The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
The Journal of Immunology, 1999, 162: 2146-2153.
Copyright © 1999 by The American Association of Immunologists

Identification of Residues in the First Domain of Human Fc{alpha} Receptor Essential for Interaction with IgA1

Bruce D. Wines, Mark D. Hulett2, Gary P. Jamieson, Halina M. Trist, Joanne M. Spratt and P. Mark Hogarth3

Helen M. Schutt Laboratory for Immunology, The Austin Research Institute, Austin Repatriation Medical Centre, Heidelberg, Victoria, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The FcR family contains multiple receptors for Igs, of which the most distantly related (~20%) is the IgA receptor (human Fc{alpha}R), being more homologous (~35%) to another family of killer-inhibitory receptor-related immunoreceptors with a 19q13.4 chromosomal location in humans. This study of the Fc{alpha}R demonstrated that, like several IgG receptors, Fc{alpha}R is a low affinity receptor for Ab (Ka ~ 106 M-1). Rapid dissociation of the rsFc{alpha}R:IgA complex (t1/2 ~ 25 s) suggests that monomer IgA would bind transiently to cellular Fc{alpha}Rs, while IgA immune complexes could bind avidly. Mutagenesis of histidyl 85 and arginyl 82, in the FG loop of domain 1, demonstrated that these residues were essential for the IgA-binding activity of Fc{alpha}R, while arginyl 87 makes a minor contribution to the binding activity of the receptor. This site is unusual among the Fc receptors (Fc{gamma}RII, Fc{gamma}RIII, and Fc{epsilon}RI), in which the ligand binding site is in domain 2 rather than domain 1, but like Fc{alpha}R, the FG loop comprises part of the ligand binding site. The putative F and G strands flanking the Fc{alpha}R ligand binding site are highly homologous in the other killer-inhibitory receptor-related immunoreceptors, suggesting they comprise a conserved structural element on which divergent FG loops are presented and participate in the specific ligand interactions of each of these receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human Fc{alpha}R 1 is encoded by a gene of five exons 2 located on chromosome 19q13.4 3 , as are the leukocyte-inhibitory receptors (LIR)4, 4, 5 and the killer-inhibitory receptors (KIR), together sharing 35–40% homology within a recently described family of receptors expressed on hemopoietic cells 6 . This family also includes p91 7 paired Ig-like receptors 8 and gp49 9 encoded on the syntenic region of mouse chromosome 7. The other FcRs are located on chromosome one and share lesser (~20%) homology to Fc{alpha}R. While the KIRs (and some LIRs) and Fc{alpha}R bind MHC and IgA, respectively, and some ligand-binding regions of KIR have been defined 10, 11 , the structural basis of Fc{alpha}R-binding IgA is unknown.

IgA is a major serum Ab and the predominate Ab at mucosal sites. IgA binding to Fc{alpha}R triggers the cellular aspects of IgA-mediated immunity against pathogens, both in the circulation and at the mucosal interface. Ligand binding initiates signaling through the Fc{epsilon}RI{gamma} subunit associated with the receptor 12, 13 , and the tyrosine kinases Syk and Btk 14 . This cascade activates the cell for respiratory burst, phagocytosis, and cytokine secretion 15, 16, 17 . Fc{alpha}R is expressed on macrophages/monocytes, eosinophils, and granulocytes; and analysis of mRNA splice variants has shown the receptor is expressed in several forms with potentially different functions 18, 19, 20, 21 .

Fc{alpha}R does not discriminate between IgA1 and IgA2 subtypes, serum and secreted forms, or monomeric and polymeric forms of IgA 22, 23, 24, 25 . This study determined the IgA binding site of Fc{alpha}R using a soluble form of Fc{alpha}R. The interaction of rsFc{alpha}R with IgA was evaluated using a biosensor, and the Ka was estimated to be ~106 M-1. A strategy combining the chemical modification and site-directed mutagenesis identified R82 and H85, in the FG loop of domain 1, as essential for the binding activity of Fc{alpha}R.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression and purification of rsFc{alpha}R

PCR of the pHuIgAR 1 , with the polymerase Pwo (Boehringer Mannheim, Castle Hill, Australia), was used to build a construct for the expression of the two EC domains and the EC membrane-proximal region of human Fc{alpha}RI in Pichia pastoris (SMD1168). PCR used the primers oBW21, CCCGGGGAATTCCAGGAAGGGGACTTTCCC; and oBW32, GGCCTAGGCCCATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCTGCCCCGGGCCCGATCAAGTTCTGCGTCGTG (which encodes a c-myc tag for the Fc{alpha}R C terminus). The PCR product was cloned into the EcoRI and AvrII (New England Biolabs, Beverly, MA) sites of pPIC-9 (Invitrogen, San Diego, CA), which was then digested with SnaBI and AvrII. The released fragment was subcloned into the SmaI and AvrII sites of pBAR34, a pPIC-9 derivative with the polylinker sequence: TACGTATCCCATCATCACCATCATCACAGCTCAGGTCTTGTGCCTAGAGGTTCCGGGCCCGGGTAGAATTCCCTAGGGCGGCCGCG, which translates as Tyr-Val-Ser-His-His-His-His-His-His-Ser-Ser-Gly-Leu-Val-Pro-Arg-Gly-Ser-Gly-Pro-Gly-*.

RsFc{alpha}R was thus expressed with hexahistidyl and c-myc tags at the N and C termini, respectively. This wild-type rsFc{alpha}R construct (pBAR 81) and mutant rsFc{alpha}R constructs were transfected by electroporation into P. pastoris, according to the manufacturer’s protocols (Invitrogen). MutS phenotype colonies expressing the recombinant receptors were selected and grown to maximum cell density in 2 L of MGY (Invitrogen) glycerol-containing medium. Cells were harvested by centrifugation and resuspended in one-fifth volume of BMMY (Invitrogen) containing 1 mM phosphate and 1% methanol. Methanol was replenished twice daily, and at the end of day 3, ZnCl2 was added to final concentration of 10 mM. The cells and precipitated proteins were removed by centrifugation at 8000 x g for 20 min. The rsFc{alpha}R, and other proteins in the supernatant, were precipitated and collected by the further addition of ZnCl2 to 5 mM and PEG 8000 (Sigma, St. Louis, MO) to 15% (w/v), followed by centrifugation (8000 x g, 20 min). This PEG cut fraction was dialyzed extensively against 50 mM phosphate, 300 mM NaCl (pH 8.5), and loaded onto an equilibrated nitrilotriacetic acid (NTA)-agarose column (Qiagen, Chatsworth, CA). RsFc{alpha}R eluted at low stringency in 50 mM phosphate, 300 mM NaCl (pH 6), and to remove the N terminus hexahistidine tag, was incubated with 2% w/w bovine thrombin (4 h, 25°C) in 50 mM Tris, 150 mM NaCl, 1 mM DTT, and 2.5 mM CaCl2 (pH 8). Thrombin was inactivated by 0.2 mM PMSF, and the rsFc{alpha}R preparation was finally passaged again on the NTA-agarose to remove nickel-binding impurities. The receptor was quantified using E280nm0.1% = 1.2, and yields of recombinant receptor were approximately 20 µg/L of culture. SDS-PAGE analysis and silver stain showed a doublet at ~40 kDa predominated with some other impurities present (data not shown).

