| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Medical Microbiology and Immunology, University of Göteborg, Göteborg, Sweden;
Department of Molecular Biology, Astra Hässle AB, Mölndal, Sweden; and
Institute of Pathology, Case Western Reserve University, Cleveland, OH
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
Our laboratory achieved a major breakthrough in research on immunomodulation and vaccine adjuvant design when we constructed a gene fusion protein that combined the enzymatic activity of the A1 subunit of CT with a B cell targeting moiety derived from an Ig-binding fragment (D) of Staphylococcus aureus protein A. The novel immunomodulator, CTA1-DD, was found to exert adjuvant activity comparable with that of the intact CT after systemic as well as mucosal immunizations 14 . However, in contrast to CT, and as a consequence of the lack of receptor-binding B subunits, the CTA1-DD adjuvant was found to be completely nontoxic in vitro and in vivo. Thus, we had successfully separated the adjuvant function from the toxic side effects of the cholera holotoxin in this novel fusion protein. Furthermore, the CTA1-DD molecule not only represents a promising new strategy for vaccine adjuvant design but also proves the concept that novel immunomodulators can be constructed as gene fusion proteins that target powerful bacterial enzymes to selected groups of cells, thereby avoiding harmful side effects. We believe that among many diverse applications, this strategy has an obvious applicability in the treatment of autoimmune diseases as well as in future vaccine development.
CT and LT are among the most powerful immunoenhancing molecules we know
of today, and their use in vaccines is currently being exploited 8, 15 . Since CT and LT have been intensely studied for several decades,
our information on the structure and function of these toxins is
extensive. For example, it is well documented that both CT and LT enter
the cell via the ganglioside GM1-receptor, present on most
nucleated mammalian cells, and that this binding appears to be central
for immunogenicity as well as adjuvanticity 9, 16, 17, 18 . Furthermore,
the toxins act via the A1 subunits to ADP-ribosylate GTP-binding
proteins, of which the Gs
is thought to be most important, resulting
in activation of adenylate cyclase and the subsequent increase in
intracellular cyclic adenosine 3':5'-monophosphate (cAMP) 19, 20 . In
addition, the toxins interact with yet other GTP-binding proteins known
as ADP-ribosylation factors, ARFs, that are thought to augment
ADP-ribosyltransferase activity as well as participate in endocytic and
exocytic trafficking 21, 22 . For example, ARF1 is thought to engage
in transport between the endoplasmic reticulum and the Golgi 21, 22 .
Also, after internalization, CT itself is transported to the Golgi and
endoplasmic reticulum, a process that is independent of the A subunit
23 . Thus, CTA1 may potentially have several functions that do not
necessarily involve an enzymatic activity but merely are effects of
other interactions that for example, might facilitate intracellular
transport.
With the demonstration of a strong adjuvant function of the CTA1-DD molecule we have proved that CTA1, separate from the rest of the holotoxin, exerts immunomodulating ability. However, we did not assess whether the adjuvant activity was a result of ADP-ribosyltransferase activity and/or the effect of structural or binding properties of CTA1 in the fusion protein. To this end, we have now used site-directed mutagenesis to construct three enzymatically inactive mutants, CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD, and compared their adjuvant function to that of the native CTA1-DD molecule and CT 14 . Furthermore, we addressed the importance of the Ig-binding ability for the adjuvant function by introducing mutations in the Ig-binding D region of the CTA1-DD fusion protein. Using these newly constructed molecules, we now unequivocally demonstrate that the ADP-ribosyltransferase activity as well as the Ig-binding ability are critically required for the adjuvant function of the CTA1-DD fusion protein. These results also confirm the importance of ADP-ribosylation activity for the adjuvant function in intact CT or LT.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
A DNA fragment consisting of 582-bp-encoding amino acids 1–194 of CTA1 24 with flanking HindIII and BamHI sites was cloned into the pUC19 vector to generate pUC19-CTA1. This vector was used as a template for site-directed mutagenesis and subcloning of PCR products before sequencing. PCR was performed for mutagenesis of R7K in CTA1 with 5'-TTACGCCAAGCTTCTAATGATGATAAGTTATATAAGGCAGATTCGCGA-3' and 5'-TTGCATGATCATAAAGGTTGATATTCA-3' as forward and reverse primers, respectively. The CTA1 mutations D109A and E112K were constructed using the following oligonucleotides; D109A, 5'-ACCATCCATATATTTGGGAGTATGGAATCCCACCTAAAGCAGAAACTTCTTGTTCAGCTGGATGAGGACTG-3' (reverse) and 5'-ACAGGAAACAGCTATGAC-3' (forward); E112K, 5'-GATACCATCCATATATTTGGGAGTATGGAATCCCACCTAAAGCAGAAACTTTTTGT3' (reverse) and 5'-ACAGGAAACAGCTATGAC-3' (forward), respectively. The mutated CTA1-fragments were cloned into the expression vector pCTA1-DD as described earlier 14 to generate the vectors pCTA1-R7K-DD, pCTA1-D109A-DD, and pCTA1-E112K-DD. A CTA1-DD fusion protein lacking Fc-binding ability was prepared by substitution of Ile34 to Ala and Lys38 to Ala in both D fragments. These amino acid substitutions had previously been shown to strongly reduce the Fc-binding ability of the Z domain of staphylococcal protein A to Ig 25, 26 . Primers used for mutagenesis were 5'-ACTTAAACGAAGAGCAACGCAATGGTTTCGCTCAAAGTCTTGCAGACGATCCA-3' (forward) and 5'-ACAGGAAACAGCTATGAC-3' (reverse), respectively. The mutated D fragments were cloned into the pCTA1-DD expression vector 14 , cut with BspMI and BpuAI, to generate the pCTA1-DDI34A/K38A expression vector. To enable purification of these fusion proteins, plasmids were equipped with a C-terminal his-tag (his), pCTA1-DDhis and pCTA1-DDI34A/K38Ahis, by PCR using the following primers: 5'-GCTCCAAGATCATCGGGATCCGGAAG (forward) and 5'-GATCGAACAGTTTCCTAATGATGATGATGATGGTGCACCTGACCTGCTACCTCGGGTTT (reverse), respectively. The sequence and all DNA fragments obtained by PCR were confirmed 27 with a Taq DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) on an Applied Biosystems Model 373A DNA Sequencing system. Oligonucleotides were purchased from Scandinavian Gene Synthesis (Köping, Sweden). Low temperature melting agarose (NuSieve GTG; FMC Bioproducts, Rockland, MA) was used for preparative work, and Multi Purpose agarose (Boehringer Mannheim, Mannheim, Germany) was used for DNA analysis. PCR amplifications were performed using the DNA Thermal Cycler and Taq DNA polymerase (Perkin-Elmer, Foster City, CA). Restriction enzymes and T4 DNA ligase (Boehringer Mannheim and New England Biolabs, Beverly, MA) were used as recommended.
Expression and purification of fusion proteins
The CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD fusion proteins were produced in E. coli and affinity purified on an IgG column as described previously 14 . The CTA1-DDhis and CTA1-DDI34A/K38Ahis fusion proteins were expressed 14 and purified under reducing conditions (6 M guanidine-HCl). Denatured CTA1-DDhis and CTA1-DDI34A/K38Ahis were recovered in the soluble fraction and subsequently purified using a nickel chelate column according to the manufacturer’s instructions (Novagen, Madison, WI). Purified CTA1-DDhis and CTA1-DDI34A/K38Ahis were renatured by two sequential dialysis steps, overnight dialysis at 4°C against 1 M guanidine-HCl followed by 8 h of dialysis against 0.2 M acetic acid, pH 3. Typical yield per culture was 8–16 mg of fusion protein. The endotoxin content was <5 ng of LPS/µg of protein. The refolded soluble material was stored in 0.2 M acetic acid at 4°C.
Mice
Female C57BL/6 mice, age 8–12 wk, from B & K Universal AB, Sollentuna, Sweden were used for immunizations and nu/numice on the C57BL/6 background (Bomholt, Bomholtsgard, Denmark) were used for all B cell experiments in vitro.
Evaluation of adjuvanticity
Priming and booster immunizations were performed i.p. with purified CT (List Biological Laboratories, Campbell, CA) used at 1–2 µg/dose or affinity-purified CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, CTA1-E112K-DD gene fusion proteins used at 10 µg/dose. The CTA1-DDhis and CTA1-DDI34A/K38Ahis fusion proteins were used at a low dose which was equivalent to 5 µg and a higher dose equivalent to 10 µg of native CTA1-DD ADP-ribosyltransferase activity. As test Ags we used keyhole limpet hemocyanin (KLH; Calbiochem, San Diego, CA) or OVA (Sigma, St. Louis, MO), at 5 and 100 µg/dose, respectively. Putative adjuvants were simply admixed with the probe Ags in PBS before injection. Five mice per group were immunized at 10-day intervals, and the mice were sacrificed 6–8 days after the final immunization. Adjuvanticity was evaluated as enhanced serum anti-KLH, anti-OVA, or anti-CTA (List Biologicals) log10 titers by ELISA essentially as described 14, 28 .
Analysis of structure, binding, and conformation
A MiniProtean (Bio-Rad, Richmond, CA) system was used for SDS-PAGE analysis according to the manufacturer’s instructions. Ten micrograms of CTA1-DD, CTA1-R7K-DD CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, and CTA1-DDI34A/K38Ahis were dissolved in buffer and analyzed on a 12% Novex gel (San Diego, CA) under reducing conditions as described earlier 14 . Protein concentrations were determined by the Bio-Rad DC Protein Assay (Bio-Rad).
The binding ability to mouse Ig- of the CTA1-DD, CTA1-R7K-DD CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, or CTA1-DDI34A/K38Ahis fusion proteins was assessed by ELISA. Briefly, polystyrene microtiter plates (Maxisorp Immunoplates; Nunc, Roskilde, Denmark) were coated with 10 µg/ml of murine IgG or IgM (PharMingen, San Diego, CA) or IgG Fab or IgG Fc fragments (Jackson ImmunoResearch Labs, West Port, PA) in PBS. Plates were blocked with 0.1% BSA in PBS/0.05% Tween 20 (PBST) for 1 h at 37°C, and serial 1:2 dilutions of the fusion proteins starting with 100 µg/ml were added to duplicate wells. Plates were incubated for 1 h at room temperature (room temperature), washed with PBST, and alkaline phosphatase-conjugated chicken anti-staphylococcal protein A Abs (Immunsystem AB, Stockholm, Sweden), was added to the plates at 1/500 dilution. After 1h bound Abs were visualized using N-p-nitrophenylphosphate (Sigma) substrate in diethanolamine buffer, and the reaction was read at 405 nm using a Thermomax microplate reader (Molecular Devices, Sunnyvale, CA). The ability of mutant or native CTA1-DD molecules to bind to naive B cells in vivo was assessed by FACS. Before analysis, i.v injections of 20 µg of mutant or native CTA1-DD fusion protein were performed. CTA1-DD on B cells was detected by double-labeling of the isolated splenocytes with phycoerythrin- and FITC-conjugated anti-IgD (PharMingen) and anti-protein A (Immunsystem AB) Abs, respectively, using a FACscan (Becton Dickinson, San Jose, CA) 14 . Gates were set on IgD+ cells which were analyzed for mean fluorescence intensity using histogram representation 14 .
CTA1-specific Abs from CT-hyperimmunized mice (generated by three i.p. immunizations with CT at 2 µg/dose) were used to detect conformational changes of CTA1 in the mutant fusion proteins. Briefly, microtiter plates (Maxisorp Immuno plates; Nunc) were coated with 10 µg/ml of human IgG (Jackson ImmunoResearch Labs) followed by CTA1-DD or mutant proteins incubated at 100 µg/ml for 1 h at room temperature. Thereafter, hyperimmune CT-specific serum in serial dilutions was added to the plates and allowed to incubate for 1 h at room temperature. The degree of recognition of CTA1 in the different mutants by CTA-hyperimmune sera was visualized by the addition of alkaline phosphatase-conjugated goat anti-mouse IgG1 (Southern Biotechnology Associates, Birmingham, AL) at 1/200 followed by N-p-nitrophenylphosphate substrate as described above.
ADP-ribosyltransferase and cAMP activity
Determinations of ADP-ribosyltransferase and cAMP activity was performed as previously described 10, 14, 29 . Briefly, the NAD:agmatine assay was used to detect enzymatic activity in twofold dilutions, beginning at 10 µg/ml, of CTA1-DD, CTA1-R7K-DD, CTA1-D109A-DD, CTA1-E112K-DD, CTA1-DDhis, and CTA1-DDI34A/K38Ahis or CT by assessing the ADP-ribosylagmatine formation through incorporation of [U-14C] adenine. A commercial cAMP-test kit was used according to the manufacturer’s instructions (Amersham International, Little Chalfont, U.K.). Briefly, spleen B cells (107 cells/ml) from nu/nu mice or enriched peritoneal macrophages (4 x 106 cells/ml) were incubated with or without various concentrations of CT, rCTB CTA1-DD, or the various mutants and the level of cAMP induction was determined after 1 h or at later time points and calculated from a standard curve.
cAMP-independent B cell proliferation was determined essentially as described 30 . Briefly, triplicate cultures of nu/nu B cells (105 cells/well) were incubated in Iscove’s medium containing 10% FCS with 0.1 µg/ml CT, 10 µg/ml CTA1-DD, 10 µg/ml CTA1-R7K-DD, or 10 µg/ml rCTB together with 1 µM ionomycin with or without 10 mM 3-aminobenzamide (Sigma-Aldrich, St. Louis, MO) 31 . After 3 days, [3H]thymidine (1 µCi; Amersham) was added for the final 18 h of culture. The cells were harvested on glass fiber filters, and the [3H]TdR uptake was assessed using a ß-scintillation counter (1450 MicroBetaTriLux, Wallac, FL).
Statistical analysis. We used the t test for independent samples for analysis of significance.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
The CTA1-DD fusion protein provides a unique possibility to
experimentally address the role of the enzymatic activity of CTA1 for
the adjuvant effect of the bacterial enterotoxins, CT and LT 14 . A
broad approach was taken to evaluate whether the CTA1-DD molecule
required ADP-ribosyltransferase activity or not for the adjuvant
function. We constructed three enzymatically inactive mutants,
CTA1-R7K-DD, CTA1-D109A-DD, and CTA1-E112K-DD (Fig. 1
). Using the cell-free NAD-agmatine
assay, we observed that while the mutants failed to demonstrate
ADP-ribosyltransferase activity even at the highest doses tested (Fig. 2), CTA1-DD exhibited an enzymatic
activity that was roughly 50%, on a molar level, of that of the
holotoxin. Following an i.p. priming and booster immunization with KLH
or OVA in the presence or absence of active CTA1-DD or the inactive
mutants, serum Ab formation was monitored. We found that the adjuvant
effect of CTA1-DD was comparable (p < 0.05)
with that of CT whereas the enzymatically inactive mutants CTA1-R7K-DD,
CTA1-D109A-DD, and CTA1-E112K-DD all failed to significantly augment
systemic immune responses above that seen with Ag alone (Fig. 3). Thus, the ADP-ribosyltransferase
activity was essential for the adjuvant functions. Substitutions in the
CTA1 molecule at positions Arg7 to Lys, Asp109
to Ala and Glu112 to Lys completely abolished the
ADP-ribosyltransferase activity and concomitantly the mutants lost
their adjuvant function in vivo. The data strongly suggest that CTA1
exerts adjuvant effect in association with enzymatic activity and that
structurally related properties or functions such as the mere binding
of CTA1 to a ligand did not suffice for an adjuvant effect.
|
|
|
It could be argued that even a single amino acid substitution in
the enzymatically active cleft of the CTA1-DD fusion protein might not
only abolish enzyme function but also result in structural changes of
the molecule. However, as illustrated by the representative data with
the CTA1-R7K-DD mutant in Fig. 4, we were
unable to disclose any conformational or degradative changes in the
enzymatically inactive mutants: Mutants as well as the native CTA1-DD
molecule all behaved as monomeric fusion proteins 37 kDa in mass (Fig. 4A). CTA1-specific antiserum from CT-hyperimmunized mice
recognized CTA1-DD and the mutants equally well (Fig. 4B).
Binding of the mutants to mouse IgD+ B cells after i.v.
injection (Fig. 4C), or to intact IgM or IgG, or to IgG Fc
and Fab fragments in solid phase in ELISA plates (Fig. 5) was retained. These results are in
agreement with unaltered structural and Ig-binding properties of the
mutant CTA1-DD fusion proteins.
|
|
, stimulated poor or no
(p < 0.05) CTA1-specific serum Ab titers.
Thus, the lack of enzymatic activity dramatically reduced the
immunogenicity of the CTA1-moiety itself.
|
Next we investigated the importance of the Ig-binding ability of
the DD dimer for the adjuvant function of CTA1-DD. On the basis of
earlier findings, we constructed a fusion protein that contained two
mutations in the D fragments: Ile34 to Ala and
Lys38 to Ala, CTA1-DDI34A/K38Ahis mutant 25, 26, 32 . To
enable purification of the non-Ig-binding fusion proteins, we added a
C-terminal his-tag consisting of six histidine residues
(His)6 to the construct, and purification was performed
using a nickel chelate column. For comparison, we also constructed a
fully competent Ig-binding CTA1-DDhis fusion protein that was similarly
purified. After assessment of the ADP-ribosylating capacity of the
various constructs, we compared their immunoenhancing ability using
doses of equivalent enzymatic activity. We found that the
CTA1-DDI34A/K38Ahis mutant exhibited significantly
(p < 0.01) lower immunoenhancement of
KLH-specific serum Ab responses than did the native Ig-binding
CTA1-DDhis fusion protein (Fig. 7). With
a low dose of CTA1-DDI34A/K38Ahis mutant, no adjuvant effect was
achieved, while the Ig-binding CTA1-DDhis gave substantial enhancement.
With a higher dose, the immunoenhancing effect was almost 10-fold lower
than the native Ig-binding CTA1-DDhis. Thus, the adjuvant effect of
CTA1-DD was dramatically reduced when the Ig-binding ability of the D
fragments were changed.
|
). A detailed analysis of the Ig-binding ability
revealed that although the Fc binding of the CTA1-DDI34A/K38Ahis fusion
protein was lost, it still had some residual binding to Fab fragments
(Fig. 8). The diminished binding was
particularly evident with low doses of CTA1-DDI34A/K38Ahis mutant,
whereas higher doses bound Fab fragments. This observation would
sufficiently explain the residual adjuvant effect of the
CTA1-DDI34A/K38Ahis mutant observed with the high dose in vivo.
Nevertheless, these results documented a close relationship between the
Ig-binding ability and the adjuvant effects of the CTA1-DD molecule.
|
In the present study, we have shown that the adjuvant effect of
CTA1-DD was comparable with that of CT and required the
ADP-ribosyltransferase activity, as exemplified by the lack of
adjuvanticity of, e.g., the CTA1-R7K-DD mutation. Since CT acts by
ADP-ribosylating G-proteins, primarily the Gs, that activate
adenylate cyclase, leading to increased intracellular cAMP levels, we
investigated the effects of CTA1-DD on intracellular cAMP levels.
Unexpectedly, we found that the intracellular cAMP levels in freshly
isolated B cells or macrophages after treatment for 1 h with
CTA1-DD did not change relative to control cultures, while they were
substantially increased, in a dose-dependent manner, after treatment
with CT (Table I). The CTA1-DD fusion
protein did not affect cAMP levels even in doses 10,000-fold in excess
of the active dose of CT (Table I), nor did we observe increases in
intracellular cAMP at later times, whereas CT promoted a dose-dependent
increase of intracellular cAMP at 1, 2 4, 8, or 21 h (not shown).
On the other hand, as expected, the CTA1-R7K-DD mutant or rCTB both
failed to affect intracellular cAMP levels (Table I). Consequently, the
mechanism by which CTA1-DD exerts its immunoenhancing effect appears to
be independent of cAMP and may not involve Gs, which is believed to
be the main target for the enzymatic activity of CTA1 in the intact
holotoxin.
|
Although CTA1-DD adjuvant was shown to act through
ADP-ribosylation of target proteins in the cell-free NAD-agmatine
system (Fig. 2), we did not know whether the fusion protein indeed also
could act on intact cells. To this end, we took advantage of a previous
study demonstrating that CT could exert cAMP-independent stimulatory
effects on B cell proliferation in the presence of ionomycin 30, 33 .
As illustrated in Fig. 9, both CT and
CTA1-DD, but not rCTB or CTA1-R7K-DD, stimulated significant B cell
proliferation in the presence of ionomycin (Fig. 9). The effect of
CTA1-DD was dramatic and dose dependent, while that of CT was more
modest, even in higher doses (not shown). Neither the CTA1-R7K-DD
mutant nor rCTB could significantly support ionomycin-driven B cell
proliferation. Moreover, when we added 3-aminobenzamide, a blocker of
ADP-ribosylation 31 , the CTA1-DD- and CT-stimulated B cell
proliferation was effectively inhibited to near background levels,
while no effect of 3-aminobenzamide was seen on B cell proliferation in
the presence of the CTA1-R7K-DD mutant or rCTB (Fig. 9). These results
unequivocally demonstrated that the CTA1-DD fusion protein acts on
intact B cells by exerting ADP-ribosyltransferase activity.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
The results of the present study are in keeping with findings reported by Rappuoli and coworkers 6, 7 , who demonstrated that mutants of CT or LT holotoxin with partial ADP-ribosylating activity, CTS106 and LTR72, were significantly stronger adjuvants than enzymatically inactive mutants. However, the inactive mutants, CTK63 or LTK63, had significantly better adjuvant ability than the CTB or LTB subunits given alone. This finding has raised the possibility that the AB5 complex may exert an adjuvant effect that is independent of the enzymatic activity but dependent on structural or binding properties of the A1 subunit. The authors put forward a hypothesis that adjuvanticity of the bacterial holotoxins is composed of two elements, enzymatic activity and, secondly, nontoxic AB5 complex-associated effects 7 . Possible targets for this second effect could be the cell membrane interaction of the B subunits or molecules that are bound by the A1 subunit. Because CTB and LTB are generally poor immunogens and adjuvants 6, 37, 38, 39, 40 as compared with the nontoxic mutants, one might speculate that it is the interaction of the A1 subunit with some undefined cellular proteins that is the most interesting. It is known that the enzymatic activity of CT and LT is enhanced by the interaction of these proteins with intracellular ARFs, and it is conceivable that an enzymatically inactive mutant A1 subunit might structurally interact with these GTP-binding proteins 9, 21, 41 . Although this hypothesis is attractive, our results using the CTA1-DD fusion protein do not support this explanation. In fact, we failed to demonstrate adjuvant activity in three different inactive CTA1-DD mutants. A single amino acid substitution in the active cleft disrupted the enzymatic activity but did not seem to alter the conformation or structure of the A1 subunit, thus probably still allowing binding to ARFs or other molecules. Thus, although our current results do not preclude a "structural" effect of CTA1, we believe our observations point in a different direction.
We would like to hypothesize that it is the ADP-ribosyltransferase activity of the A1 subunit per se that is important for the immunomodulating effect. Our study clearly has demonstrated that the enzymatic activity of the A1 subunit constitutes a unique and separate immunomodulating ability of the bacterial enterotoxin. The strength of this immunomodulation can easily be appreciated by the fact that we achieved an adjuvanticity with the CTA1-DD fusion protein of equal magnitude to that of the intact CT. The dose required for such an effect was roughly threefold higher than that of CT 14 , supporting the idea that the holotoxins, indeed, also host additional nontoxic AB5 complex-associated adjuvant properties. By inference, although not yet demonstrated, we predict that it would be possible to replace or omit the A1 subunit from the AB5 complex and still achieve stronger adjuvanticity than that obtained with the B subunits alone. No documentation is available on the adjuvant role of the A2 subunit in the AB5 complex. Perhaps a deletion of A1 would generate a molecule that still matches the AB5 complex in adjuvant capability. Such a molecule has been found an efficient delivery system for mucosal immune responses to epitopes replacing the A1 subunit epitopes 42 .
Thus, with regard to the second immunomodulating effect of the holotoxins mediated by the AB5 complex, we firmly believe that it is separate from the enzymatic activity of the A1 subunit. The question is whether this effect is operating through a single or multiple mechanisms. If the AB5 complex is more stable in vivo, as been suggested 43 , or even if it has a broader spectrum of interactions with cell membrane or cytosolic substructures than the B subunits alone, it is probable that immunomodulation dependent on the B subunit.
Such a notion can explain why a great variability in adjuvanticity has been reported for the nontoxic mutants and the B subunits. In particular, the route of administration is critically influencing the degree of adjuvanticity. No doubt the oral route is most demanding, whereas intranasal (i.n.) immunization appears to be more permissive 6, 37 . Indeed, several investigators have reported substantial adjuvant effects by CTB or LTB alone given i.n., whereas CTB or LTB, for the most part, has been found inactive given perorally as adjuvants 35, 40, 44, 45 . Interestingly, Yamamoto et al. 3, 46 recently reported that the E112K mutant CT, which is the same substitution tested by us in the CTA1-E112K-DD fusion protein, gave enhancing effects on immune responses after peroral or s.c. administration similar to that observed with the intact CT. Currently, we have no explanation for this discrepancy, but in the present study we specifically used the i.p. route for immunization to avoid possible involvement of variability in adjuvant and Ag uptake, as would be expected with the peroral or i.n. routes. An earlier study from our laboratory also failed to show adjuvant function of LT-E112K after oral immunization, whereas de Haan et al. 1, 40 found that nasal administration of this mutant gave good adjuvant effects. Taken together, these observations indicate that the route of adjuvant administration and type of Ag used for evaluation are crucial elements to consider when assessing the immunoenhancing effects of the mutant holotoxins.
Nevertheless, in practical terms all AB5 complex-dependent systems appear to have the same limitation, namely the requirement for uptake via the ganglioside GM1 receptor. Since this receptor is expressed on most nucleated cells, these adjuvant molecules can never be selective in their action. Although Douce et al. have, using the CTK63 and LTK63 mutants, provided evidence to suggest that LT may have broader immunogenic and adjuvant effects than CT, most investigators have found that both molecules lack these abilities in the mutated non-GM1 ganglioside-binding forms 16, 17, 36 . This is despite the fact that LT, as opposed to CT, can bind several other carbohydrate ligands 47 . Thus, adjuvanticity of CT and LT appears to depend on the ganglioside GM1 receptor pathway 16, 17 . It should be mentioned, however, that at variance with these observations de Haan et al. 1 have reported a non-GM1-binding LT mutant, LT-G33D, as well as a mutant that lack both binding and ADP-ribosyltransferase activity, LT-E112K/G33D, with retained adjuvant function after i.n. administration. This latter observation is controversial, but, together with the reports of strong adjuvant effects of the B subunits given i.n., it clearly demonstrates current problems in evaluation of adjuvant function using the i.n. route of administration.
The unique strength of the CTA1-DD system is that it targets the full enzymatic activity of the CTA1 to cells that are engaged in the formation of an immune response, leaving all other cells at rest. The inherent problem with the mutant holotoxins using the ganglioside GM1 pathway, incurred by the risk of toxicity, is the required balancing of adjuvanticity against enzymatic activity. Elegant studies have demonstrated that partially active LTR72 mutant can give similar adjuvant effects to the intact holotoxin in doses 50–100-fold higher 7 . Such dose increases appeared to be safe and nontoxic in mice, but for clinical use, adjuvant active, but nontoxic, doses may be difficult to achieve. Ongoing clinical trials with some of these mutants will hopefully answer this critical question 48, 49, 50 .
What is most remarkable with the CTA1-DD adjuvant, however, is the ability to circumvent the natural ganglioside GM1 pathway for entrance of CTA1 into the cell via binding through the DD dimer. Although we have not completely defined the ligands for the DD dimer, we strongly believe that the B cell receptor is the most likely candidate 14 . Previous and ongoing studies point to the idea that B cell targeting rather than binding to dendritic cells and macrophages occurs after injection 14 . Whether this effect is responsible for the adjuvanticity or not awaits to be proved. Clearly, the fact that admixed CTA1-DD, without conjugation to the Ag, achieves strong immunoenhancement in CD4+ T cell priming and humoral immunity 14 argues in favor of an involvement in Ag presentation. We have also reported that up-regulation of the costimulatory molecule CD86 is a primary event after treatment of naive B cells with CTA1-DD 14 .
In the present study, we extend the evidence for an immunomodulating
effect of CTA-DD on binding to the B cell, by showing that B cell
proliferation in the presence of ionomycin is greatly enhanced. In this
regard, the effect of CTA1-DD mimics that of CT, whereas rCTB or the
enzymatically inactive mutant CTA1-DD failed to affect this system.
Benzamide, a known inhibitor of ADP-ribosyltransferase activity,
substantially abrogated the proliferation induced by CTA1-DD and CT,
clearly indicating that these agents use ADP-ribosyltransferase
activity for the effect 30 . Although CTA1 in the holotoxin is thought
to ADP-ribosylate the Gs protein, leading to an activation of
adenylate cyclase and subsequent increase of intracellular cAMP, we
failed to show an effect on cAMP levels. In spite of numerous
experiments using different conditions, high doses of the fusion
protein and different time points, using isolated B cells or
macrophages or two different murine B cell lines (X16, CH12LX), we were
unable to mimic the effect of CT on cAMP levels. This observation was
unexpected and highly surprising.
A speculation derived from the findings mentioned above is that CTA1 in
the form of a fusion protein uses a pathway distinct from the classical
Gs-adenylate cyclase-cAMP pathway for its adjuvant effect. In fact,
we believe our report is the first to suggest that CT exerts adjuvant
activity independently of cAMP. Even though the pathway for entrance of
CTA1 into the target cell differs between the fusion protein and the
holotoxin, the present study indicates that a substrate (or
substrates), which is ADP-ribosylated, in both cases is targeted by
CTA1. The nature of this substrate may, thus, not be Gs but one or
several other G-proteins, or alternatively, it may be that the Gs,
in a different subcellular location, is not acting on adenylate
cyclase. Future studies in our laboratory will address these important
and challenging questions.
|
Acknowledgments |
|---|
. |
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Nils Lycke, Department of Medical Microbiology and Immunology, University of Göteborg, S-413 46 Göteborg, Sweden. E-mail address:
3 Abbreviations used in this paper: CT, cholera toxin, LT, Escherichia coli heat-labile toxin; ARFs, ADP-ribosylation factors; KLH, keyhole limpet hemocyanin; cAMP, cyclic adenosine 3':5'-monophosphate; i.n., intranasal.
Received for publication September 8, 1998. Accepted for publication November 10, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsRESULTSDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. R. M. Negri, D. Pinto, S. Vendetti, M. Patrizio, M. Sanchez, A. Riccomi, P. Ruggiero, G. Del Giudice, and M. T. De Magistris Cholera Toxin and Escherichia coli Heat-Labile Enterotoxin, but Not Their Nontoxic Counterparts, Improve the Antigen-Presenting Cell Function of Human B Lymphocytes Infect. Immun., May 1, 2009; 77(5): 1924 - 1935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Andersen, J. Dietrich, E. M. Agger, N. Y. Lycke, K. Lovgren, and P. Andersen The Combined CTA1-DD/ISCOMs Vector Is an Effective Intranasal Adjuvant for Boosting Prior Mycobacterium bovis BCG Immunity to Mycobacterium tuberculosis Infect. Immun., January 1, 2007; 75(1): 408 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Helgeby, N. C. Robson, A. M. Donachie, H. Beackock-Sharp, K. Lovgren, K. Schon, A. Mowat, and N. Y. Lycke The Combined CTA1-DD/ISCOM Adjuvant Vector Promotes Priming of Mucosal and Systemic Immunity to Incorporated Antigens by Specific Targeting of B Cells J. Immunol., March 15, 2006; 176(6): 3697 - 3706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Duverger, R. J. Jackson, F. W. van Ginkel, R. Fischer, A. Tafaro, S. H. Leppla, K. Fujihashi, H. Kiyono, J. R. McGhee, and P. N. Boyaka Bacillus anthracis Edema Toxin Acts as an Adjuvant for Mucosal Immune Responses to Nasally Administered Vaccine Antigens J. Immunol., February 1, 2006; 176(3): 1776 - 1783. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Hajishengallis, S. Arce, C.M. Gockel, T.D. Connell, and M.W. Russell Immunomodulation with Enterotoxins for the Generation of Secretory Immunity or Tolerance: Applications for Oral Infections Journal of Dental Research, December 1, 2005; 84(12): 1104 - 1116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Eriksson, K. M. Schon, and N. Y. Lycke The Cholera Toxin-Derived CTA1-DD Vaccine Adjuvant Administered Intranasally Does Not Cause Inflammation or Accumulate in the Nervous Tissues J. Immunol., September 1, 2004; 173(5): 3310 - 3319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. I. Mowat, A. M. Donachie, S. Jagewall, K. Schon, B. Lowenadler, K. Dalsgaard, P. Kaastrup, and N. Lycke CTA1-DD-Immune Stimulating Complexes: a Novel, Rationally Designed Combined Mucosal Vaccine Adjuvant Effective with Nanogram Doses of Antigen J. Immunol., September 15, 2001; 167(6): 3398 - 3405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Boirivant, I. J. Fuss, L. Ferroni, M. De Pascale, and W. Strober Oral Administration of Recombinant Cholera Toxin Subunit B Inhibits IL-12-Mediated Murine Experimental (Trinitrobenzene Sulfonic Acid) Colitis J. Immunol., March 1, 2001; 166(5): 3522 - 3532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Agren, E. Sverremark, L. Ekman, K. Schon, B. Lowenadler, C. Fernandez, and N. Lycke The ADP-Ribosylating CTA1-DD Adjuvant Enhances T Cell-Dependent and Independent Responses by Direct Action on B Cells Involving Anti-Apoptotic Bcl-2- and Germinal Center-Promoting Effects J. Immunol., June 15, 2000; 164(12): 6276 - 6286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Weltzin, B. Guy, W. D. Thomas Jr., P. J. Giannasca, and T. P. Monath Parenteral Adjuvant Activities of Escherichia coli Heat-Labile Toxin and Its B Subunit for Immunization of Mice against Gastric Helicobacter pylori Infection Infect. Immun., May 1, 2000; 68(5): 2775 - 2782. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), CTA1-DD
(
), CTA1-R7K-DD, CTA1-D109A-DD or CTA1-E112K-DD (
) were assayed
for ADP-ribosylagmatine formation through incorporation of
[U-14C]adenine. The values represent mean counts per
minute (cpm) of three experiments with SD <5%. The mean background
activity was 1987 cpm.
