and CTA1-DDI34A/K38Ahis were recovered in the soluble fraction and subsequently purified using a nickel chelate column according to the manufacturer’s instructions (Novagen, Madison, WI). Purified CTA1-DDhis and CTA1-DDI34A/K38Ahis were renatured by two sequential dialysis steps, overnight dialysis at 4°C against 1 M guanidine-HCl followed by 8 h of dialysis against 0.2 M acetic acid, pH 3. Typical yield per culture was 8–16 mg of fusion protein. The endotoxin content was <5 ng of LPS/µg of protein. The refolded soluble material was stored in 0.2 M acetic acid at 4°C.

Mice

Female C57BL/6 mice, age 8–12 wk, from B & K Universal AB, Sollentuna, Sweden were used for immunizations and nu/numice on the C57BL/6 background (Bomholt, Bomholtsgard, Denmark) were used for all B cell experiments in vitro.

Evaluation of adjuvanticity

Priming and booster immunizations were performed i.p. with purified CT (List Biological Laboratories, Campbell, CA) used at 1–2 µg/dose or affinity-purified CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, CTA1-E112K-DD gene fusion proteins used at 10 µg/dose. The CTA1-DDhis and CTA1-DDI34A/K38Ahis fusion proteins were used at a low dose which was equivalent to 5 µg and a higher dose equivalent to 10 µg of native CTA1-DD ADP-ribosyltransferase activity. As test Ags we used keyhole limpet hemocyanin (KLH; Calbiochem, San Diego, CA) or OVA (Sigma, St. Louis, MO), at 5 and 100 µg/dose, respectively. Putative adjuvants were simply admixed with the probe Ags in PBS before injection. Five mice per group were immunized at 10-day intervals, and the mice were sacrificed 6–8 days after the final immunization. Adjuvanticity was evaluated as enhanced serum anti-KLH, anti-OVA, or anti-CTA (List Biologicals) log10 titers by ELISA essentially as described 14, 28 .

Analysis of structure, binding, and conformation

A MiniProtean (Bio-Rad, Richmond, CA) system was used for SDS-PAGE analysis according to the manufacturer’s instructions. Ten micrograms of CTA1-DD, CTA1-R7K-DD CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, and CTA1-DDI34A/K38Ahis were dissolved in buffer and analyzed on a 12% Novex gel (San Diego, CA) under reducing conditions as described earlier 14 . Protein concentrations were determined by the Bio-Rad DC Protein Assay (Bio-Rad).

The binding ability to mouse Ig- of the CTA1-DD, CTA1-R7K-DD CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, or CTA1-DDI34A/K38Ahis fusion proteins was assessed by ELISA. Briefly, polystyrene microtiter plates (Maxisorp Immunoplates; Nunc, Roskilde, Denmark) were coated with 10 µg/ml of murine IgG or IgM (PharMingen, San Diego, CA) or IgG Fab or IgG Fc fragments (Jackson ImmunoResearch Labs, West Port, PA) in PBS. Plates were blocked with 0.1% BSA in PBS/0.05% Tween 20 (PBST) for 1 h at 37°C, and serial 1:2 dilutions of the fusion proteins starting with 100 µg/ml were added to duplicate wells. Plates were incubated for 1 h at room temperature (room temperature), washed with PBST, and alkaline phosphatase-conjugated chicken anti-staphylococcal protein A Abs (Immunsystem AB, Stockholm, Sweden), was added to the plates at 1/500 dilution. After 1h bound Abs were visualized using N-p-nitrophenylphosphate (Sigma) substrate in diethanolamine buffer, and the reaction was read at 405 nm using a Thermomax microplate reader (Molecular Devices, Sunnyvale, CA). The ability of mutant or native CTA1-DD molecules to bind to naive B cells in vivo was assessed by FACS. Before analysis, i.v injections of 20 µg of mutant or native CTA1-DD fusion protein were performed. CTA1-DD on B cells was detected by double-labeling of the isolated splenocytes with phycoerythrin- and FITC-conjugated anti-IgD (PharMingen) and anti-protein A (Immunsystem AB) Abs, respectively, using a FACscan (Becton Dickinson, San Jose, CA) 14 . Gates were set on IgD+ cells which were analyzed for mean fluorescence intensity using histogram representation 14 .

CTA1-specific Abs from CT-hyperimmunized mice (generated by three i.p. immunizations with CT at 2 µg/dose) were used to detect conformational changes of CTA1 in the mutant fusion proteins. Briefly, microtiter plates (Maxisorp Immuno plates; Nunc) were coated with 10 µg/ml of human IgG (Jackson ImmunoResearch Labs) followed by CTA1-DD or mutant proteins incubated at 100 µg/ml for 1 h at room temperature. Thereafter, hyperimmune CT-specific serum in serial dilutions was added to the plates and allowed to incubate for 1 h at room temperature. The degree of recognition of CTA1 in the different mutants by CTA-hyperimmune sera was visualized by the addition of alkaline phosphatase-conjugated goat anti-mouse IgG1 (Southern Biotechnology Associates, Birmingham, AL) at 1/200 followed by N-p-nitrophenylphosphate substrate as described above.

ADP-ribosyltransferase and cAMP activity

Determinations of ADP-ribosyltransferase and cAMP activity was performed as previously described 10, 14, 29 . Briefly, the NAD:agmatine assay was used to detect enzymatic activity in twofold dilutions, beginning at 10 µg/ml, of CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, and CTA1-DDI34A/K38Ahis or CT by assessing the ADP-ribosylagmatine formation through incorporation of [U-14C] adenine. A commercial cAMP-test kit was used according to the manufacturer’s instructions (Amersham International, Little Chalfont, U.K.). Briefly, spleen B cells (107 cells/ml) from nu/nu mice or enriched peritoneal macrophages (4 x 106 cells/ml) were incubated with or without various concentrations of CT, rCTB CTA1-DD, or the various mutants and the level of cAMP induction was determined after 1 h or at later time points and calculated from a standard curve.

cAMP-independent B cell proliferation was determined essentially as described 30 . Briefly, triplicate cultures of nu/nu B cells (105 cells/well) were incubated in Iscove’s medium containing 10% FCS with 0.1 µg/ml CT, 10 µg/ml CTA1-DD, 10 µg/ml CTA1-R7K-DD, or 10 µg/ml rCTB together with 1 µM ionomycin with or without 10 mM 3-aminobenzamide (Sigma-Aldrich, St. Louis, MO) 31 . After 3 days, [3H]thymidine (1 µCi; Amersham) was added for the final 18 h of culture. The cells were harvested on glass fiber filters, and the [3H]TdR uptake was assessed using a ß-scintillation counter (1450 MicroBetaTriLux, Wallac, FL).

Statistical analysis. We used the t test for independent samples for analysis of significance.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
Discussion
 References
 
The ADP-ribosyltransferase activity of CTA1-DD is critical for the adjuvant function

The CTA1-DD fusion protein provides a unique possibility to experimentally address the role of the enzymatic activity of CTA1 for the adjuvant effect of the bacterial enterotoxins, CT and LT 14 . A broad approach was taken to evaluate whether the CTA1-DD molecule required ADP-ribosyltransferase activity or not for the adjuvant function. We constructed three enzymatically inactive mutants, CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD (Fig. 1Go). Using the cell-free NAD-agmatine assay, we observed that while the mutants failed to demonstrate ADP-ribosyltransferase activity even at the highest doses tested (Fig. 2Go), CTA1-DD exhibited an enzymatic activity that was roughly 50%, on a molar level, of that of the holotoxin. Following an i.p. priming and booster immunization with KLH or OVA in the presence or absence of active CTA1-DD or the inactive mutants, serum Ab formation was monitored. We found that the adjuvant effect of CTA1-DD was comparable (p < 0.05) with that of CT whereas the enzymatically inactive mutants CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD all failed to significantly augment systemic immune responses above that seen with Ag alone (Fig. 3Go). Thus, the ADP-ribosyltransferase activity was essential for the adjuvant functions. Substitutions in the CTA1 molecule at positions Arg7 to Lys, Asp109 to Ala and Glu112 to Lys completely abolished the ADP-ribosyltransferase activity and concomitantly the mutants lost their adjuvant function in vivo. The data strongly suggest that CTA1 exerts adjuvant effect in association with enzymatic activity and that structurally related properties or functions such as the mere binding of CTA1 to a ligand did not suffice for an adjuvant effect.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 1. Schematic drawing of the CTA1 subunit and the amino acid substitutions in the enzymatically active cleft that were tested in the study. Ribbon model of the crystallographic structure of the {alpha}-chain of cholera toxin (51). Mutants are shown as space-filling models.

 


View larger version (9K):
[in this window]
[in a new window]
  		FIGURE 2. ADP-ribosyltransferase activity. The NAD-agmatine assay was used to detect enzymatic activity of serial 1:2-dilutions of CT ({diamondsuit}), CTA1-DD ({blacksquare}), CTA1-R7K-DD, CTA1-D109A-DD or CTA1-E112K-DD ({blacktriangleup}) were assayed for ADP-ribosylagmatine formation through incorporation of [U-14C]adenine. The values represent mean counts per minute (cpm) of three experiments with SD <5%. The mean background activity was 1987 cpm.

 


View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 3. Enzymatically inactive mutants of CTA1-DD lack adjuvant activity. Mice were immunized twice i.p. with 5 µg/dose of KLH (A) or 100 µg/dose of OVA (B) in the absence or presence of CT at 2 µg/dose or CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, or CTA1-E112K-DD at 10 µg/dose. Ag-specific serum Abs were determined by ELISA and expressed as total Ig mean log10-titers ± SD of three experiments. The CTA1-DD and CT-enhanced OVA and KLH titers are significantly different from titers generated in the presence of ADP-ribosyltransferase-inactive mutants of CTA1-DD; p < 0.005.

 
The enzymatically inactive CTA1-DD mutants seem to have a preserved structure

It could be argued that even a single amino acid substitution in the enzymatically active cleft of the CTA1-DD fusion protein might not only abolish enzyme function but also result in structural changes of the molecule. However, as illustrated by the representative data with the CTA1-R7K-DD mutant in Fig. 4Go, we were unable to disclose any conformational or degradative changes in the enzymatically inactive mutants: Mutants as well as the native CTA1-DD molecule all behaved as monomeric fusion proteins 37 kDa in mass (Fig. 4GoA). CTA1-specific antiserum from CT-hyperimmunized mice recognized CTA1-DD and the mutants equally well (Fig. 4GoB). Binding of the mutants to mouse IgD+ B cells after i.v. injection (Fig. 4GoC), or to intact IgM or IgG, or to IgG Fc and Fab fragments in solid phase in ELISA plates (Fig. 5Go) was retained. These results are in agreement with unaltered structural and Ig-binding properties of the mutant CTA1-DD fusion proteins.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 4. A comparative analysis of the structural and conformational integrity of the mutant and native CTA-DD molecules. A, The CTA1-R7K-DD fusion protein (lane 1) was analyzed after purification on a 12% Novex gel under reducing conditions and compared with native CTA1-DD (lane 2). Lane M shows m.w. markers (kilodaltons). Similar results were obtained with CTA1-D109A-DD or CTA1-E112K-DD. B, CTA1-specific epitope recognition was determined by ELISA by incubating the fusion proteins with serial dilutions of hyperimmune anti-CT serum. The analysis was performed in duplicates, and values are shown for the CTA1-R7K-DD mutant and expressed as mean absorbance at 405 nm of three independent experiments. SD was <5%. C, Ability of mutant and native CTA1-DD to bind to naive IgD+ B cells. Freshly isolated splenocytes were isolated 4 h after an i.v. injection of 20 µg/ml of the fusion protein. Isolated splenocytes were double-labeled with anti-staphylococcal protein A-FITC and anti-IgD-PE and analyzed for DD binding by FACS by setting live gates on IgD+ lymphocytes. The fluorescence intensity was monitored by histogram representation. Background labeling of splenocytes from control, PBS-injected mice, is seen in gray. This is a representative experiment of at least three using the CTA1-R7K-DD mutant. Similar results were obtained with the other two mutants.

 


View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 5. Native or enzymatically inactive mutants of CTA1-DD bind equally well to mouse Igs in solid phase. The ability of the inactive mutants to bind to mouse IgG, IgM, or Fab and Fc fragments of IgG was analyzed in duplicates by ELISA and compared with that of native CTA1-DD. This depicts the representative results of the CTA1-R7K-DD mutant and gives the mean absorbance values at 405 nm of three independent experiments with SD <5%.

 
In addition, we used CTA1-specific serum Abs as an internal standard to assess altered immunoenhancing activity of the mutated CTA1-DD molecules in vivo. CTA1-specific serum Abs were determined after i.p. immunizations. Both CT and CTA1-DD exerted strong immunoenhancing effect on CTA-specific responses, whereas, by contrast, the mutated CTA1-DD, represented by the CTA1-R7K-DD and CTA1-E112K-DD mutations in Fig. 6Go, stimulated poor or no (p < 0.05) CTA1-specific serum Ab titers. Thus, the lack of enzymatic activity dramatically reduced the immunogenicity of the CTA1-moiety itself.



View larger version (8K):
[in this window]
[in a new window]
  		FIGURE 6. Determinations of CTA1-specific Abs is a sensitive marker for strong immunoenhancement associated with enzymatically active CTA1-DD. Anti-CTA Abs in serum was assessed after i.p. immunization with CT, CTA1-DD, or the enzymatically inactive mutants CTA1-R7K-DD and CTA1-E112K-DD. Mice were immunized twice with CT at 2 µg/dose or CTA1-DD, CTA1-R7K-DD, and CTA1-E112K-DD at 10 µg/dose. CTA1-specific Ab titers in serum were determined by ELISA, and the results are expressed as total Ig mean ± SD log10 titers of three experiments. Similar results were obtained with the CTA1-D109A-DO mutant. p < 0.05.

 
Adjuvanticity of CTA1-DD is dependent on the ability to bind to Ig

Next we investigated the importance of the Ig-binding ability of the DD dimer for the adjuvant function of CTA1-DD. On the basis of earlier findings, we constructed a fusion protein that contained two mutations in the D fragments: Ile34 to Ala and Lys38 to Ala, CTA1-DDI34A/K38Ahis mutant 25, 26, 32 . To enable purification of the non-Ig-binding fusion proteins, we added a C-terminal his-tag consisting of six histidine residues (His)6 to the construct, and purification was performed using a nickel chelate column. For comparison, we also constructed a fully competent Ig-binding CTA1-DDhis fusion protein that was similarly purified. After assessment of the ADP-ribosylating capacity of the various constructs, we compared their immunoenhancing ability using doses of equivalent enzymatic activity. We found that the CTA1-DDI34A/K38Ahis mutant exhibited significantly (p < 0.01) lower immunoenhancement of KLH-specific serum Ab responses than did the native Ig-binding CTA1-DDhis fusion protein (Fig. 7Go). With a low dose of CTA1-DDI34A/K38Ahis mutant, no adjuvant effect was achieved, while the Ig-binding CTA1-DDhis gave substantial enhancement. With a higher dose, the immunoenhancing effect was almost 10-fold lower than the native Ig-binding CTA1-DDhis. Thus, the adjuvant effect of CTA1-DD was dramatically reduced when the Ig-binding ability of the D fragments were changed.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 7. The adjuvant effect of CTA1-DD requires binding to Ig via the DD-dimer. Mice were immunized twice with 5 µg/dose of KLH in the absence or presence of CTA1-DDhis or CTA1-DDI34A/K38Ahis in doses of comparable ADP-ribosyltransferase activity to native CTA1-DD. The low dose was equivalent to 5 µg, and the higher dose was equivalent to 10 µg of CTA1-DD ADP-ribosyltransferase activity. KLH-specific Ab titers in serum were determined by ELISA. Low dose: the CTA1-DDI34A/K38Ahis KLH-titers are significantly different from CTA1-DDhis but not from KLH alone (p < 0.01) (asterisk). High dose: the CTA1-DDI34A/K38Ahis KLH titers are significantly different from CTA1-DDhis and KLH alone (p < 0.05) (asterisk in oval).

 
However, the loss of adjuvanticity using the high dose of the CTA1-DDI34A/K38Ahis mutant was not complete compared with the PBS control (Fig. 7Go). A detailed analysis of the Ig-binding ability revealed that although the Fc binding of the CTA1-DDI34A/K38Ahis fusion protein was lost, it still had some residual binding to Fab fragments (Fig. 8Go). The diminished binding was particularly evident with low doses of CTA1-DDI34A/K38Ahis mutant, whereas higher doses bound Fab fragments. This observation would sufficiently explain the residual adjuvant effect of the CTA1-DDI34A/K38Ahis mutant observed with the high dose in vivo. Nevertheless, these results documented a close relationship between the Ig-binding ability and the adjuvant effects of the CTA1-DD molecule.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 8. The CTA1-DDI34A/K38Ahis mutant lacks Fc-binding ability but has partly retained the Fab-binding ability to mouse Igs. The ability of CTA1-DD with mutations in the D fragments to bind to mouse Ig in solid phase was investigated by ELISA. The CTA1-DDhis and CTA1-DDI34A/K38Ahis were analyzed in duplicates, and the results represent the mean results of three experiments with SD of <5%.

 
The adjuvant effect of CTA1-DD appears to be cAMP independent

In the present study, we have shown that the adjuvant effect of CTA1-DD was comparable with that of CT and required the ADP-ribosyltransferase activity, as exemplified by the lack of adjuvanticity of, e.g., the CTA1-R7K-DD mutation. Since CT acts by ADP-ribosylating G-proteins, primarily the Gs{alpha}, that activate adenylate cyclase, leading to increased intracellular cAMP levels, we investigated the effects of CTA1-DD on intracellular cAMP levels. Unexpectedly, we found that the intracellular cAMP levels in freshly isolated B cells or macrophages after treatment for 1 h with CTA1-DD did not change relative to control cultures, while they were substantially increased, in a dose-dependent manner, after treatment with CT (Table IGo). The CTA1-DD fusion protein did not affect cAMP levels even in doses 10,000-fold in excess of the active dose of CT (Table IGo), nor did we observe increases in intracellular cAMP at later times, whereas CT promoted a dose-dependent increase of intracellular cAMP at 1, 2 4, 8, or 21 h (not shown). On the other hand, as expected, the CTA1-R7K-DD mutant or rCTB both failed to affect intracellular cAMP levels (Table IGo). Consequently, the mechanism by which CTA1-DD exerts its immunoenhancing effect appears to be independent of cAMP and may not involve Gs{alpha}, which is believed to be the main target for the enzymatic activity of CTA1 in the intact holotoxin.


View this table:
[in this window]
[in a new window]
  		Table I. Stimulation of intracellular cAMP levels1

 
Induction of B cell proliferation confirms that CTA1-DD exerts ADP-ribosyltransferase activity on intact cells

Although CTA1-DD adjuvant was shown to act through ADP-ribosylation of target proteins in the cell-free NAD-agmatine system (Fig. 2Go), we did not know whether the fusion protein indeed also could act on intact cells. To this end, we took advantage of a previous study demonstrating that CT could exert cAMP-independent stimulatory effects on B cell proliferation in the presence of ionomycin 30, 33 . As illustrated in Fig. 9Go, both CT and CTA1-DD, but not rCTB or CTA1-R7K-DD, stimulated significant B cell proliferation in the presence of ionomycin (Fig. 9Go). The effect of CTA1-DD was dramatic and dose dependent, while that of CT was more modest, even in higher doses (not shown). Neither the CTA1-R7K-DD mutant nor rCTB could significantly support ionomycin-driven B cell proliferation. Moreover, when we added 3-aminobenzamide, a blocker of ADP-ribosylation 31 , the CTA1-DD- and CT-stimulated B cell proliferation was effectively inhibited to near background levels, while no effect of 3-aminobenzamide was seen on B cell proliferation in the presence of the CTA1-R7K-DD mutant or rCTB (Fig. 9Go). These results unequivocally demonstrated that the CTA1-DD fusion protein acts on intact B cells by exerting ADP-ribosyltransferase activity.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 9. CTA1-DD acts on intact B cells as assessed by the ability to promote ionomycin-driven ADP-ribosyltransferase-dependent proliferation. Enriched splenic B cells from nu/nu mice were incubated (2 x 105 cells/well) in Iscove’s total medium containing 10% FCS with 0.1 µg/ml CT, or 10 µg/ml rCTB, CTA1-DD, or CTA1-R7K-DD, together with 1 µM ionomycin (black bars) or with 1 µM ionomycin and 10 mM 3-aminobenzamide (striped bars), a blocker of ADP-ribosyltransferase activity. B cell proliferation was assessed by [3H]thymidine uptake on the third day of incubation using a ß-scintillation counter. Data are mean counts/minute (cpm) ± SD of triplicate cultures and representative of three independent experiments. Values for cultures with CT or CTA1-DD are significantly different from those with the enzymatically inactive mutant, CTA1-R7K-DD, rCTB, or medium (asterisk in oval) or those obtained in the presence of 3-aminobenzamide (p < 0.05) (asterisk).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
References
 
The mechanism for the adjuvant effect of the bacterial ADP-ribosylating enterotoxins, CT and LT, is still poorly understood 8, 34 . A current controversy in the field is the degree of adjuvanticity contributed by the GM1 receptor-binding B subunits relative to that contributed by the enzymatically active A1 subunit 8, 35, 36 . Here we show, using our newly constructed CTA1-DD fusion protein 14 , that ADP-ribosyltransferase activity of the CTA1 is a prerequisite for the adjuvant function. Moreover, adjuvanticity of the fusion protein is dependent on its ability to bind to Ig via the DD dimer. Thus, contrary to recently published work from several laboratories using mutant holotoxins, we can unequivocally demonstrate that the ADP-ribosyltransferase active A1 subunit has potent immunomodulating ability of its own 1, 2, 3, 13 . By excluding the B subunits and via direct targeting of the full enzymatic activity of the CTA1 subunit to B cells, and perhaps other APC, we have achieved full adjuvanticity with no toxicity. We believe that the CTA1-DD fusion protein, therefore, represents an important advancement in immunomodulation and vaccine adjuvant research.

The results of the present study are in keeping with findings reported by Rappuoli and coworkers 6, 7 , who demonstrated that mutants of CT or LT holotoxin with partial ADP-ribosylating activity, CTS106 and LTR72, were significantly stronger adjuvants than enzymatically inactive mutants. However, the inactive mutants, CTK63 or LTK63, had significantly better adjuvant ability than the CTB or LTB subunits given alone. This finding has raised the possibility that the AB5 complex may exert an adjuvant effect that is independent of the enzymatic activity but dependent on structural or binding properties of the A1 subunit. The authors put forward a hypothesis that adjuvanticity of the bacterial holotoxins is composed of two elements, enzymatic activity and, secondly, nontoxic AB5 complex-associated effects 7 . Possible targets for this second effect could be the cell membrane interaction of the B subunits or molecules that are bound by the A1 subunit. Because CTB and LTB are generally poor immunogens and adjuvants 6, 37, 38, 39, 40 as compared with the nontoxic mutants, one might speculate that it is the interaction of the A1 subunit with some undefined cellular proteins that is the most interesting. It is known that the enzymatic activity of CT and LT is enhanced by the interaction of these proteins with intracellular ARFs, and it is conceivable that an enzymatically inactive mutant A1 subunit might structurally interact with these GTP-binding proteins 9, 21, 41 . Although this hypothesis is attractive, our results using the CTA1-DD fusion protein do not support this explanation. In fact, we failed to demonstrate adjuvant activity in three different inactive CTA1-DD mutants. A single amino acid substitution in the active cleft disrupted the enzymatic activity but did not seem to alter the conformation or structure of the A1 subunit, thus probably still allowing binding to ARFs or other molecules. Thus, although our current results do not preclude a "structural" effect of CTA1, we believe our observations point in a different direction.

We would like to hypothesize that it is the ADP-ribosyltransferase activity of the A1 subunit per se that is important for the immunomodulating effect. Our study clearly has demonstrated that the enzymatic activity of the A1 subunit constitutes a unique and separate immunomodulating ability of the bacterial enterotoxin. The strength of this immunomodulation can easily be appreciated by the fact that we achieved an adjuvanticity with the CTA1-DD fusion protein of equal magnitude to that of the intact CT. The dose required for such an effect was roughly threefold higher than that of CT 14 , supporting the idea that the holotoxins, indeed, also host additional nontoxic AB5 complex-associated adjuvant properties. By inference, although not yet demonstrated, we predict that it would be possible to replace or omit the A1 subunit from the AB5 complex and still achieve stronger adjuvanticity than that obtained with the B subunits alone. No documentation is available on the adjuvant role of the A2 subunit in the AB5 complex. Perhaps a deletion of A1 would generate a molecule that still matches the AB5 complex in adjuvant capability. Such a molecule has been found an efficient delivery system for mucosal immune responses to epitopes replacing the A1 subunit epitopes 42 .

Thus, with regard to the second immunomodulating effect of the holotoxins mediated by the AB5 complex, we firmly believe that it is separate from the enzymatic activity of the A1 subunit. The question is whether this effect is operating through a single or multiple mechanisms. If the AB5 complex is more stable in vivo, as been suggested 43 , or even if it has a broader spectrum of interactions with cell membrane or cytosolic substructures than the B subunits alone, it is probable that immunomodulation dependent on the B subunit.

Such a notion can explain why a great variability in adjuvanticity has been reported for the nontoxic mutants and the B subunits. In particular, the route of administration is critically influencing the degree of adjuvanticity. No doubt the oral route is most demanding, whereas intranasal (i.n.) immunization appears to be more permissive 6, 37 . Indeed, several investigators have reported substantial adjuvant effects by CTB or LTB alone given i.n., whereas CTB or LTB, for the most part, has been found inactive given perorally as adjuvants 35, 40, 44, 45 . Interestingly, Yamamoto et al. 3, 46 recently reported that the E112K mutant CT, which is the same substitution tested by us in the CTA1-E112K-DD fusion protein, gave enhancing effects on immune responses after peroral or s.c. administration similar to that observed with the intact CT. Currently, we have no explanation for this discrepancy, but in the present study we specifically used the i.p. route for immunization to avoid possible involvement of variability in adjuvant and Ag uptake, as would be expected with the peroral or i.n. routes. An earlier study from our laboratory also failed to show adjuvant function of LT-E112K after oral immunization, whereas de Haan et al. 1, 40 found that nasal administration of this mutant gave good adjuvant effects. Taken together, these observations indicate that the route of adjuvant administration and type of Ag used for evaluation are crucial elements to consider when assessing the immunoenhancing effects of the mutant holotoxins.

Nevertheless, in practical terms all AB5 complex-dependent systems appear to have the same limitation, namely the requirement for uptake via the ganglioside GM1 receptor. Since this receptor is expressed on most nucleated cells, these adjuvant molecules can never be selective in their action. Although Douce et al. have, using the CTK63 and LTK63 mutants, provided evidence to suggest that LT may have broader immunogenic and adjuvant effects than CT, most investigators have found that both molecules lack these abilities in the mutated non-GM1 ganglioside-binding forms 16, 17, 36 . This is despite the fact that LT, as opposed to CT, can bind several other carbohydrate ligands 47 . Thus, adjuvanticity of CT and LT appears to depend on the ganglioside GM1 receptor pathway 16, 17 . It should be mentioned, however, that at variance with these observations de Haan et al. 1 have reported a non-GM1-binding LT mutant, LT-G33D, as well as a mutant that lack both binding and ADP-ribosyltransferase activity, LT-E112K/G33D, with retained adjuvant function after i.n. administration. This latter observation is controversial, but, together with the reports of strong adjuvant effects of the B subunits given i.n., it clearly demonstrates current problems in evaluation of adjuvant function using the i.n. route of administration.

The unique strength of the CTA1-DD system is that it targets the full enzymatic activity of the CTA1 to cells that are engaged in the formation of an immune response, leaving all other cells at rest. The inherent problem with the mutant holotoxins using the ganglioside GM1 pathway, incurred by the risk of toxicity, is the required balancing of adjuvanticity against enzymatic activity. Elegant studies have demonstrated that partially active LTR72 mutant can give similar adjuvant effects to the intact holotoxin in doses 50–100-fold higher 7 . Such dose increases appeared to be safe and nontoxic in mice, but for clinical use, adjuvant active, but nontoxic, doses may be difficult to achieve. Ongoing clinical trials with some of these mutants will hopefully answer this critical question 48, 49, 50 .

What is most remarkable with the CTA1-DD adjuvant, however, is the ability to circumvent the natural ganglioside GM1 pathway for entrance of CTA1 into the cell via binding through the DD dimer. Although we have not completely defined the ligands for the DD dimer, we strongly believe that the B cell receptor is the most likely candidate 14 . Previous and ongoing studies point to the idea that B cell targeting rather than binding to dendritic cells and macrophages occurs after injection 14 . Whether this effect is responsible for the adjuvanticity or not awaits to be proved. Clearly, the fact that admixed CTA1-DD, without conjugation to the Ag, achieves strong immunoenhancement in CD4+ T cell priming and humoral immunity 14 argues in favor of an involvement in Ag presentation. We have also reported that up-regulation of the costimulatory molecule CD86 is a primary event after treatment of naive B cells with CTA1-DD 14 .

In the present study, we extend the evidence for an immunomodulating effect of CTA-DD on binding to the B cell, by showing that B cell proliferation in the presence of ionomycin is greatly enhanced. In this regard, the effect of CTA1-DD mimics that of CT, whereas rCTB or the enzymatically inactive mutant CTA1-DD failed to affect this system. Benzamide, a known inhibitor of ADP-ribosyltransferase activity, substantially abrogated the proliferation induced by CTA1-DD and CT, clearly indicating that these agents use ADP-ribosyltransferase activity for the effect 30 . Although CTA1 in the holotoxin is thought to ADP-ribosylate the Gs{alpha} protein, leading to an activation of adenylate cyclase and subsequent increase of intracellular cAMP, we failed to show an effect on cAMP levels. In spite of numerous experiments using different conditions, high doses of the fusion protein and different time points, using isolated B cells or macrophages or two different murine B cell lines (X16, CH12LX), we were unable to mimic the effect of CT on cAMP levels. This observation was unexpected and highly surprising.

A speculation derived from the findings mentioned above is that CTA1 in the form of a fusion protein uses a pathway distinct from the classical Gs{alpha}-adenylate cyclase-cAMP pathway for its adjuvant effect. In fact, we believe our report is the first to suggest that CT exerts adjuvant activity independently of cAMP. Even though the pathway for entrance of CTA1 into the target cell differs between the fusion protein and the holotoxin, the present study indicates that a substrate (or substrates), which is ADP-ribosylated, in both cases is targeted by CTA1. The nature of this substrate may, thus, not be Gs{alpha} but one or several other G-proteins, or alternatively, it may be that the Gs{alpha}, in a different subcellular location, is not acting on adenylate cyclase. Future studies in our laboratory will address these important and challenging questions.


   Acknowledgments
 
We thank Karin Schön for skilled technical assistance and Martin Norin for help in preparing Fig. 1Go.


   Footnotes
 
1 This study was supported by The Swedish Medical Research Council, the Swedish Cancer Foundation, the WHO Transdisease Vaccinology Program, Astra Research Center Boston, EU project B104-98-0505, and National Institute of Health Grant R01 AI40701. Back

2 Address correspondence and reprint requests to Dr. Nils Lycke, Department of Medical Microbiology and Immunology, University of Göteborg, S-413 46 Göteborg, Sweden. E-mail address: Back

3 Abbreviations used in this paper: CT, cholera toxin, LT, Escherichia coli heat-labile toxin; ARFs, ADP-ribosylation factors; KLH, keyhole limpet hemocyanin; cAMP, cyclic adenosine 3':5'-monophosphate; i.n., intranasal. Back

Received for publication September 8, 1998. Accepted for publication November 10, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 

  1. de Haan, L., I. K. Feil, W. R. Verweij, M. Holtrop, W. G. Hol, E. Agsteribbe, J. Wilschut. 1998. Mutational analysis of the role of ADP-ribosylation activity and GM1-binding activity in the adjuvant properties of the Escherichia coli heat-labile enterotoxin towards intranasally administered keyhole limpet hemocyanin. Eur. J. Immunol. 28:1243.[Medline]
  2. Dickinson, B. L., J. D. Clements. 1995. Dissociation of Escherichia coli heat-labile enterotoxin adjuvanticity from ADP-ribosyltransferase activity. Infect. Immun. 63:1617.[Abstract]
  3. Yamamoto, S., Y. Takeda, M. Yamamoto, H. Kurazono, K. Imaoka, M. Yamamoto, K. Fujihashi, M. Noda, H. Kiyono, J. R. McGhee. 1997. Mutants in the ADP-ribosyltransferase cleft of cholera toxin lack diarrheagenicity but retain adjuvanticity. J. Exp. Med. 185:1203.[Abstract/Free Full Text]
  4. Douce, G., C. Turcotte, I. Cropley, M. Roberts, M. Pizza, M. Domenghini, R. Rappuoli, G. Dougan. 1995. Mutants of Escherichia coli heat-labile toxin lacking ADP-ribosyltransferase activity act as nontoxic, mucosal adjuvants. Proc. Natl. Acad. Sci. USA 92:1644.[Abstract/Free Full Text]
  5. Grant, C. C., R. J. Messer, Jr W. Cieplak. 1994. Role of trypsin-like cleavage at arginine 192 in the enzymatic and cytotonic activities of Escherichia coli heat-labile enterotoxin. Infect. Immun. 62:4270.[Abstract/Free Full Text]
  6. Douce, G., M. Fontana, M. Pizza, R. Rappuoli, G. Dougan. 1997. Intranasal immunogenicity and adjuvanticity of site-directed mutant derivatives of cholera toxin. Infect. Immun. 65:2821.[Abstract]
  7. Giuliani, M. M., G. Del Giudice, V. Giannelli, G. Dougan, G. Douce, R. Rappuoli, M. Pizza. 1998. Mucosal adjuvanticity and immunogenicity of LTR72, a novel mutant of Escherichia coli heat-labile enterotoxin with partial knockout of ADP-ribosyltransferase activity. J. Exp. Med. 187:1123.[Abstract/Free Full Text]
  8. Lycke, N.. 1997. The mechanism of cholera toxin adjuvanticity. Res. Immunol. 148:504.[Medline]
  9. Rappuoli, R., and M. Pizza. 1991. Structure and evolutionary aspects of ADP-ribosylating toxins. In Sourcebook of Bacterial Protein Toxins. J. E. A. a. J. H. Freer, ed. Academic Press, London, p. 1.
  10. Spangler, B. D.. 1992. Structure and function of cholera toxin and the related Escherichia coli heat-labile enterotoxin. Microbiol. Rev. 56:622.[Abstract/Free Full Text]
  11. Merritt, E. A., W. G. Hol. 1995. AB5 toxins. Curr. Opin. Struct. Biol. 5:165.[Medline]
  12. de Haan, L., W. R. Verweij, I. K. Feil, T. H. Lijnema, W. G. Hol, E. Agsteribbe, J. Wilschut. 1996. Mutants of the Escherichia coli heat-labile enterotoxin with reduced ADP-ribosylation activity or no activity retain the immunogenic properties of the native holotoxin. Infect. Immun. 64:5413.[Abstract]
  13. Tsuji, T., T. Yokochi, H. Kamiya, Y. Kawamoto, A. Miyama, Y. Asano. 1997. Relationship between a low toxicity of the mutant A subunit of enterotoxigenic Escherichia coli enterotoxin and its strong adjuvant action. Immunology 90:176.[Medline]
  14. Ågren, L., L. Ekman, B. Löwenadler, N. Lycke. 1997. A genetically engineered non-toxic vaccine adjuvant that combines B cell targeting with immunomodulation by cholera toxin A1 subunit. J. Immunol. 158:3936.[Abstract]
  15. Elson, C. O.. 1996. Cholera toxin as a mucosal adjuvant. Mucosal Vaccines Academic Press, Inc, New York.
  16. Guidry, J. J., L. Cardenas, E. Cheng, J. D. Clemens. 1997. Role of receptor binding in toxicity, immunogenicity, and adjuvanticity of Escherichia coli heat-labile enterotoxin. Infect. Immun. 65:4943.[Abstract]
  17. Nashar, T. O., H. M. Webb, S. Eaglestone, N. A. Williams, T. R. Hirst. 1996. Potent immunogenicity of the B subunits of Escherichia coli heat-labile enterotoxin: receptor binding is essential and induces differential modulation of lymphocyte subsets. Proc. Natl. Acad. Sci. USA 93:226.[Abstract/Free Full Text]
  18. Holmgren, J.. 1981. Actions of cholera toxin and the prevention and treatment of cholera. Nature 292:413.[Medline]
  19. Field, M., M. C. Rao, E. B. Chang. 1989. Intestinal electrolyte transport and diarrheal disease. N. Engl. J. Med. 321:800.[Medline]
  20. Moss, J., M. Vaughan. 1988. ADP-ribosylation of guanine nucleotide-binding regulatory proteins by bacterial toxins. Adv. Enzymol. 61:303.
  21. Donaldson, J. G., R. D. Klausner. 1994. ARF: a key regulatory switch in membrane traffic and organelle structure. Curr. Opin. Cell Biol. 6:527.[Medline]
  22. Moss, J., M. Vaughan. 1995. Structure and function of ARF proteins: Activators of cholera toxin and critical components of intracellular vesicular transport processes. J. Biol. Chem. 270:12327.[Free Full Text]
  23. Sofer, A., A. H. Futerman. 1996. Rate of retrograde transport of cholera toxin from the plasma membrane to the Golgi apparatus and endoplasmic reticulum decreases during neuronal development. J. Neurochem. 67:2134.[Medline]
  24. Mekalanos, J. J.. 1983. Duplication and amplification of toxin genes in Vibrio cholerae. Cell 35:253.[Medline]
  25. Jendeberg, L., B. Persson, R. Andersson, R. Karlsson, M. Uhlen, B. Nilsson. 1995. Kinetic analysis of the interaction between protein A domain variants and human Fc using plasmon resonance detection. J. Mol. Recognit. 8:270.[Medline]
  26. Cedergren, L., R. Andersson, B. Jansson, M. Uhlen, B. Nilsson. 1993. Mutational analysis of the interaction between staphylococcal protein A and human IgG1. Protein Eng. 6:441.[Abstract/Free Full Text]
  27. Sanger, F., S. Niclen, A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463.[Abstract/Free Full Text]
  28. Bromander, A. K., L. Ekman, M. Kopf, J. G. Nedrud, N. Y. Lycke. 1996. IL-6 deficient mice exhibit normal mucosal IgA responses to local immunizations and Helicobacter felis infection. J. Immunol. 156:4290.[Abstract]
  29. Tsuji, T., T. Inoue, A. Miyama, M. Noda. 1991. Glutamic acid-112 of the A subunit of heat-labile enterotoxin from enterotoxigenic Escherichia coli is important for ADP-ribosyltransferase activity. FEBS Lett. 291:319.[Medline]
  30. Francis, M. L., I. Okazaki, J. Moss, A. Kurosky, L. M. Pecanha, J. J. Mond. 1995. cAMP-independent effects of cholera toxin on B cell activation. III. Cholera toxin A subunit-mediated ADP-ribosylation acts synergistically with ionomycin or IL-4 to induce B cell proliferation. J. Immunol. 154:4956.[Abstract]
  31. Rankin, P. W., E. L. Jacobson, R. C. Benjamin, J. Moss, M. K. Jacobson. 1989. Quantitative studies of inhibitors of ADP-ribosylation in vitro and in vivo. J. Biol. Chem. 264:4312.[Abstract/Free Full Text]
  32. Ljungberg, U. K., B. Jansson, U. Niss, R. Nilsson, B. E. Sandberg, B. Nilsson. 1993. The interaction between different domains of staphylococcal protein A and human polyclonal IgG, IgA, IgM and F(ab')2: separation of affinity from specificity. Mol. Immunol. 30:1279.[Medline]
  33. Klaus, G. G., K. Vondy, M. Holman. 1987. Selective effects of cholera toxin on the activation of mouse B cells by different polyclonal activators. Eur. J. Immunol. 17:1787.[Medline]
  34. Elson, C. O., M. T. Dertzbaugh. 1994. Mucosal adjuvants. P. L. Ogra, and J. Mestecky, and M. E. Lamm, and W. Strober, and J. R. McGhee, and J. Bienenstock, eds. Handbook of Mucosal Immunology 391. Academic Press, San Diego.
  35. Douce, G., M. Pizza, M. Roberts, R. Rappuoli, G. Dougan. 1998. Mutant pertussis and Escherichia coli heat-labile toxins as adjuvants for enhancing local and systemic immune responses to coadministered, nonliving antigens. G. C. W. M. M. Levine, and J. B. Kaper, and J. S. Cobon, eds. New Generation Vaccines 253. Marcel Dekker, New York.
  36. de Haan, L., W. Verweij, E. Agsteribbe, J. Wilschut. 1998. The role of ADP-ribosylation and GM1-binding activity in the mucosal immunogenicity and adjuvanticity of the Escherichia coli heat-labile enterotoxin and Vibrio cholerae cholera toxin. Immunol. Cell Biol. 76:270.[Medline]
  37. Blanchard, T. G., N. Lycke, S. J. Czinn, J. Nedrud. 1998. Recombinant cholera toxin B subunit is not an effective mucosal adjuvant for oral immunization of mice against H. felis. Immunology 93:22.
  38. Lycke, N., J. Holmgren. 1986. Strong adjuvant properties of cholera toxin on gut mucosal immune responses to orally presented antigens. Immunology 39:301.
  39. Van der Heijden, P. J., A. T. Bianchi, M. Dol, J. W. Pals, W. Stok, B. A. Bokhout. 1991. Manipulation of intestinal immune responses against ovalbumin by cholera toxin and its B subunit in mice. Immunology 72:89.[Medline]
  40. Lycke, N., T. Tsuji, J. Holmgren. 1992. The adjuvant effect of Vibrio cholerae and Escherichia coli heat-labile enterotoxins is linked to their ADP-ribosyltransferase activity. Eur. J. Immunol. 22:2277.[Medline]
  41. Moss, J., M. Vaughan. 1995. Structure and function of ARF proteins: activators of cholera toxin and critical components of intracellular vesicular transport processes. J. Biol. Chem. 270:12327.
  42. Hajishengallis, G., S. K. Hollingshead, T. Koga, M. W. Russell. 1995. Mucosal immunization with a bacterial protein antigen genetically coupled to cholera toxin A2/B subunits. J. Immunol. 154:4322.[Abstract]
  43. Magagnoli, C., R. Manetti, M. R. Fontana, V. Giannelli, M. M. Giuliani, R. Rappuoli, M. Pizza. 1996. Mutations in the A subunit affect yield, stability, and protease sensitivity of nontoxic derivatives of heat-labile enterotoxin. Infect. Immun. 64:5434.[Abstract]
  44. Russell, M. W., H.-Y. Wu. 1991. Distribution, persistence, and recall of serum and salivary antibody responses to peroral immunization with protein antigen I/II of Streptococcus mutans coupled to the cholera toxin B subunit. Infect. Immun. 59:4061.[Abstract/Free Full Text]
  45. Tamura, S., Y. Samegai, H. Kurata, T. Nagamine, C. Aizawa, T. Kurata. 1988. Protection against influenza virus infection by vaccine inoculated intranasally with cholera toxin B subunit. Vaccine 6:409.[Medline]
  46. Yamamoto, S., H. Kiyono, M. Yamamoto, K. Imaoka, K. Fujihashi, F. W. Van Ginkel, M. Noda, Y. Takeda, J. R. McGhee. 1997. A nontoxic mutant of cholera toxin elicits Th2-type responses for enhanced mucosal immunity. Proc. Natl. Acad. Sci. USA 94:5267.[Abstract/Free Full Text]
  47. Fukuta, S., J. L. Magnani, E. M. Twiddy, R. K. Holmes, V. Ginsburg. 1988. Comparison of the carbohydrate-binding specificities of cholera toxin and Escherichia coli heat-labile enterotoxins LTh-I, LT-IIa, and LT-IIb. Infect. Immun. 56:1748.[Abstract/Free Full Text]
  48. Michetti, P., C. Kreiss, K. Kotloff, N. Porta, J. L. Blanco, D. Bachman, P. F. Sadlinger, I. Corthesy-Theulaz, G. Losonsky, R. Nichols, M. Stolte, T. Monath, S. Ackerman, S. Blum.. 1997. Oral immunization of H. pylori infected adults with recombinant urease and LT adjuvant. Gastroenterology 112:A1042. (Abstr.).
  49. Conference Coverage (Interscience Conference on Antimicrobial Agents and Chemotherapy). 1997. Vaccine Wkly. p. 4.
  50. Levine, M. M., J. B. Kaper, R. E. Black, M. L. Clemens. 1983. New knowledge on pathogenesis of bacterial enteric infections as applied to vaccine development. Microbiol. Rev. 47:510.[Free Full Text]
  51. Zhang, R. G., D. L. Scott, M. L. Westbrook, S. Nance, B. D. Spangler, G. G. Shipley, E. M. Westbrook. 1995. The three-dimensional crystal structure of cholera toxin. J. Mol. Biol. 251:563.[Medline]



This article has been cited by other articles:


Home page
 Infect. Immun.Home page
C. S. Andersen, J. Dietrich, E. M. Agger, N. Y. Lycke, K. Lovgren, and P. Andersen
The Combined CTA1-DD/ISCOMs Vector Is an Effective Intranasal Adjuvant for Boosting Prior Mycobacterium bovis BCG Immunity to Mycobacterium tuberculosis
Infect. Immun., January 1, 2007; 75(1): 408 - 416.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Helgeby, N. C. Robson, A. M. Donachie, H. Beackock-Sharp, K. Lovgren, K. Schon, A. Mowat, and N. Y. Lycke
The Combined CTA1-DD/ISCOM Adjuvant Vector Promotes Priming of Mucosal and Systemic Immunity to Incorporated Antigens by Specific Targeting of B Cells
J. Immunol., March 15, 2006; 176(6): 3697 - 3706.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Duverger, R. J. Jackson, F. W. van Ginkel, R. Fischer, A. Tafaro, S. H. Leppla, K. Fujihashi, H. Kiyono, J. R. McGhee, and P. N. Boyaka
Bacillus anthracis Edema Toxin Acts as an Adjuvant for Mucosal Immune Responses to Nasally Administered Vaccine Antigens
J. Immunol., February 1, 2006; 176(3): 1776 - 1783.
[Abstract] [Full Text] [PDF]

Home page
 J. Dent. Res.Home page
G. Hajishengallis, S. Arce, C.M. Gockel, T.D. Connell, and M.W. Russell
Immunomodulation with Enterotoxins for the Generation of Secretory Immunity or Tolerance: Applications for Oral Infections
J. Dent. Res., December 1, 2005; 84(12): 1104 - 1116.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
N. LYCKE
ADP-Ribosylating Bacterial Enzymes for the Targeted Control of Mucosal Tolerance and Immunity
Ann. N.Y. Acad. Sci., December 1, 2004; 1029(1): 193 - 208.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. M. Eriksson, K. M. Schon, and N. Y. Lycke
The Cholera Toxin-Derived CTA1-DD Vaccine Adjuvant Administered Intranasally Does Not Cause Inflammation or Accumulate in the Nervous Tissues
J. Immunol., September 1, 2004; 173(5): 3310 - 3319.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. M. I. Mowat, A. M. Donachie, S. Jagewall, K. Schon, B. Lowenadler, K. Dalsgaard, P. Kaastrup, and N. Lycke
CTA1-DD-Immune Stimulating Complexes: a Novel, Rationally Designed Combined Mucosal Vaccine Adjuvant Effective with Nanogram Doses of Antigen
J. Immunol., September 15, 2001; 167(6): 3398 - 3405.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Boirivant, I. J. Fuss, L. Ferroni, M. De Pascale, and W. Strober
Oral Administration of Recombinant Cholera Toxin Subunit B Inhibits IL-12-Mediated Murine Experimental (Trinitrobenzene Sulfonic Acid) Colitis
J. Immunol., March 1, 2001; 166(5): 3522 - 3532.
[Abstract] [Full Text] [PDF]