A baculovirus expression construct was made by BglII digestion of pHuIgAR, releasing the Fc{alpha}R cDNA, and this was subcloned into the BamHI site of pFastBac1 (Life Technologies, Gaithersburg, MD) to make pBAR 141. A construct encoding a rsFc{alpha}R with a c-myc tag at the C terminus was made by removing the PvuII/NotI fragment from pBAR 141 and replacing it with the PvuII/NotI fragment from pBAR81. The manufacturer’s instructions were followed to produce recombinant virus and supernatant containing rsFc{alpha}R. Unpurified supernatants were used in gel shift and biosensor assays and contained up to 10 µg/ml Fc{alpha}R.

Biosensor assay of rsFc{alpha}R binding to immobilized IgA

Serum IgA (Calbiochem-Novabiochem, Alexandria, Australia) was coupled to a BIAcore CM5 carboxyldextran biosensor chip (Pharmacia, Uppsala, Sweden) using the established carbodiimide-mediated amine reaction protocol. IgA (50 µg/ml) was concentrated on the chip surface in 10 mM acetate (pH 5), and for the kinetic analysis, typically 1000 RU (for example, in Fig. 2GoA, 1350 U) was coupled to the chip. Control channels consisted of a chemically coupled blank channel and a channel of ~1000 RU of coupled rabbit IgG. Binding sensograms were obtained by subtraction of the sensogram of a IgG-coupled channel from the sensogram for the IgA-coupled channel. The sensograms obtained from the IgG-coupled channel were essentially identical with the chemically coupled blank channel and represented bulk refractive index effects of the samples with no evidence for Fc{alpha}R binding to IgG. Human IgG (Sandoglobulin, Novartis Pharmaceuticals, East Hanover, NJ) was also used as a control Ig to test Fc{alpha}R-binding specificity. Kinetic analyses used 50-µl aliquots of rsFc{alpha}R at concentrations of 0.2–2 µM injected at 10 µl/min in 10 mM HEPES, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 (pH 7.4). Data collected for each experiment were analyzed in one fit using the simultaneous fitting program Clamp 26 , yielding on and off rates and saturated binding levels. Equilibrium-binding analysis was performed by plotting the plateau RU value for each sensogram and fitting the data to a single binding site model.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. Biosensor analysis of the kinetics of rsFc{alpha}R binding to immobilized serum IgA. A, The kinetics of rsFc{alpha}R binding was measured using a biosensor chip with 1350 RU of immobilized human IgA on one channel and an equivalent amount of rabbit IgG on a control channel. RsFc{alpha}R at different concentrations between 0.2 and 2.2 µM was injected over the chip at 10 µl/min in 50-µl injections. IgA-binding sensograms (heavy lines) were obtained by subtraction of the control sensograms from the IgA sensograms. All sensograms were simultaneously fitted to a one-site binding model using the program Clamp (26) with the generated theoretical sensograms shown (light lines). B, Equilibrium-binding analysis was performed by fitting the maximal RU bound for each sensogram to a single site model.

 
Native gel electrophoresis

Samples of recombinant myc-tagged rsFc{alpha}R (10 µl of Pichia or 1/10 diluted baculovirus supernatant) and IgA at 200 µg/ml were electrophoresed on native 12.5% (or 8%) polyacrylamide gels, according to established procedures 27 , at 150 V for 3 h. The proteins were Western transferred to polyvinylidene difluoride (PVDF) membranes by semidry blotting and immunodetection performed using the anti-c-myc mAb 9E10. The 9E10 ascites was diluted 1/2000 in PBS containing 5% skim milk powder and incubated with the blot for 2 h at 25°C, followed by incubation with 1/1000 dilution of horseradish peroxidase-conjugated anti-mouse IgG and ECL reagents (Amersham, Buckinghamshire, U.K.).

Chemical modification rsFc{alpha}R

Protein modification with diethylpyrocarbonate (DEPC) was as described by Easterbrook-Smith 28 . Following reaction with 0.02–0.2 mM DEPC (Sigma) in 0.8x PBS (pH 7.4) for 20 min, further protein modification was stopped by the addition of imidazole to a final concentration of 20 mM. Arginyl modification with p-hydroxyphenylglyoxal (Pierce, Rockford, IL) was as described by Wines and Easterbrook-Smith 29 .

Mutagenesis of rsFc{alpha}R cDNA

Each histidine residue in the extracellular region of rsFc{alpha}R was altered to a glutamyl or alanyl using a QuickChange mutagenesis kit (Stratagene, La Jolla, CA) with degenerate oligonucleotides containing a GCG or GAG codon targeted to the histidyl codon. The sense oligonucleotides of the mutagenic oligonucleotide pairs were as follows: H(68)A/E, CTGAGTTCGTCATTGACG(C/A)GATGGACGCAACCAAG; H(85)A/E, GCCAATATAGGATAGGGG(C/A)GTACAGATTCCGGTACAG; H(129)A/E, CACGTGCAGCTCAGCAG(C/A)GATCCCATTTGATAGATTTTC; H(148)A/E, GAACTTTCTCTGCCACAGG(C/A)GCAAAGTGGGGAACACCCG; H(153)A/E, CAGCACCAAAGTGGGGAAG(C/A)GCCGGCCAACTTCTCTTTGG; H(199)A/E, GTGGTCACAGACTCCATCG(C/A)GCAAGATTACACGACGCAG.

Likewise, the arginine residues 82, 87, and 89 were targeted for mutagenesis using the following oligonucleotide and its reverse complement: RRR(82,87,89)K/G/E/R, K/G/E/R, Q/G/E/R, CGCTATCAGTGCCAATAT(A/G)(G/A)GATAGGGCACTAC(A/G)(G/A)ATTC(C/G)(G/A)GTACAGTGACACCCTG.

Mutant constructs were confirmed using a thermosequenase dye terminator cycle sequencing kit (Amersham) and an ABI Prism 377 DNA sequencer (Applied Biosystems, Foster City, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The IgA binding site was defined by analysis of normal, chemically modified, and mutant recombinant soluble forms of the extracellular domains of Fc{alpha}R. The interaction of these with IgA was analyzed using biosensor and gel shift assays.

Specificity of the rsFc{alpha}R:IgA interaction

The IgA:rsFc{alpha}R interaction was measured using a biosensor chip coupled with serum IgA, to which rsFc{alpha}R (~0.2 µM, 40 µl) was applied (10 µl/min) and approximately 400 RU of receptor binding to the surface was observed. The specificity of this binding was confirmed by the prior incubation of the rsFc{alpha}R with serum IgG (0.5 µM) without effect on the binding of rsFc{alpha}R to the IgA channel. In contrast, incubation with 0.5 µM IgA reduced this binding by ~50% to 200 RU (Fig. 1Go). The saturable rsFc{alpha}R binding to the IgA gave typical ratios of ~0.7, and this indicated the immobilized IgA was highly active in receptor binding and suitable for analysis of the binding kinetics. That is, the coupling of IgA through lysyl amine groups to the biosensor surface did not appear to compromise its Fc{alpha}R-binding activity.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. The specificity of rsFc{alpha}R binding to immobilized serum IgA on the biosensor. RsFc{alpha}R specifically binds immobilized serum IgA. RsFc{alpha}R 40 µl at ~0.2 µM was injected over the chip at 10 µl/min. The first injection was of rsFc{alpha}R alone, the second of receptor incubated with IgG at 0.5 µM, and the third was receptor incubated with 0.5 µM serum IgA.

 
Biosensor analysis of the rsFc{alpha}R:IgA interaction

The kinetics of the rsFc{alpha}R:IgA interaction was determined using a chip with 1350 RU of coupled serum IgA and injection of rsFc{alpha}R at various concentrations in the range 0.2–2.2 µM. The sensograms were fitted simultaneously to a single binding site using the Clamp program (Fig. 2GoA) 26 . This kinetic analysis yielded rapid on and off rates and an affinity of 0.96 x 106 M-1 (Kd = 1 µM; Table IGo). Equilibrium analysis of the same data (Fig. 2GoB) gave an estimate of the affinity of the interaction of 1 x 106 M-1, which agreed with the data analysis given by the Clamp program. That this analysis was not affected by the coupling of the IgA to the chip was evident from the following experiment. In this second type of assay, the Ab 9E10 was immobilized on the chip and used to capture rsFc{alpha}R. Different concentrations of serum IgA were applied, and the affinity obtained for the IgA:Fc{alpha}R interaction (Ka ~ 0.8 x 106 M-1) agreed with the previous analyses.


View this table:
[in this window]
[in a new window]
 
Table I. Biosensor analysis of rsFc{alpha}R interaction with serum IgA1

 
Chemical modification and mutagenesis of rsFc{alpha}R histidine residues

The rsFc{alpha}R:IgA interaction was affected by pH when measured at pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, and 9. Optimal interaction was observed at pH 7.5, with a rapid loss of activity at more acid pH (Fig. 3GoA). The imidazole side chains of histidine residues typically have pKa values near 7, so the pH-binding profile is consistent with a histidine residue participating in the Fc{alpha}R:IgA interaction.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 3. The pH dependence of IgA binding and DEPC treatment implicates histidyl involvement in rsFc{alpha}R binding to IgA. A, RsFc{alpha}R was dialyzed against 5 mM acetate, 5 mM MOPS, 5 mM HEPES, 5 mM Tris, 150 mM NaCl, and 3.4 mM EDTA at the pH values indicated. Binding to immobilized IgA was measured using the BIAcore biosensor, as in Fig. 1Go. B, RsFc{alpha}R was modified with the indicated concentrations of the histidyl-selective reagent DEPC, as described in Materials and Methods. The binding of the histidyl-modified rsFc{alpha}R to immobilized IgA was measured by biosensor analysis, as in Fig. 1Go.

 
To confirm the participation of a histidine residue(s) in IgA binding, rsFc{alpha}R was chemically modified with the histidyl-selective reagent DEPC, and the effect on IgA binding was monitored. Treatment of rsFc{alpha}R with DEPC (0.02–0.2 mM) resulted in a dose-dependent loss of approximately 60% of the receptor-binding activity (Fig. 3GoB). Most of the loss of binding activity was observed on treatment of the receptor with up to 0.1 mM DEPC, with the 0.2 mM DEPC treatment resulting in a relatively small additional loss of binding activity. This clearly indicated a histidine(s) residue in the IgA binding site of Fc{alpha}R and the partial loss of binding activity with the modification of reactive histidyls.

Confirmation of histidyl involvement in IgA binding and the identification of these were made by site-directed mutagenesis performed separately on each of the histidine residues in the soluble Fc{alpha}R. The DEPC adduct to a histidyl side chain greatly changes the properties of the residue, and so, in the first instance, mutagenesis to glutamyls was chosen, as this substitution also greatly changes the chemistry of the targeted histidyl. Histidyls (H68, H85, H129, H148, H153, H199) were individually changed to a glutamic acid residue, and the mutant proteins were expressed in P. pastoris and analyzed for IgA binding by a native gel bandshift assay (Fig. 4GoA). In the band shift assay, the wild-type rsFc{alpha}R, when incubated with IgA, was found to migrate more slowly as a higher m.w. rsFc{alpha}R:IgA complex (Fig. 4GoA, lane 2) than as the free receptor (Fig. 4GoA, lane 1). The mutant receptors H68E, H129E, H148E, H153E, and H199E also shifted to a high m.w. in the presence of IgA, in a manner identical to the wild-type receptor. In contrast, the migration of the H85E mutant protein did not alter in the presence of IgA; i.e., no IgA-binding activity was detected (Fig. 4GoA, lane 6). Thus, the use of two distinct approaches, chemical modification and mutagenesis, clearly defines Fc{alpha}R histidyl involvement in IgA binding. The mutagenesis approach identified H85 as participating in the IgA binding site and probably excluding the other histidyl-containing regions.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 4. Substitution of H85 leads to the loss of IgA-binding activity of mutant rsFc{alpha}R. Western blots were performed on normal and mutant rsFc{alpha}R proteins following native gel electrophoresis in the presence, or absence, of 2 µg serum IgA. A, Histidyl to glutamyl substitutions of rsFc{alpha}R. Aliquots (10 µl) of Pichia supernatant containing the wild-type and mutant rsFc{alpha}R proteins H68E, H85E, H129E, H148E, H153E, and H199E were electrophoresed in the presence (+) or absence (-) of IgA. Wild-type rsFc{alpha}R is indicated by wt. B, Histidyl to alanyl substitutions of rsFc{alpha}R. The wild-type (wt) and mutant rsFc{alpha}R proteins H68A, H85A, H129A, H148A, H153A, and H199A were analyzed as described for A. C, The H85A mutant rsFc{alpha}R has partial, and H85E has complete loss of IgA-binding activity. The relative activities of the H85 mutant proteins were determined by incubating samples of the appropriate Pichia supernatant with 200, 100, 50, and 0 µg/ml of serum IgA. Samples were then applied to a native 8% polyacrylamide gel for electrophoresis. Western blotting and detection were as described in Materials and Methods.

 
Whether the nature of the glutamyl substitution in the Fc{alpha}R mutants affected the IgA-binding activity of the receptor was tested by mutating the six histidyls to alanyls, and the mutant rsFc{alpha}R proteins tested in the IgA gel shift assay. All of the rsFc{alpha}R mutants bound IgA in a manner indistinguishable from the wild type, with the exception of the H85 mutant (Fig. 4GoB). Mutation of H85 to A resulted in loss of IgA-binding activity. In some assays, particularly if a lower concentration of acrylamide was used in the native gel (in this case 8%), the H85A mutant protein showed some residual IgA-binding activity (Fig. 4GoC). This titrated rapidly and was apparent only at the highest concentration (200 µg/ml) of IgA. On this basis, the activity of the H85A mutant is at least fourfold less than the wild-type protein, whereas binding activity was never observed with the H85E mutant protein.

Chemical modification and mutagenesis of rsFc{alpha}R arginine residues

Inspection of the sequence of Fc{alpha}R revealed multiple arginyls (R82, R87, and R89) flanking H85. A separate series of experiments addressed the role of arginine residues in IgA binding by chemical modification of the receptor with the arginyl-selective reagent p-hydroxyphenylglyoxal at the concentrations 0, 1, 2, and 4 mM. The activity of the modified protein in IgA binding was measured by biosensor assay, and a dose-dependent loss of activity was observed, with the 4 mM phenylglyoxal-treated protein having ~10% of the binding activity of the unmodified receptor (Fig. 5GoA). These data suggest the involvement of Fc{alpha}R arginine residues in IgA binding. Mutagenesis of the arginyls flanking H85 was performed to confirm this and to identify which arginine residues contribute to IgA binding. A single pair of degenerate oligonucleotides was used to target R82, R87, and R89 in the one mutagenesis reaction, and several constructs were sequenced to select appropriate mutants. Those chosen were R82K,R87,R89Q (KRQ); R82K,R87K,R89E (KKE); R82G,R87,R89 (GRR); R82,R87G, R89G (RGG); and R82,R87G,R89 (RGR), and these mutant cDNAs and the normal cDNA (R82,R87,R89) were expressed using baculovirus. IgA binding by the proteins was measured using the native gel bandshift assay (Fig. 5GoB). The wild-type receptor (R82,R87,R89; RRR, lane 1) migrated more slowly as a complex when incubated with IgA (lane 2), while the migration of the R82K,R87,R89Q double mutant receptor (KRQ, lane 3) did not alter in the presence of IgA (lane 4). This indicates some combination of residues 82 and 89 contributes to IgA binding. The single mutant receptor R82G,R87,R89 (GRR, lane 5) also showed no IgA-binding activity (lane 6), indicating R82 is essential for IgA binding. The mutant receptor R82,R87G,R89 (RGR lane 10) and the double mutant R82,R87G,R89G (RGG, lane 8) showed wild-type IgA-binding activity in being shifted to migrating as a high m.w. species in the presence of IgA. Thus, from this assay, neither R87 or R89 appears to contribute to IgA binding, while R82 is essential for binding activity.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 5. Modification of rsFc{alpha}R arginyls or mutation of R82 leads to loss of IgA-binding activity. A, RsFc{alpha}R was modified with the indicated concentrations of the arginyl-selective reagent p-hydroxyphenylglyoxal, as described in Materials and Methods. The binding of the arginyl-modified rsFc{alpha}R to immobilized IgA was measured by BIAcore biosensor analysis, as in Fig. 1Go. B, Western blots were performed on normal (R82,R87,R89) and arginyl mutant rsFc{alpha}R proteins following native gel electrophoresis in the presence (+) or absence (-) of 2 µg serum IgA. Lanes 1 and 2, wild-type R82,R87,R89 (RRR) rsFc{alpha}R (10 µl 1/10 diluted baculovirus supernatant); lanes 3 and 4, R82K,R87,R89Q (KRQ); lanes 5 and 6, R82G,R87,R89 (GRR); lanes 7 and 8, R82,R87G,R89G (RGG); and lanes 9 and 10, R82,R87G,R89 (RGR).

 
These mutants were further characterized by binding to IgA on the biosensor. The amounts of receptors expressed in the baculovirus supernatants varied and were normalized with respect to the C-terminal myc tag by binding, on the biosensor, to a channel of immobilized 9E10 anti-c-myc Ab (data not shown). Thus, the relative affinities of the arginine mutants could be compared with that of the normal rsFc{alpha}R. The binding to IgA of the supernatant containing normal rsFc{alpha}R gave a maximum response of ~110 RU, while no measurable binding was found with the R82G,R87,R89 (GRR) mutant receptor (Fig. 6GoA). This confirmed the result obtained by native gel shift analysis, that R82 is essential for IgA-binding activity of Fc{alpha}R (Fig. 5GoB). The biosensor assay was, however, more sensitive than the gel shift assay, in that it indicated a partial activity, about 60% that of the normal receptor, for the R82,R87G,R89 (RGR) mutant receptor. This indicated that R87 does make a minor contribution to the activity of the binding site. For the double mutant receptor R82,R87G,R89G (RGG), there was no additional diminution of IgA-binding activity with the additional substitution of R89, suggesting R89 makes no contribution to IgA binding. For the two mutants with a lysine substitution at the critical position 82, it was not possible to determine whether there was weak residual IgA binding above background. To measure the weak IgA binding of such mutant receptors, a method for amplification of the binding activity of the normal and mutant Fc{alpha}Rs was necessary. High apparent affinities are normally achieved by low affinity cell surface receptors, such as Fc{alpha}R, through multivalent interactions with aggregated ligands. This effect was mimicked by reacting both normal and mutant rsFc{alpha}R in the baculovirus supernatants with the mAb 9E10 (10 µg/ml), which binds to the c-myc tag on the protein C terminus, to produce receptor dimers. The binding of these receptor dimers to immobilized IgA was measured, and the apparent affinity was clearly increased compared with that of receptor in the untreated baculovirus supernatant (Fig. 6GoB). The t1/2 for dissociation of the 9E10:rsFc{alpha}R dimers from the IgA layer was extended to ~10 min (Fig. 6GoB), representing a ~20-fold increase over that of the normal monomer receptor (Fig. 6GoA). It is likely that the receptor dimers are able to bind bivalently to different IgA molecules on the layer, and this avidity effect accounts for the observed high apparent affinity. Once again, the R82G mutant receptor (GRR) showed no IgA-binding activity, producing a sensogram equivalent to the injection of the 9E10 mAb alone. The two mutant receptors with the R87G substitutions again showed equivalent activity at ~50% that of the normal receptor (~200 RU versus ~425 RU). Most interestingly, in this sensitive IgA-binding assay, the mutant receptors with R82K substitutions (R82K,R87,R89Q (KRQ) and R82K,R87K, R89E (KKE)) showed some activity, although less than 10% that of the normal rsFc{alpha}R. Thus, it would appear the maintenance of a positive charge in substituting a lysine for the critical R82 is compatible with the retention of some IgA-binding activity, while substitution for a glycine completely inactivates the binding site. That lysine nonetheless rather poorly substitutes for arginine 82 indicates that something more than merely a positive charge is required at this position for optimal IgA binding.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Biosensor analysis of the IgA-binding activities of R82,R87,R89 mutants of rsFc{alpha}R. A, Baculovirus supernatants containing rsFc{alpha}R and mutant proteins were diluted, typically about 1/5, to give equivalent binding to the anti-myc tag mAb 9E10. These dilutions of the normal and mutant receptors were then injected over a chip containing immobilized serum IgA, as described in Fig. 1Go. Samples were: wild-type rsFc{alpha}R R82,R87,R89 (RRR); mutant receptor R82G,R87,R89 (GRR); mutant receptor R82,R87G,R89G (RGG); mutant receptor R82,R87G,R89 (RGR); mutant receptor R82K,R87,R89Q (KRQ); and mutant receptor R82K,R87K,R89E (KKE) labeled on the figure as indicated in brackets. B, The IgA-binding activity of dimers of the wild-type and mutant receptors formed by reaction with mAb 9E10. Baculovirus supernatants were diluted identically as described in A, and samples were: wild-type rsFc{alpha}R R82,R87,R89 incubated with 10 µg/ml mAb 9E10 (RRR); mutant receptor R82G,R87,R89, and mAb 9E10 (GRR); mutant receptor R82,R87G,R89G, and mAb 9E10 (RGG); mutant receptor R82,R87G,R89, and mAb 9E10 (RGR); mutant receptor R82K,R87,R89Q, and mAb 9E10 (KRQ); mutant receptor R82K,R87K,R89E, and mAb 9E10 (KKE); and finally, 10 µg/ml mAb 9E10 alone (mAb 9E10). Samples are labeled on the figure as indicated in brackets. Binding was measured identically as in A.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fc{alpha}R is an interesting member of the Ig superfamily, as it may be classified either by function as a FcR, or by homology and gene location, as one of the 19q13.4 family of human immunoreceptors. These include the MHC-binding inhibitory receptors, the KIRs and some LIRs, as well as other related mouse immunoreceptors, paired Ig-like receptors/p91 and gp49. This study characterized the Fc{alpha}R:IgA interaction, as it provides an opportunity for insight into a FcR:Ig interaction specifically and that of the 19q13.4-related immunoreceptors generally.

RsFc{alpha}R, consisting of the two EC domains and the membrane-proximal region, was expressed in P. pastoris, and the binding to immobilized serum IgA was assayed using a biosensor. The assay specifically measured IgA-binding activity, since incubation of rsFc{alpha}R with IgA in solution, but not IgG, inhibited the rsFc{alpha}R interaction with the immobilized IgA layer. Analysis of the biosensor assay data revealed the rsFc{alpha}R interaction to have a low affinity constant (Ka = 1 x 106 M-1; Kd = 1 µM) and rapid on and off rates (k1 = 26,800 M-1s-1 and k-1 = 0.028 s-1; Table IGo). A second form of biosensor assay involved immobilizing the anti-tag mAb 9E10 to the chip, tethering the tagged rsFc{alpha}R, and then measuring the binding of IgA at various concentrations (data not shown). Equilibrium-binding analysis of this data yielded a Ka ~ 0.8 x 106 M-1; Kd ~ 1.2 µM, which agreed with the first analysis and discounted potential artifacts arising from the protein immobilization. Subsequent analysis of the baculovirus-produced receptor has shown a Ka of ~2 x 106 M-1, with a small component of higher affinity binding, the significance of which has not been established (data not shown).

Previously, the affinity of Fc{alpha}R has been measured indirectly, by the inhibition of binding activity on addition of soluble IgA. In a study using IgA to inhibit the binding of IgA-coated erythrocytes to monocytes, micromolar IgA concentrations gave 50% inhibition of rosette formation (IC50 ~ 0.1 mg/ml, ~0.6 µM) 22 . Another inhibition study used affinity-purified receptor from surface-iodinated neutrophils to bind IgA Sepharose. Again, inhibition of binding by free IgA yielded an IC50 ~ 0.5 µM, which corresponds to a Ka ~ 2 x 106 M-1 30 . Both of these studies are in agreement with the values obtained in this report (Kd = 0.5–1 µM; Ka = 1–2 x 106 M-1). Biosensor analysis revealed rapid kinetics for the interaction, with the dissociation rate constant being such that the Fc{alpha}R:IgA-bound state had a t1/2 ~25 s. The rapid dissociation of bound monomer IgA from Fc{alpha}R implies that, for example, blood myeloid cell Fc{alpha}Rs would rapidly be exchanging bound surface IgA for other IgA molecules from the circulation. Since the serum concentration of IgA (~4–22 µM) exceeds the Kd for the Fc{alpha}R:IgA interaction, most of the receptors on a blood myeloid cell would be occupied with IgA. However, the transient nature of the interaction with monomer allows cell surface Fc{alpha}Rs to continuously sample IgA in the vicinity and, through the avidity of the interactions, to sense the aggregation state of the IgA. Only when an immune complex containing IgA was encountered would binding be other than transient. The data presented in this work indicate Fc{alpha}R is a low affinity Fc receptor, more akin to Fc{gamma}RII/III than to the high affinity receptors Fc{gamma}RI and Fc{epsilon}RI 31 . On the cell surface, Fc{alpha}R would therefore be expected to more efficiently bind immune complexes containing IgA or polymeric IgA, as suggested by Maliszewski et al. 32 . This avidity effect is well illustrated by the increase in apparent affinity of Fc{alpha}R dimers, formed by reaction of the myc-tagged rsFc{alpha}R with the anti-myc mAb, such that the t1/2 for the bound receptor dimer increased 20-fold over that of the monomer receptor (Fig. 6GoB).

Since the specificity of the rFc{alpha}R for IgA had been validated, and the affinity of the interaction measured, the location and nature of the IgA binding site were investigated. The pH dependence of receptor binding to IgA appeared to reflect the titration of a histidyl. This was a useful indication of a histidine residue at the binding site since no modification or mutagenesis of the protein was involved. Similar pH dependence in the binding of C1q 28, 29 and FcRn 33 to IgG reflects the direct participation of histidyls in these binding reactions. Furthermore, chemical modification of rsFc{alpha}R with DEPC suggested a role for histidyls in the binding reaction. Water-soluble chemical modification reagents are more likely to target surface-exposed residues than buried ones, surface exposure being an expected feature for a binding site residue. Each of the six histidyls in rsFc{alpha}R (two in EC1 and four in EC2) was separately mutated to a glutamyl, making a large change in the properties of the histidine residue, as does the DEPC modification. Substitutions to alanyls were also made, and in both instances, only the mutation of one histidine, H85, resulted in loss of IgA-binding activity. The loss of IgA binding for the H85E mutant protein was absolute, and for the H85A receptor loss of activity was substantial, but not complete, having at least fourfold less binding activity than that of the normal protein. Clearly, the location of H85 in the sequence of Fc{alpha}R is an important marker of the IgA binding site. Although single amino acid changes are generally well tolerated in the overall structure of a protein 34 , there is always the possibility of structural disruption of the protein. In making mutations to both a charged (glutamyl) and uncharged (alanyl) side chain, we attempted to match some of the different properties of the substituted histidyl and so, by one or the other mutation, to minimize disruption of the protein structure.

In addition to the results showing loss of binding after mutation of H85, the lack of effect on IgA binding by mutation of the other five histidine residues to either glutamic or alanine residues is informative in that these sites apparently do not form part of the IgA binding site. Indeed, it is of interest that four of these histidyls are located in EC2. In the other FcRs, it is this second domain, and not the first domain, that contains the binding site for IgG or IgE 35 . In fact, H131 of Fc{gamma}RII, a residue involved in IgG binding, in a sequence alignment of Fc{alpha}R corresponds with H148 of Fc{alpha}R, the mutation of which has no effect on IgA binding. Clearly, Fc{alpha}R and the other two EC domain FcRs (Fc{gamma}RII, Fc{gamma}RII, and Fc{epsilon}RI) have very different topologies of ligand binding.

A distinctive feature of the region of Fc{alpha}R near H85 is the three arginine residues R82, R87, and R89. The modification of the protein with the arginyl-selective reagent phenylglyoxal affected IgA binding, providing evidence of a role for arginine residues in IgA binding. Residues R82, R87, and R89 were altered by mutagenesis, and the IgA-binding activities of the mutant proteins were assessed by gel shift and biosensor assay. R82 was found to be essential for IgA binding, while R87 makes a minor contribution to binding since R87G mutant protein had ~60% of normal IgA-binding activity and R89 is not required, as the R87G, R89G double mutant receptor demonstrated no additional loss of IgA-binding activity. Thus, residues 82–85, RIGH, comprise an essential element of the IgA binding site of Fc{alpha}R. Residues 82 and H85 are shown in space-filling representation on a ribbon diagram (Fig. 7GoA) of the solved KIR structure 36 , which was used as a pertinent model for Fc{alpha}R on the basis of its homology with the KIRs. The IgA binding site can be seen to be a positively charged loop lying out on the apical tip of EC1. The potential for artifact in this mutagenesis study is diminished by the location of the binding site to a loop. Generally, loops of Ig superfamily proteins can be quite variable without causing alteration to the overall protein fold, so mutation in loops, such as in this study, is likely to be compatible with the native protein structure. It might be argued that the mutations affecting binding have altered the local structure of the loop itself, rather than removing actual essential binding contacts. Important to such an argument is the mutation of R89, close to the other residues 82, 85, and 87, which has no effect on binding. So, either residues 82, 85, and 87 provide binding interactions with IgA or they are so close to binding residues that they are, in either case, defining markers of the IgA binding site.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 7. The KIR structure as a model of Fc{alpha}R and a sequence alignment of the KIR-related immunoreceptors and FcRs. A, The structure of the p58 KIR (36) is shown as a ribbon diagram with residues 82, 85, and 87 displayed as space-filling representations. This study indicates R82 and H85 comprise essential elements of the IgA binding site of Fc{alpha}R. This binding site, lying on the tip of domain 1, differs from the other FcRs, in which mutagenesis data have indicated that the ligand binding site is in EC2 at the "elbow" between EC1 and EC2. B, Diagrammatic representation of the FcR- and KIR-related immunoreceptors. The percentage of identity shown is derived from comparison of the two Fc{alpha}R EC domains with the first two of the other immunoreceptors using Align query, at EERIE (GeneStream IGH, Montpellier, France). C, An alignment of the FG loop region of rsFc{alpha}R with the corresponding regions of related immunoreceptors. Strands are indicated by bold arrows and are based on the strand assignment of the KIR structure (A). Identities with Fc{alpha}R are indicated by dark background.

 
The IgA binding site of Fc{alpha}R is distant from the prototypical FcR ligand binding site, which lies in EC2 at the interface with EC1. This KIR structure was also used to assign strands in the Fc{alpha}R sequence (Fig. 7Go, B and C) such that R82, H85, and R87 lie in the putative FG loop of domain 1 of Fc{alpha}R. Recent work has implied that the IgA binding site is located in the first domain, as a variant receptor lacking EC2 still binds secretory IgA 18 . This unique arrangement of a FcR ligand binding site mirrors a further unusual feature of the Fc{alpha}R:IgA interaction, that is, Fc{alpha}R binds to the C{alpha}2C{alpha}3 interface of IgA and is unaffected by substitution of the hinge 37 , whereas the binding sites of the other FcRs include the lower hinge region of the Ab 35 . The hinge region of IgA, unlike other Abs, is a substrate for pathogen proteases 38 , and in response to this selective pressure, both the Fc{alpha}R and IgA proteins may have co-evolved to use unique sites for binding. The C{alpha}2C{alpha}3 interface of the Fc region of IgA includes some acidic residues (E262, D263, and E269) that may be close to residues L266 and L465, which, by mutagenesis analysis, bind the receptor 37 . Some of these negatively charged IgA Fc residues may then comprise part of the binding site for Fc{alpha}R, and could be involved in charge matching with cationic residues in the sequence RIGHYR in the FG loop of Fc{alpha}R.

It is notable that, although the topology of ligand binding by Fc{alpha}R is very different from the other FcRs, there are some striking similarities in the composition of these ligand binding sites. First, although different domains are used, the other FcRs and Fc{alpha}R all utilize a FG loop in ligand binding. Second, features of the Ig-binding FG loops are common between Fc{alpha}R and the Fc{gamma}Rs (Fig. 7GoC). For example, the IgA-binding sequence RIGH in Fc{alpha}R is paralleled in Fc{gamma}RII (FG loop of domain 2) by the sequence NIGY, and mutagenesis of residues I155, G156, or Y157 decreases IgG binding 35 . So, although they are distantly related, similar ligand-binding function may require the conservation of some elements of the ligand-binding loop.

Fc{alpha}R shares 30–40% homology with the KIRs, LIRs, and related immunoreceptors, and is significantly less homologous (~22%) with the other Ig-binding receptors, such as Fc{gamma}RII and Fc{gamma}RIII (Fig. 7GoB). Within the 19q13.4 family and related immunoreceptors, there is very high homology within the putative F, and more especially, the G strands (Fig. 7GoC). In contrast, the sequence of the loop between these strands is more diverse. Such an arrangement would occur if the conserved strand sequences provided a part of the general fold of the domain, on which different ligand-binding loops could be displayed. In support of this notion, Fc{alpha}R and the Fc{gamma}Rs, which are the most distantly related in this grouping of receptors, all use this loop in binding ligand. This is also likely to be the case with immunoreceptors more closely related to Fc{alpha}R than the FcRs. The FG loop is then predicted to be a hot spot for receptor:ligand interactions in this family of immunoreceptors. In this respect, it is notable that H85 is common to the Fc{alpha}R and the KIR FG loops. H85 is located near the N terminus of the protein, where, in the KIR, a zinc-binding motif has been identified that contributes to the Zn-dependent inhibition of killing of targets bearing HLA-C 11, 39 . H85 in the KIR may contribute to this Zn coordination site.

The unique nature of Fc{alpha}R, both in terms of the mode of ligand interaction and its homology to the KIR-related immunoreceptors, provides fresh insight into both of these immune receptors and the other FcRs. First, Fc{alpha}R is a low affinity IgA-immune complex receptor. Second, the unusual topology of both receptor and IgA binding sites may reflect pathogen-derived evolutionary pressure on the IgA hinge. Third, the domain 1 FG loop of Fc{alpha}R contains the essential sequence element RIGH required for IgA binding. Finally, since Fc{alpha}R and the other FcRs use a FG loop in ligand binding, by interpolation the other KIR-related immunoreceptors are also likely to use this region in ligand interaction.


    Acknowledgments
 
We thank Nadine Barnes for expert technical assistance, and Mark Smyth, Lin Rigby, and Ian MacKenzie for critical reading of the manuscript. We are grateful to Neil McKearn for the kind gift of some purified 9E10 mAbs, and Don Wiley for the killer-inhibitory receptor coordinates.


    Footnotes
 
1 This work was supported by a grant from the National Health and Medical Research Council. Back

2 Current address: Division of Immunology and Cell Biology, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia. Back

3 Address correspondence and reprint requests to Dr. P. M. Hogarth, Helen M. Schutt, Laboratory for Immunology, The Austin Research Institute, Kronheimer Building, Austin Repatriation Medical Centre, Studley Road, Heidelberg, Victoria 3084, Australia. E-mail address: Back

4 Abbreviations used in this paper: LIR, leukocyte-inhibitory receptor; DEPC, diethylpyrocarbonate; EC, extracellular; KIR, killer-inhibitory receptor; rsFcR, recombinant soluble Fc receptor; RU, resonance units. Back

Received for publication August 7, 1998. Accepted for publication November 5, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Maliszewski, C. R., C. J. March, M. A. Schoenborn, S. Gimpel, L. Shen. 1990. Expression cloning of a human Fc receptor for IgA. J. Exp. Med. 172:1665.[Abstract/Free Full Text]
  2. De Wit, T. P. M., H. C. Morton, P. J. Capel, J. G. J. van de Winkel. 1995. Structure of the gene for the human myeloid IgA Fc receptor (CD89). J. Immunol. 155:1203.[Abstract]
  3. Kremer, E. J., V. Kalatzis, E. Baker, D. F. Callen, G. R. Sutherland, C. R. Maliszewski. 1992. The gene for the human IgA Fc receptor maps to 19q13.4. Hum. Genet. 89:107.[Medline]
  4. Borges, L., M.-L. Hsu, N. Fanger, M. Kubin, D. Cosman. 1997. A family of human lymphoid and myeloid Ig like receptors, some of which bind to MHC class I molecules. J. Immunol. 159:5192.[Abstract]
  5. Cella, M., C. Dohring, J. Samaridis, M. Dessing, M. Brockhaus, A. Lanzavecchia, M. Colonna. 1997. A novel inhibitory receptor ILT3 expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J. Exp. Med. 185:1743.[Abstract/Free Full Text]
  6. Dupont, B., A. Selvakumar, U. Steffens. 1997. The killer cell inhibitory receptor genomic region on human chromosome 19q13.4. Tissue Antigens 49:557.[Medline]
  7. Hayami, K., D. Fukuta, Y. Nishikawa, Y. Yamashita, M. Inui, Y. Ohyama, M. Hikida, H. Ohmori, T. Takai. 1997. Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors. J. Biol. Chem. 272:7320.[Abstract/Free Full Text]
  8. Kubagawa, H., P. D. Burrows, M. D. Cooper. 1997. A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells. Proc. Natl. Acad. Sci. USA 94:5261.[Abstract/Free Full Text]
  9. Rojo, S., D. N. Burshtyn, E. O. Long, N. Wagtmann. 1997. Type I transmembrane receptor with inhibitory function in mouse mast cells and NK cells. J. Immunol. 158:9.[Abstract]
  10. Winter, C. C., E. O. Long. 1997. A single amino acid in the p58 killer cell inhibitory receptor controls the ability of natural killer cells to discriminate between the two groups of HLA-C allotypes. J. Immunol. 158:4026.[Abstract]
  11. Rajagopalan, S., C. C. Winter, N. Wagtmann, E. C. Long. 1995. The Ig-related killer cell inhibitory receptor binds zinc and requires zinc for recognition of HLA-C on target cells. J. Immunol. 155:4143.[Abstract]
  12. Pfefferkorn, L. C., G. R. Yeaman. 1994. Association of IgA-Fc receptors Fc{alpha}R, with Fc{epsilon}RI{gamma} subunits in U937 cells: aggregation induces the tyrosine phosphorylation of {gamma}2. J. Immunol. 153:3228.[Abstract]
  13. Morton, H. C., I. E. van den Herik-Oudijk, P. Vossebeld, A. Snijders, A. J. Verhoeven, P. J. Capel, J. G. van de Winkel. 1995. Functional association between the human myeloid immunoglobulin A Fc receptor (CD89) and FcR{gamma} chain: molecular basis for CD89/FcR{gamma} chain association. J. Biol. Chem. 270:29781.[Abstract/Free Full Text]
  14. Launay, P., A. Lehuen, T. Kawakami, U. Blank, R. C. Monterio. 1998. IgA receptor (CD89) activation enables coupling Fc to Syk and Btk tyrosine kinase pathways: differential signaling after IFN-{gamma} or phorbol ester stimulation. J. Leukocyte Biol. 63:636.[Abstract]
  15. Albrechtsen, M., G. R. Yeaman, M. A. Kerr. 1988. Characterization of the IgA receptor from human polymorphonuclear leukocytes. Immunology 64:201.[Medline]
  16. Mackenzie, S. J., M. A. Kerr. 1995. IgM monoclonal antibodies recognizing Fc{alpha}R but not Fc{gamma}RIII trigger a respiratory burst in neutrophils although both trigger an increase in intracellular calcium levels and degranulation. Biochem. J. 306:519.
  17. Morton, H. C., M. van Egmond, J. G. J. van de Winkel. 1996. Structure and function of human IgA Fc receptors Fc{alpha}R. Crit. Rev. Immunol. 16:423.[Medline]
  18. Patry, C., Y. Sibille, A. Lehuen, R. C. Monteiro. 1996. Identification of Fc{alpha} receptor (CD89) isoforms generated by alternative splicing that are differentially expressed between blood monocytes and alveolar macrophages. J. Immunol. 156:4442.[Abstract]
  19. Pleass, R. J., P. D. Andrews, M. A. Kerr, J. M. Woof. 1996. Alternative splicing of the human IgA Fc receptor (CD89) in neutrophils and eosinophils. Biochem. J. 318:771.
  20. Van Dijk, T. B., M. Bracke, E. Caldenhoven, J. A. Raaijmakers, J. J. Lammers, L. Koenderman, R. P. de Groot. 1996. Cloning and characterization of Fc{alpha}Rb, a novel Fc{alpha} receptor (CD89) isoform expressed in eosinophils and neutrophils. Blood 88:4229.[Abstract/Free Full Text]
  21. Toyabe, S., Y. Kuwano, K. Takeda, M. Uchiyama, T. Abo. 1997. IgA nephropathy-specific expression of the IgA Fc receptors (CD89) on blood phagocytic cells. Clin. Exp. Immunol. 110:226.[Medline]
  22. Fanger, M. W., J. Pugh, G. M. Bernier. 1981. The specificity of receptors for IgA on human peripheral polymorphonuclear cells and monocytes. Cell. Immunol. 60:324.[Medline]
  23. Monteiro, R. C., H. Kubagawa, M. D. Cooper. 1990. Cellular distribution, regulation, and biochemical nature of an Fc{alpha} receptor in humans. J. Exp. Med. 171:597.[Abstract/Free Full Text]
  24. Stewart, W. W., M. A. Kerr. 1990. The specificity of the human neutrophil IgA receptor Fc{alpha}R determined by measurement of chemoluminescence induced by serum or secretory IgA1 or IgA2. Immunology 71:328.[Medline]
  25. Stewart, W. W., R. L. Mazengera, L. Shen, M. A. Kerr. 1994. Unaggregated serum IgA binds to neutrophil Fc{alpha}R at physiological concentrations and is endocytosed but cross-linking is necessary to elicit a respiratory burst. J. Leukocyte Biol. 56:481.[Abstract]
  26. Morton, T. A., D. G. Myska, I. M. Chaiken. 1995. Interpreting complex binding kinetics from optical biosensors: a comparison of analysis by linearization, the integrated rate equation, and numerical integration. Anal. Biochem. 227:176.[Medline]
  27. Moos, M. 1993. Analysis of proteins. In Current Protocols in Molecular Biology. K. Janssen, ed. Greene Pub. Assoc. and John Wiley and Sons, New York, p. 10.2.9.
  28. Easterbrook-Smith, S. B.. 1983. Evidence for histidine residues in the immunoglobulin-binding site of human C1q. Biosci. Rep. 3:134.
  29. Wines, B. D., S. B. Easterbrook-Smith. 1990. Carbodiimide cross-linking of human C1q and rabbit IgG. Mol. Immunol. 3:221.
  30. Mazengera, R. L., M. A. Kerr. 1990. The specificity of the IgA receptor purified from human neutrophils. Biochem. J. 272:159.[Medline]
  31. Kerr, M. A., W. W. Stewart, B. C. Bonner, M. R. Greer, S. J. MacKenzie, M. G. Steele. 1995. The diversity of leukocyte IgA receptors. Contrib. Nephrol. 111:60.[Medline]
  32. Maliszewski, C. R., T. VandenBos, L. Shen, M. A. Schoenborn, H. Kubagawa, M. P. Beckmann, R. C. Monteiro. 1993. Recombinant soluble IgA Fc receptor: generation, biochemical characterization, and functional analysis of the recombinant protein. J. Leukocyte Biol. 53:223.[Abstract]
  33. Vaughn, D. E., P. J. Bjorkman. 1998. Structural basis of pH-dependent antibody binding by the neonatal Fc receptor. Structure 15:63.
  34. Matthews, B. W.. 1993. Structural and genetic analysis of protein stability. Annu. Rev. Biochem. 62:139.[Medline]
  35. Hulett, M. D., P. M. Hogarth. 1994. Molecular basis of Fc receptor function. Adv. Immunol. 57:1.[Medline]
  36. Fan, Q. R., L. Mosyak, C. C. Winter, N. Wagtmann, E. O. Long, D. C. Wiley. 1997. Structure of the inhibitory receptor for human natural killer cells resembles haematopoietic receptors. Nature 389:96.[Medline]
  37. Carayannopoulos, L., J. M. Hexham, J. D. Capra. 1996. Localization of the binding site for the monocyte immunoglobulin IgA-Fc receptor (CD89) to the domain boundary between C{alpha}2 and C{alpha}3 in human IgA1. J. Exp. Med. 183:1579.[Abstract/Free Full Text]
  38. Kilian, M., J. Reinholdt, H. Lomholt, K. Poulsen, E. V. Frandsen. 1996. Biological significance of IgA1 proteases in bacterial colonization and pathogenesis: critical evaluation of experimental evidence. APMIS 104:321.[Medline]
  39. Rajagopalan, S., E. O. Long. 1998. Zinc bound to the killer cell-inhibitory receptor modulates the negative signal in human NK cells. J. Immunol. 161:1299.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
K. Qian, F. Xie, A. W. Gibson, J. C. Edberg, R. P. Kimberly, and J. Wu
Functional expression of IgA receptor Fc{alpha}RI on human platelets
J. Leukoc. Biol., December 1, 2008; 84(6): 1492 - 1500.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Abi-Rached, K. Dorighi, P. J. Norman, M. Yawata, and P. Parham
Episodes of Natural Selection Shaped the Interactions of IgA-Fc with Fc{alpha}RI and Bacterial Decoy Proteins
J. Immunol., June 15, 2007; 178(12): 7943 - 7954.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wu, C. Ji, F. Xie, C. D. Langefeld, K. Qian, A. W. Gibson, J. C. Edberg, and R. P. Kimberly
Fc{alpha}RI (CD89) Alleles Determine the Proinflammatory Potential of Serum IgA
J. Immunol., March 15, 2007; 178(6): 3973 - 3982.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
O. A. Iakoubova, C. H. Tong, A. P. Chokkalingam, C. M. Rowland, T. G. Kirchgessner, J. Z. Louie, L. M. Ploughman, M. S. Sabatine, H. Campos, J. J. Catanese, et al.
Asp92Asn Polymorphism in the Myeloid IgA Fc Receptor Is Associated With Myocardial Infarction in Two Disparate Populations: CARE and WOSCOPS
Arterioscler. Thromb. Vasc. Biol., December 1, 2006; 26(12): 2763 - 2768.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Wines, N. Willoughby, J. D. Fraser, and P. M. Hogarth
A Competitive Mechanism for Staphylococcal Toxin SSL7 Inhibiting the Leukocyte IgA Receptor, Fc{alpha}RI, Is Revealed by SSL7 Binding at the C{alpha}2/C{alpha}3 Interface of IgA
J. Biol. Chem., January 20, 2006; 281(3): 1389 - 1393.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Langley, B. Wines, N. Willoughby, I. Basu, T. Proft, and J. D. Fraser
The Staphylococcal Superantigen-Like Protein 7 Binds IgA and Complement C5 and Inhibits IgA-Fc{alpha}RI Binding and Serum Killing of Bacteria
J. Immunol., March 1, 2005; 174(5): 2926 - 2933.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. C. Morton, R. J. Pleass, J. M. Woof, and P. Brandtzaeg
Characterization of the Ligand Binding Site of the Bovine IgA Fc Receptor (bFc{alpha}R)
J. Biol. Chem., December 24, 2004; 279(52): 54018 - 54022.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Wines, H. M. Trist, R. C. Monteiro, C. van Kooten, and P. M. Hogarth
Fc Receptor {gamma} Chain Residues at the Interface of the Cytoplasmic and Transmembrane Domains Affect Association with Fc{alpha}RI, Surface Expression, and Function
J. Biol. Chem., June 18, 2004; 279(25): 26339 - 26345.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. E. Foster, M. Colonna, and P. D. Sun
Crystal Structure of the Human Natural Killer (NK) Cell Activating Receptor NKp46 Reveals Structural Relationship to Other Leukocyte Receptor Complex Immunoreceptors
J. Biol. Chem., November 14, 2003; 278(46): 46081 - 46086.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ding, G. Xu, M. Yang, M. Yao, G. F. Gao, L. Wang, W. Zhang, and Z. Rao
Crystal Structure of the Ectodomain of Human Fc{alpha}RI
J. Biol. Chem., July 18, 2003; 278(30): 27966 - 27970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. B. van Spriel, J. H. W. Leusen, H. Vile, and J. G. J. van de Winkel
Mac-1 (CD11b/CD18) as Accessory Molecule for Fc{alpha}R (CD89) Binding of IgA
J. Immunol., October 1, 2002; 169(7): 3831 - 3836.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. A. Mackay, M. D. Hulett, J. P. D. Cook, H. M. Trist, A. J. Henry, J. M. McDonnell, A. J. Beavil, R. L. Beavil, B. J. Sutton, P. M. Hogarth, et al.
Mutagenesis Within Human Fc{epsilon}RI{alpha} Differentially Affects Human and Murine IgE Binding
J. Immunol., February 15, 2002; 168(4): 1787 - 1795.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. J. M. van der Boog, G. van Zandbergen, J. W. de Fijter, N. Klar-Mohamad, A. van Seggelen, P. Brandtzaeg, M. R. Daha, and C. van Kooten
Fc{alpha}RI/CD89 Circulates in Human Serum Covalently Linked to IgA in a Polymeric State
J. Immunol., February 1, 2002; 168(3): 1252 - 1258.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. C. Morton, C. J. Howard, A. K. Storset, and P. Brandtzaeg
Identification of Residues within the Extracellular Domain 1 of Bovine Fcgamma 2R Essential for Binding Bovine IgG2
J. Biol. Chem., December 14, 2001; 276(51): 47794 - 47800.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. C. Honorio-França, P. Launay, M. M. S. Carneiro-Sampaio, and R. C. Monteiro
Colostral neutrophils express Fc{alpha} receptors (CD89) lacking {gamma} chain association and mediate noninflammatory properties of secretory IgA
J. Leukoc. Biol., February 1, 2001; 69(2): 289 - 296.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
B. D. Wines, C. T. Sardjono, H. M. Trist, C.-S. Lay, and P. M. Hogarth
The Interaction of Fc{{alpha}}RI with IgA and Its Implications for Ligand Binding by Immunoreceptors of the Leukocyte Receptor Cluster
J. Immunol., February 1, 2001; 166(3): 1781 - 1789.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Geissmann, P. Launay, B. Pasquier, Y. Lepelletier, M. Leborgne, A. Lehuen, N. Brousse, and R. C. Monteiro
A Subset of Human Dendritic Cells Expresses IgA Fc Receptor (CD89), Which Mediates Internalization and Activation Upon Cross-Linking by IgA Complexes
J. Immunol., January 1, 2001; 166(1): 346 - 352.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. D. Wines, M. S. Powell, P. W. H. I. Parren, N. Barnes, and P. M. