|
|
||||||||
Receptor Essential for Interaction with IgA1
Helen M. Schutt Laboratory for Immunology, The Austin Research Institute, Austin Repatriation Medical Centre, Heidelberg, Victoria, Australia
| Abstract |
|---|
|
|
|---|
20%) is the IgA receptor (human Fc
R),
being more homologous (
35%) to another family of killer-inhibitory
receptor-related immunoreceptors with a 19q13.4 chromosomal location in
humans. This study of the Fc
R demonstrated that, like several IgG
receptors, Fc
R is a low affinity receptor for Ab
(Ka
106 M-1).
Rapid dissociation of the rsFc
R:IgA complex
(t1/2
25 s) suggests that monomer
IgA would bind transiently to cellular Fc
Rs, while IgA immune
complexes could bind avidly. Mutagenesis of histidyl 85 and arginyl 82,
in the FG loop of domain 1, demonstrated that these residues were
essential for the IgA-binding activity of Fc
R, while arginyl 87
makes a minor contribution to the binding activity of the receptor.
This site is unusual among the Fc receptors (Fc
RII, Fc
RIII, and
Fc
RI), in which the ligand binding site is in domain 2 rather than
domain 1, but like Fc
R, the FG loop comprises part of the ligand
binding site. The putative F and G strands flanking the Fc
R ligand
binding site are highly homologous in the other killer-inhibitory
receptor-related immunoreceptors, suggesting they comprise a conserved
structural element on which divergent FG loops are presented and
participate in the specific ligand interactions of each of these
receptors. | Introduction |
|---|
|
|
|---|
R 1 is encoded by a gene of five exons 2 located on
chromosome 19q13.4 3 , as are the leukocyte-inhibitory receptors
(LIR)4, 4, 5 and the
killer-inhibitory receptors (KIR), together sharing 3540% homology
within a recently described family of receptors expressed on
hemopoietic cells 6 . This family also includes p91 7 paired
Ig-like receptors 8 and gp49 9 encoded on the syntenic region of
mouse chromosome 7. The other FcRs are located on chromosome one and
share lesser (
20%) homology to Fc
R. While the KIRs (and some
LIRs) and Fc
R bind MHC and IgA, respectively, and some
ligand-binding regions of KIR have been defined 10, 11 , the
structural basis of Fc
R-binding IgA is unknown.
IgA is a major serum Ab and the predominate Ab at mucosal sites. IgA
binding to Fc
R triggers the cellular aspects of IgA-mediated
immunity against pathogens, both in the circulation and at the mucosal
interface. Ligand binding initiates signaling through the Fc
RI
subunit associated with the receptor 12, 13 , and the tyrosine kinases
Syk and Btk 14 . This cascade activates the cell for respiratory
burst, phagocytosis, and cytokine secretion 15, 16, 17 . Fc
R is
expressed on macrophages/monocytes, eosinophils, and granulocytes; and
analysis of mRNA splice variants has shown the receptor is expressed in
several forms with potentially different functions 18, 19, 20, 21 .
Fc
R does not discriminate between IgA1 and IgA2 subtypes, serum and
secreted forms, or monomeric and polymeric forms of IgA 22, 23, 24, 25 . This
study determined the IgA binding site of Fc
R using a soluble form of
Fc
R. The interaction of rsFc
R with IgA was evaluated using a
biosensor, and the Ka was estimated to be
106 M-1. A strategy combining the chemical
modification and site-directed mutagenesis identified R82 and H85, in
the FG loop of domain 1, as essential for the binding activity of
Fc
R.
| Materials and Methods |
|---|
|
|
|---|
R
PCR of the pHuIgAR 1 , with the polymerase Pwo (Boehringer
Mannheim, Castle Hill, Australia), was used to build a construct for
the expression of the two EC domains and the EC membrane-proximal
region of human Fc
RI in Pichia pastoris (SMD1168). PCR
used the primers oBW21, CCCGGGGAATTCCAGGAAGGGGACTTTCCC; and
oBW32,
GGCCTAGGCCCATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCTGCCCCGGGCCCGATCAAGTTCTGCGTCGTG
(which encodes a c-myc tag for the Fc
R C terminus). The
PCR product was cloned into the EcoRI and AvrII
(New England Biolabs, Beverly, MA) sites of pPIC-9 (Invitrogen, San
Diego, CA), which was then digested with SnaBI and
AvrII. The released fragment was subcloned into the
SmaI and AvrII sites of pBAR34, a pPIC-9
derivative with the polylinker sequence:
TACGTATCCCATCATCACCATCATCACAGCTCAGGTCTTGTGCCTAGAGGTTCCGGGCCCGGGTAGAATTCCCTAGGGCGGCCGCG,
which translates as
Tyr-Val-Ser-His-His-His-His-His-His-Ser-Ser-Gly-Leu-Val-Pro-Arg-Gly-Ser-Gly-Pro-Gly-*.
RsFc
R was thus expressed with hexahistidyl and c-myc tags
at the N and C termini, respectively. This wild-type rsFc
R construct
(pBAR 81) and mutant rsFc
R constructs were transfected by
electroporation into P. pastoris, according to the
manufacturers protocols (Invitrogen). MutS phenotype colonies
expressing the recombinant receptors were selected and grown to maximum
cell density in 2 L of MGY (Invitrogen) glycerol-containing medium.
Cells were harvested by centrifugation and resuspended in one-fifth
volume of BMMY (Invitrogen) containing 1 mM phosphate and 1%
methanol. Methanol was replenished twice daily, and at the end of day
3, ZnCl2 was added to final concentration of 10 mM. The
cells and precipitated proteins were removed by centrifugation at
8000 x g for 20 min. The rsFc
R, and other proteins
in the supernatant, were precipitated and collected by the further
addition of ZnCl2 to 5 mM and PEG 8000 (Sigma, St. Louis,
MO) to 15% (w/v), followed by centrifugation (8000 x
g, 20 min). This PEG cut fraction was dialyzed extensively
against 50 mM phosphate, 300 mM NaCl (pH 8.5), and loaded onto an
equilibrated nitrilotriacetic acid (NTA)-agarose column (Qiagen,
Chatsworth, CA). RsFc
R eluted at low stringency in 50 mM phosphate,
300 mM NaCl (pH 6), and to remove the N terminus hexahistidine tag, was
incubated with 2% w/w bovine thrombin (4 h, 25°C) in 50 mM Tris, 150
mM NaCl, 1 mM DTT, and 2.5 mM CaCl2 (pH 8). Thrombin was
inactivated by 0.2 mM PMSF, and the rsFc
R preparation was finally
passaged again on the NTA-agarose to remove nickel-binding impurities.
The receptor was quantified using E280nm0.1% = 1.2,
and yields of recombinant receptor were approximately 20 µg/L of
culture. SDS-PAGE analysis and silver stain showed a doublet at
40
kDa predominated with some other impurities present (data not shown).
A baculovirus expression construct was made by BglII
digestion of pHuIgAR, releasing the Fc
R cDNA, and this was subcloned
into the BamHI site of pFastBac1 (Life Technologies,
Gaithersburg, MD) to make pBAR 141. A construct encoding a rsFc
R
with a c-myc tag at the C terminus was made by removing the
PvuII/NotI fragment from pBAR 141 and replacing
it with the PvuII/NotI fragment from pBAR81. The
manufacturers instructions were followed to produce recombinant virus
and supernatant containing rsFc
R. Unpurified supernatants were used
in gel shift and biosensor assays and contained up to 10 µg/ml
Fc
R.
Biosensor assay of rsFc
R binding to immobilized IgA
Serum IgA (Calbiochem-Novabiochem, Alexandria, Australia) was
coupled to a BIAcore CM5 carboxyldextran biosensor chip (Pharmacia,
Uppsala, Sweden) using the established carbodiimide-mediated amine
reaction protocol. IgA (50 µg/ml) was concentrated on the chip
surface in 10 mM acetate (pH 5), and for the kinetic analysis,
typically 1000 RU (for example, in Fig. 2
A, 1350 U) was
coupled to the chip. Control channels consisted of a chemically coupled
blank channel and a channel of
1000 RU of coupled rabbit IgG.
Binding sensograms were obtained by subtraction of the sensogram of a
IgG-coupled channel from the sensogram for the IgA-coupled channel. The
sensograms obtained from the IgG-coupled channel were essentially
identical with the chemically coupled blank channel and represented
bulk refractive index effects of the samples with no evidence for
Fc
R binding to IgG. Human IgG (Sandoglobulin, Novartis
Pharmaceuticals, East Hanover, NJ) was also used as a control Ig
to test Fc
R-binding specificity. Kinetic analyses used 50-µl
aliquots of rsFc
R at concentrations of 0.22 µM injected at 10
µl/min in 10 mM HEPES, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 (pH
7.4). Data collected for each experiment were analyzed in one fit using
the simultaneous fitting program Clamp 26 , yielding on and off rates
and saturated binding levels. Equilibrium-binding analysis was
performed by plotting the plateau RU value for each sensogram and
fitting the data to a single binding site model.
|
Samples of recombinant myc-tagged rsFc
R (10 µl
of Pichia or 1/10 diluted baculovirus supernatant) and IgA
at 200 µg/ml were electrophoresed on native 12.5% (or 8%)
polyacrylamide gels, according to established procedures 27 , at 150 V
for 3 h. The proteins were Western transferred to polyvinylidene
difluoride (PVDF) membranes by semidry blotting and immunodetection
performed using the anti-c-myc mAb 9E10. The 9E10
ascites was diluted 1/2000 in PBS containing 5% skim milk powder and
incubated with the blot for 2 h at 25°C, followed by incubation
with 1/1000 dilution of horseradish peroxidase-conjugated
anti-mouse IgG and ECL reagents (Amersham, Buckinghamshire, U.K.).
Chemical modification rsFc
R
Protein modification with diethylpyrocarbonate (DEPC) was as described by Easterbrook-Smith 28 . Following reaction with 0.020.2 mM DEPC (Sigma) in 0.8x PBS (pH 7.4) for 20 min, further protein modification was stopped by the addition of imidazole to a final concentration of 20 mM. Arginyl modification with p-hydroxyphenylglyoxal (Pierce, Rockford, IL) was as described by Wines and Easterbrook-Smith 29 .
Mutagenesis of rsFc
R cDNA
Each histidine residue in the extracellular region of rsFc
R
was altered to a glutamyl or alanyl using a QuickChange mutagenesis kit
(Stratagene, La Jolla, CA) with degenerate oligonucleotides containing
a GCG or GAG codon targeted to the histidyl codon. The sense
oligonucleotides of the mutagenic oligonucleotide pairs were as
follows: H(68)A/E, CTGAGTTCGTCATTGACG(C/A)GATGGACGCAACCAAG; H(85)A/E,
GCCAATATAGGATAGGGG(C/A)GTACAGATTCCGGTACAG; H(129)A/E,
CACGTGCAGCTCAGCAG(C/A)GATCCCATTTGATAGATTTTC; H(148)A/E,
GAACTTTCTCTGCCACAGG(C/A)GCAAAGTGGGGAACACCCG; H(153)A/E,
CAGCACCAAAGTGGGGAAG(C/A)GCCGGCCAACTTCTCTTTGG; H(199)A/E,
GTGGTCACAGACTCCATCG(C/A)GCAAGATTACACGACGCAG.
Likewise, the arginine residues 82, 87, and 89 were targeted for mutagenesis using the following oligonucleotide and its reverse complement: RRR(82,87,89)K/G/E/R, K/G/E/R, Q/G/E/R, CGCTATCAGTGCCAATAT(A/G)(G/A)GATAGGGCACTAC(A/G)(G/A)ATTC(C/G)(G/A)GTACAGTGACACCCTG.
Mutant constructs were confirmed using a thermosequenase dye terminator cycle sequencing kit (Amersham) and an ABI Prism 377 DNA sequencer (Applied Biosystems, Foster City, CA).
| Results |
|---|
|
|
|---|
R. The interaction of these with IgA was analyzed using
biosensor and gel shift assays.
Specificity of the rsFc
R:IgA interaction
The IgA:rsFc
R interaction was measured using a biosensor chip
coupled with serum IgA, to which rsFc
R (
0.2 µM, 40 µl) was
applied (10 µl/min) and approximately 400 RU of receptor binding to
the surface was observed. The specificity of this binding was confirmed
by the prior incubation of the rsFc
R with serum IgG (0.5 µM)
without effect on the binding of rsFc
R to the IgA channel. In
contrast, incubation with 0.5 µM IgA reduced this binding by
50%
to 200 RU (Fig. 1
). The saturable
rsFc
R binding to the IgA gave typical ratios of
0.7, and this
indicated the immobilized IgA was highly active in receptor binding and
suitable for analysis of the binding kinetics. That is, the coupling of
IgA through lysyl amine groups to the biosensor surface did not appear
to compromise its Fc
R-binding activity.
|
R:IgA interaction
The kinetics of the rsFc
R:IgA interaction was determined using
a chip with 1350 RU of coupled serum IgA and injection of rsFc
R at
various concentrations in the range 0.22.2 µM. The sensograms were
fitted simultaneously to a single binding site using the Clamp program
(Fig. 2
A) 26 . This kinetic
analysis yielded rapid on and off rates and an affinity of 0.96 x
106 M-1 (Kd = 1 µM;
Table I
). Equilibrium analysis of the
same data (Fig. 2
B) gave an estimate of the affinity of the
interaction of 1 x 106 M-1, which agreed
with the data analysis given by the Clamp program. That this analysis
was not affected by the coupling of the IgA to the chip was evident
from the following experiment. In this second type of assay, the Ab
9E10 was immobilized on the chip and used to capture rsFc
R.
Different concentrations of serum IgA were applied, and the affinity
obtained for the IgA:Fc
R interaction (Ka
0.8 x 106 M-1) agreed with the previous
analyses.
|
R histidine
residues
The rsFc
R:IgA interaction was affected by pH when measured at
pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, and 9. Optimal interaction was
observed at pH 7.5, with a rapid loss of activity at more acid pH (Fig. 3
A). The imidazole side chains
of histidine residues typically have pKa values near 7, so the
pH-binding profile is consistent with a histidine residue participating
in the Fc
R:IgA interaction.
|
R was chemically modified with the histidyl-selective reagent
DEPC, and the effect on IgA binding was monitored. Treatment of
rsFc
R with DEPC (0.020.2 mM) resulted in a dose-dependent loss of
approximately 60% of the receptor-binding activity (Fig. 3
R and the partial loss of binding activity with
the modification of reactive histidyls.
Confirmation of histidyl involvement in IgA binding and the
identification of these were made by site-directed mutagenesis
performed separately on each of the histidine residues in the soluble
Fc
R. The DEPC adduct to a histidyl side chain greatly changes the
properties of the residue, and so, in the first instance, mutagenesis
to glutamyls was chosen, as this substitution also greatly changes the
chemistry of the targeted histidyl. Histidyls (H68, H85, H129, H148,
H153, H199) were individually changed to a glutamic acid residue, and
the mutant proteins were expressed in P. pastoris and
analyzed for IgA binding by a native gel bandshift assay (Fig. 4
A). In the band shift assay,
the wild-type rsFc
R, when incubated with IgA, was found to migrate
more slowly as a higher m.w. rsFc
R:IgA complex (Fig. 4
A,
lane 2) than as the free receptor (Fig. 4
A,
lane 1). The mutant receptors H68E, H129E, H148E, H153E, and
H199E also shifted to a high m.w. in the presence of IgA, in a manner
identical to the wild-type receptor. In contrast, the migration of the
H85E mutant protein did not alter in the presence of IgA; i.e., no
IgA-binding activity was detected (Fig. 4
A, lane
6). Thus, the use of two distinct approaches, chemical
modification and mutagenesis, clearly defines Fc
R histidyl
involvement in IgA binding. The mutagenesis approach identified H85 as
participating in the IgA binding site and probably excluding the other
histidyl-containing regions.
|
R mutants
affected the IgA-binding activity of the receptor was tested by
mutating the six histidyls to alanyls, and the mutant rsFc
R proteins
tested in the IgA gel shift assay. All of the rsFc
R mutants bound
IgA in a manner indistinguishable from the wild type, with the
exception of the H85 mutant (Fig. 4
Chemical modification and mutagenesis of rsFc
R arginine residues
Inspection of the sequence of Fc
R revealed multiple arginyls
(R82, R87, and R89) flanking H85. A separate series of experiments
addressed the role of arginine residues in IgA binding by chemical
modification of the receptor with the arginyl-selective reagent
p-hydroxyphenylglyoxal at the concentrations 0, 1, 2, and 4
mM. The activity of the modified protein in IgA binding was measured by
biosensor assay, and a dose-dependent loss of activity was observed,
with the 4 mM phenylglyoxal-treated protein having
10% of the
binding activity of the unmodified receptor (Fig. 5
A). These data suggest the
involvement of Fc
R arginine residues in IgA binding. Mutagenesis of
the arginyls flanking H85 was performed to confirm this and to identify
which arginine residues contribute to IgA binding. A single pair of
degenerate oligonucleotides was used to target R82, R87, and R89 in the
one mutagenesis reaction, and several constructs were sequenced to
select appropriate mutants. Those chosen were R82K,R87,R89Q (KRQ);
R82K,R87K,R89E (KKE); R82G,R87,R89 (GRR); R82,R87G, R89G (RGG); and
R82,R87G,R89 (RGR), and these mutant cDNAs and the normal cDNA
(R82,R87,R89) were expressed using baculovirus. IgA binding by the
proteins was measured using the native gel bandshift assay (Fig. 5
B). The wild-type receptor (R82,R87,R89; RRR, lane
1) migrated more slowly as a complex when incubated with IgA
(lane 2), while the migration of the R82K,R87,R89Q
double mutant receptor (KRQ, lane 3) did not alter in the
presence of IgA (lane 4). This indicates some
combination of residues 82 and 89 contributes to IgA binding. The
single mutant receptor R82G,R87,R89 (GRR, lane 5) also
showed no IgA-binding activity (lane 6), indicating
R82 is essential for IgA binding. The mutant receptor R82,R87G,R89 (RGR
lane 10) and the double mutant R82,R87G,R89G (RGG,
lane 8) showed wild-type IgA-binding activity in being
shifted to migrating as a high m.w. species in the presence of IgA.
Thus, from this assay, neither R87 or R89 appears to contribute to IgA
binding, while R82 is essential for binding activity.
|
R. The binding to IgA of the supernatant
containing normal rsFc
R gave a maximum response of
110 RU, while
no measurable binding was found with the R82G,R87,R89 (GRR) mutant
receptor (Fig. 6
R (Fig. 5
Rs was necessary. High apparent
affinities are normally achieved by low affinity cell surface
receptors, such as Fc
R, through multivalent interactions with
aggregated ligands. This effect was mimicked by reacting both normal
and mutant rsFc
R in the baculovirus supernatants with the mAb 9E10
(10 µg/ml), which binds to the c-myc tag on the protein C
terminus, to produce receptor dimers. The binding of these receptor
dimers to immobilized IgA was measured, and the apparent affinity was
clearly increased compared with that of receptor in the untreated
baculovirus supernatant (Fig. 6
R
dimers from the IgA layer was extended to
10 min (Fig. 6
20-fold increase over that of the
normal monomer receptor (Fig. 6
50% that of the
normal receptor (
200 RU versus
425 RU). Most interestingly, in
this sensitive IgA-binding assay, the mutant receptors with R82K
substitutions (R82K,R87,R89Q (KRQ) and R82K,R87K, R89E (KKE)) showed
some activity, although less than 10% that of the normal rsFc
R.
Thus, it would appear the maintenance of a positive charge in
substituting a lysine for the critical R82 is compatible with the
retention of some IgA-binding activity, while substitution for a
glycine completely inactivates the binding site. That lysine
nonetheless rather poorly substitutes for arginine 82 indicates that
something more than merely a positive charge is required at this
position for optimal IgA binding.
|
| Discussion |
|---|
|
|
|---|
R is an interesting member of the Ig superfamily, as it may
be classified either by function as a FcR, or by homology and gene
location, as one of the 19q13.4 family of human immunoreceptors. These
include the MHC-binding inhibitory receptors, the KIRs and some LIRs,
as well as other related mouse immunoreceptors, paired Ig-like
receptors/p91 and gp49. This study characterized the Fc
R:IgA
interaction, as it provides an opportunity for insight into a FcR:Ig
interaction specifically and that of the 19q13.4-related
immunoreceptors generally.
RsFc
R, consisting of the two EC domains and the membrane-proximal
region, was expressed in P. pastoris, and the binding to
immobilized serum IgA was assayed using a biosensor. The assay
specifically measured IgA-binding activity, since incubation of
rsFc
R with IgA in solution, but not IgG, inhibited the rsFc
R
interaction with the immobilized IgA layer. Analysis of the biosensor
assay data revealed the rsFc
R interaction to have a low affinity
constant (Ka = 1 x 106
M-1; Kd = 1 µM) and rapid on and
off rates (k1 = 26,800
M-1s-1 and k-1 =
0.028 s-1; Table I
). A second form of biosensor assay
involved immobilizing the anti-tag mAb 9E10 to the chip, tethering
the tagged rsFc
R, and then measuring the binding of IgA at various
concentrations (data not shown). Equilibrium-binding analysis of this
data yielded a Ka
0.8 x
106 M-1; Kd
1.2
µM, which agreed with the first analysis and discounted potential
artifacts arising from the protein immobilization. Subsequent analysis
of the baculovirus-produced receptor has shown a
Ka of
2 x 106
M-1, with a small component of higher affinity binding,
the significance of which has not been established (data not shown).
Previously, the affinity of Fc
R has been measured indirectly, by the
inhibition of binding activity on addition of soluble IgA. In a study
using IgA to inhibit the binding of IgA-coated erythrocytes to
monocytes, micromolar IgA concentrations gave 50% inhibition of
rosette formation (IC50
0.1 mg/ml,
0.6 µM) 22 .
Another inhibition study used affinity-purified receptor from
surface-iodinated neutrophils to bind IgA Sepharose. Again, inhibition
of binding by free IgA yielded an IC50
0.5 µM, which
corresponds to a Ka
2 x
106 M-1 30 . Both of these studies are in
agreement with the values obtained in this report
(Kd = 0.51 µM; Ka =
12 x 106 M-1). Biosensor analysis
revealed rapid kinetics for the interaction, with the dissociation rate
constant being such that the Fc
R:IgA-bound state had a
t1/2
25 s. The rapid dissociation of bound
monomer IgA from Fc
R implies that, for example, blood myeloid cell
Fc
Rs would rapidly be exchanging bound surface IgA for other IgA
molecules from the circulation. Since the serum concentration of IgA
(
422 µM) exceeds the Kd for the
Fc
R:IgA interaction, most of the receptors on a blood myeloid cell
would be occupied with IgA. However, the transient nature of the
interaction with monomer allows cell surface Fc
Rs to continuously
sample IgA in the vicinity and, through the avidity of the
interactions, to sense the aggregation state of the IgA. Only when an
immune complex containing IgA was encountered would binding be other
than transient. The data presented in this work indicate Fc
R is a
low affinity Fc receptor, more akin to Fc
RII/III than to the high
affinity receptors Fc
RI and Fc
RI 31 . On the cell surface,
Fc
R would therefore be expected to more efficiently bind immune
complexes containing IgA or polymeric IgA, as suggested by Maliszewski
et al. 32 . This avidity effect is well illustrated by the increase in
apparent affinity of Fc
R dimers, formed by reaction of the
myc-tagged rsFc
R with the anti-myc mAb,
such that the t1/2 for the bound receptor dimer
increased 20-fold over that of the monomer receptor (Fig. 6
B).
Since the specificity of the rFc
R for IgA had been validated, and
the affinity of the interaction measured, the location and nature of
the IgA binding site were investigated. The pH dependence of receptor
binding to IgA appeared to reflect the titration of a histidyl. This
was a useful indication of a histidine residue at the binding site
since no modification or mutagenesis of the protein was involved.
Similar pH dependence in the binding of C1q 28, 29 and FcRn 33 to
IgG reflects the direct participation of histidyls in these binding
reactions. Furthermore, chemical modification of rsFc
R with DEPC
suggested a role for histidyls in the binding reaction. Water-soluble
chemical modification reagents are more likely to target
surface-exposed residues than buried ones, surface exposure being an
expected feature for a binding site residue. Each of the six histidyls
in rsFc
R (two in EC1 and four in EC2) was separately mutated to a
glutamyl, making a large change in the properties of the histidine
residue, as does the DEPC modification. Substitutions to alanyls were
also made, and in both instances, only the mutation of one histidine,
H85, resulted in loss of IgA-binding activity. The loss of IgA binding
for the H85E mutant protein was absolute, and for the H85A receptor
loss of activity was substantial, but not complete, having at least
fourfold less binding activity than that of the normal protein.
Clearly, the location of H85 in the sequence of Fc
R is an important
marker of the IgA binding site. Although single amino acid changes are
generally well tolerated in the overall structure of a protein 34 ,
there is always the possibility of structural disruption of the
protein. In making mutations to both a charged (glutamyl) and uncharged
(alanyl) side chain, we attempted to match some of the different
properties of the substituted histidyl and so, by one or the other
mutation, to minimize disruption of the protein structure.
In addition to the results showing loss of binding after mutation of
H85, the lack of effect on IgA binding by mutation of the other five
histidine residues to either glutamic or alanine residues is
informative in that these sites apparently do not form part of the IgA
binding site. Indeed, it is of interest that four of these histidyls
are located in EC2. In the other FcRs, it is this second domain, and
not the first domain, that contains the binding site for IgG or IgE
35 . In fact, H131 of Fc
RII, a residue involved in IgG binding, in
a sequence alignment of Fc
R corresponds with H148 of Fc
R, the
mutation of which has no effect on IgA binding. Clearly, Fc
R and the
other two EC domain FcRs (Fc
RII, Fc
RII, and Fc
RI) have very
different topologies of ligand binding.
A distinctive feature of the region of Fc
R near H85 is the three
arginine residues R82, R87, and R89. The modification of the protein
with the arginyl-selective reagent phenylglyoxal affected IgA binding,
providing evidence of a role for arginine residues in IgA binding.
Residues R82, R87, and R89 were altered by mutagenesis, and the
IgA-binding activities of the mutant proteins were assessed by gel
shift and biosensor assay. R82 was found to be essential for IgA
binding, while R87 makes a minor contribution to binding since R87G
mutant protein had
60% of normal IgA-binding activity and R89 is
not required, as the R87G, R89G double mutant receptor demonstrated no
additional loss of IgA-binding activity. Thus, residues 8285, RIGH,
comprise an essential element of the IgA binding site of Fc
R.
Residues 82 and H85 are shown in space-filling representation on a
ribbon diagram (Fig. 7
A) of
the solved KIR structure 36 , which was used as a pertinent model for
Fc
R on the basis of its homology with the KIRs. The IgA binding site
can be seen to be a positively charged loop lying out on the apical tip
of EC1. The potential for artifact in this mutagenesis study is
diminished by the location of the binding site to a loop. Generally,
loops of Ig superfamily proteins can be quite variable without causing
alteration to the overall protein fold, so mutation in loops, such as
in this study, is likely to be compatible with the native protein
structure. It might be argued that the mutations affecting binding have
altered the local structure of the loop itself, rather than removing
actual essential binding contacts. Important to such an argument is the
mutation of R89, close to the other residues 82, 85, and 87, which has
no effect on binding. So, either residues 82, 85, and 87 provide
binding interactions with IgA or they are so close to binding residues
that they are, in either case, defining markers of the IgA binding
site.
|
R is distant from the prototypical FcR
ligand binding site, which lies in EC2 at the interface with EC1. This
KIR structure was also used to assign strands in the Fc
R sequence
(Fig. 7
R. Recent work has implied
that the IgA binding site is located in the first domain, as a variant
receptor lacking EC2 still binds secretory IgA 18 . This unique
arrangement of a FcR ligand binding site mirrors a further unusual
feature of the Fc
R:IgA interaction, that is, Fc
R binds to the
C
2C
3 interface of IgA and is unaffected by substitution of the
hinge 37 , whereas the binding sites of the other FcRs include the
lower hinge region of the Ab 35 . The hinge region of IgA, unlike
other Abs, is a substrate for pathogen proteases 38 , and in response
to this selective pressure, both the Fc
R and IgA proteins may have
co-evolved to use unique sites for binding. The C
2C
3 interface of
the Fc region of IgA includes some acidic residues (E262, D263, and
E269) that may be close to residues L266 and L465, which, by
mutagenesis analysis, bind the receptor 37 . Some of these negatively
charged IgA Fc residues may then comprise part of the binding site for
Fc
R, and could be involved in charge matching with cationic residues
in the sequence RIGHYR in the FG loop of Fc
R.
It is notable that, although the topology of ligand binding by Fc
R
is very different from the other FcRs, there are some striking
similarities in the composition of these ligand binding sites. First,
although different domains are used, the other FcRs and Fc
R all
utilize a FG loop in ligand binding. Second, features of the Ig-binding
FG loops are common between Fc
R and the Fc
Rs (Fig. 7
C). For example, the IgA-binding sequence RIGH in Fc
R is
paralleled in Fc
RII (FG loop of domain 2) by the sequence NIGY, and
mutagenesis of residues I155, G156, or Y157 decreases IgG binding 35 .
So, although they are distantly related, similar ligand-binding
function may require the conservation of some elements of the
ligand-binding loop.
Fc
R shares 3040% homology with the KIRs, LIRs, and related
immunoreceptors, and is significantly less homologous (
22%) with
the other Ig-binding receptors, such as Fc
RII and Fc
RIII (Fig. 7
B). Within the 19q13.4 family and related immunoreceptors,
there is very high homology within the putative F, and more especially,
the G strands (Fig. 7
C). In contrast, the sequence of the
loop between these strands is more diverse. Such an arrangement would
occur if the conserved strand sequences provided a part of the general
fold of the domain, on which different ligand-binding loops could be
displayed. In support of this notion, Fc
R and the Fc
Rs, which are
the most distantly related in this grouping of receptors, all use this
loop in binding ligand. This is also likely to be the case with
immunoreceptors more closely related to Fc
R than the FcRs. The FG
loop is then predicted to be a hot spot for receptor:ligand
interactions in this family of immunoreceptors. In this respect, it is
notable that H85 is common to the Fc
R and the KIR FG loops. H85 is
located near the N terminus of the protein, where, in the KIR, a
zinc-binding motif has been identified that contributes to the
Zn-dependent inhibition of killing of targets bearing HLA-C 11, 39 .
H85 in the KIR may contribute to this Zn coordination site.
The unique nature of Fc
R, both in terms of the mode of ligand
interaction and its homology to the KIR-related immunoreceptors,
provides fresh insight into both of these immune receptors and the
other FcRs. First, Fc
R is a low affinity IgA-immune complex
receptor. Second, the unusual topology of both receptor and IgA binding
sites may reflect pathogen-derived evolutionary pressure on the IgA
hinge. Third, the domain 1 FG loop of Fc
R contains the essential
sequence element RIGH required for IgA binding. Finally, since Fc
R
and the other FcRs use a FG loop in ligand binding, by interpolation
the other KIR-related immunoreceptors are also likely to use this
region in ligand interaction.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Division of Immunology and Cell Biology, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia. ![]()
3 Address correspondence and reprint requests to Dr. P. M. Hogarth, Helen M. Schutt, Laboratory for Immunology, The Austin Research Institute, Kronheimer Building, Austin Repatriation Medical Centre, Studley Road, Heidelberg, Victoria 3084, Australia. E-mail address: ![]()
4 Abbreviations used in this paper: LIR, leukocyte-inhibitory receptor; DEPC, diethylpyrocarbonate; EC, extracellular; KIR, killer-inhibitory receptor; rsFcR, recombinant soluble Fc receptor; RU, resonance units. ![]()
Received for publication August 7, 1998. Accepted for publication November 5, 1998.
| References |
|---|
|
|
|---|
R, with Fc
RI
subunits in U937 cells: aggregation induces the tyrosine phosphorylation of
2. J. Immunol. 153:3228.[Abstract]
chain: molecular basis for CD89/FcR
chain association. J. Biol. Chem. 270:29781.
or phorbol ester stimulation. J. Leukocyte Biol. 63:636.[Abstract]
R but not Fc
RIII trigger a respiratory burst in neutrophils although both trigger an increase in intracellular calcium levels and degranulation. Biochem. J. 306:519.
R. Crit. Rev. Immunol. 16:423.[Medline]
receptor (CD89) isoforms generated by alternative splicing that are differentially expressed between blood monocytes and alveolar macrophages. J. Immunol. 156:4442.[Abstract]
Rb, a novel Fc
receptor (CD89) isoform expressed in eosinophils and neutrophils. Blood 88:4229.
receptor in humans. J. Exp. Med. 171:597.
R determined by measurement of chemoluminescence induced by serum or secretory IgA1 or IgA2. Immunology 71:328.[Medline]
R at physiological concentrations and is endocytosed but cross-linking is necessary to elicit a respiratory burst. J. Leukocyte Biol. 56:481.[Abstract]
2 and C
3 in human IgA1. J. Exp. Med. 183:1579.This article has been cited by other articles:
![]() |
K. Qian, F. Xie, A. W. Gibson, J. C. Edberg, R. P. Kimberly, and J. Wu Functional expression of IgA receptor Fc{alpha}RI on human platelets J. Leukoc. Biol., December 1, 2008; 84(6): 1492 - 1500. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Abi-Rached, K. Dorighi, P. J. Norman, M. Yawata, and P. Parham Episodes of Natural Selection Shaped the Interactions of IgA-Fc with Fc{alpha}RI and Bacterial Decoy Proteins J. Immunol., June 15, 2007; 178(12): 7943 - 7954. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, C. Ji, F. Xie, C. D. Langefeld, K. Qian, A. W. Gibson, J. C. Edberg, and R. P. Kimberly Fc{alpha}RI (CD89) Alleles Determine the Proinflammatory Potential of Serum IgA J. Immunol., March 15, 2007; 178(6): 3973 - 3982. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Iakoubova, C. H. Tong, A. P. Chokkalingam, C. M. Rowland, T. G. Kirchgessner, J. Z. Louie, L. M. Ploughman, M. S. Sabatine, H. Campos, J. J. Catanese, et al. Asp92Asn Polymorphism in the Myeloid IgA Fc Receptor Is Associated With Myocardial Infarction in Two Disparate Populations: CARE and WOSCOPS Arterioscler Thromb Vasc Biol, December 1, 2006; 26(12): 2763 - 2768. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Wines, N. Willoughby, J. D. Fraser, and P. M. Hogarth A Competitive Mechanism for Staphylococcal Toxin SSL7 Inhibiting the Leukocyte IgA Receptor, Fc{alpha}RI, Is Revealed by SSL7 Binding at the C{alpha}2/C{alpha}3 Interface of IgA J. Biol. Chem., January 20, 2006; 281(3): 1389 - 1393. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Langley, B. Wines, N. Willoughby, I. Basu, T. Proft, and J. D. Fraser The Staphylococcal Superantigen-Like Protein 7 Binds IgA and Complement C5 and Inhibits IgA-Fc{alpha}RI Binding and Serum Killing of Bacteria J. Immunol., March 1, 2005; 174(5): 2926 - 2933. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Morton, R. J. Pleass, J. M. Woof, and P. Brandtzaeg Characterization of the Ligand Binding Site of the Bovine IgA Fc Receptor (bFc{alpha}R) J. Biol. Chem., December 24, 2004; 279(52): 54018 - 54022. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Wines, H. M. Trist, R. C. Monteiro, C. van Kooten, and P. M. Hogarth Fc Receptor {gamma} Chain Residues at the Interface of the Cytoplasmic and Transmembrane Domains Affect Association with Fc{alpha}RI, Surface Expression, and Function J. Biol. Chem., June 18, 2004; 279(25): 26339 - 26345. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Foster, M. Colonna, and P. D. Sun Crystal Structure of the Human Natural Killer (NK) Cell Activating Receptor NKp46 Reveals Structural Relationship to Other Leukocyte Receptor Complex Immunoreceptors J. Biol. Chem., November 14, 2003; 278(46): 46081 - 46086. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ding, G. Xu, M. Yang, M. Yao, G. F. Gao, L. Wang, W. Zhang, and Z. Rao Crystal Structure of the Ectodomain of Human Fc{alpha}RI J. Biol. Chem., July 18, 2003; 278(30): 27966 - 27970. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. van Spriel, J. H. W. Leusen, H. Vile, and J. G. J. van de Winkel Mac-1 (CD11b/CD18) as Accessory Molecule for Fc{alpha}R (CD89) Binding of IgA J. Immunol., October 1, 2002; 169(7): 3831 - 3836. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Mackay, M. D. Hulett, J. P. D. Cook, H. M. Trist, A. J. Henry, J. M. McDonnell, A. J. Beavil, R. L. Beavil, B. J. Sutton, P. M. Hogarth, et al. Mutagenesis Within Human Fc{epsilon}RI{alpha} Differentially Affects Human and Murine IgE Binding J. Immunol., February 15, 2002; 168(4): 1787 - 1795. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. M. van der Boog, G. van Zandbergen, J. W. de Fijter, N. Klar-Mohamad, A. van Seggelen, P. Brandtzaeg, M. R. Daha, and C. van Kooten Fc{alpha}RI/CD89 Circulates in Human Serum Covalently Linked to IgA in a Polymeric State J. Immunol., February 1, 2002; 168(3): 1252 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Morton, C. J. Howard, A. K. Storset, and P. Brandtzaeg Identification of Residues within the Extracellular Domain 1 of Bovine Fcgamma 2R Essential for Binding Bovine IgG2 J. Biol. Chem., December 14, 2001; 276(51): 47794 - 47800. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Honorio-França, P. Launay, M. M. S. Carneiro-Sampaio, and R. C. Monteiro Colostral neutrophils express Fc{alpha} receptors (CD89) lacking {gamma} chain association and mediate noninflammatory properties of secretory IgA J. Leukoc. Biol., February 1, 2001; 69(2): 289 - 296. [Abstract] [Full Text] |
||||
![]() |
B. D. Wines, C. T. Sardjono, H. M. Trist, C.-S. Lay, and P. M. Hogarth The Interaction of Fc{{alpha}}RI with IgA and Its Implications for Ligand Binding by Immunoreceptors of the Leukocyte Receptor Cluster J. Immunol., February 1, 2001; 166(3): 1781 - 1789. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Geissmann, P. Launay, B. Pasquier, Y. Lepelletier, M. Leborgne, A. Lehuen, N. Brousse, and R. C. Monteiro A Subset of Human Dendritic Cells Expresses IgA Fc Receptor (CD89), Which Mediates Internalization and Activation Upon Cross-Linking by IgA Complexes J. Immunol., January 1, 2001; 166(1): 346 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Launay, B. Grossetete, M. Arcos-Fajardo, E. Gaudin, S. P. Torres, L. Beaudoin, N. Patey-Mariaud de Serre, A. Lehuen, and R. C. Monteiro Fc{alpha} Receptor (Cd89) Mediates the Development of Immunoglobulin a (Iga) Nephropathy (Berger's Disease): Evidence for Pathogenic Soluble Receptor-Iga Complexes in Patients and Cd89 Transgenic Mice J. Exp. Med., June 5, 2000; 191(11): 1999 - 2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Wines, M. S. Powell, P. W. H. I. Parren, N. Barnes, and P. M. Hogarth The IgG Fc Contains Distinct Fc Receptor (FcR) Binding Sites: The Leukocyte Receptors Fc{gamma}RI and Fc{gamma}RIIa Bind to a Region in the Fc Distinct from That Recognized by Neonatal FcR and Protein A J. Immunol., May 15, 2000; 164(10): 5313 - 5318. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. van Zandbergen, R. Westerhuis, N. K. Mohamad, J. G. J. van de Winkel, M. R. Daha, and C. van Kooten Crosslinking of the Human Fc Receptor for IgA (Fc{alpha}RI/CD89) Triggers FcR {gamma}-Chain-Dependent Shedding of Soluble CD89 J. Immunol., December 1, 1999; 163(11): 5806 - 5812. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Pleass, J. I. Dunlop, C. M. Anderson, and J. M. Woof Identification of Residues in the CH2/CH3 Domain Interface of IgA Essential for Interaction with the Human Fcalpha Receptor (Fcalpha R) CD89 J. Biol. Chem., August 13, 1999; 274(33): 23508 - 23514. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Pleass, T. Areschoug, G. Lindahl, and J. M. Woof Streptococcal IgA-binding Proteins Bind in the Calpha 2-Calpha 3 Interdomain Region and Inhibit Binding of IgA to Human CD89 J. Biol. Chem., March 9, 2001; 276(11): 8197 - 8204. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maenaka, P. A. van der Merwe, D. I. Stuart, E. Y. Jones, and P. Sondermann The Human Low Affinity Fcgamma Receptors IIa, IIb, and III Bind IgG with Fast Kinetics and Distinct Thermodynamic Properties J. Biol. Chem., November 21, 2001; 276(48): 44898 - 44904. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |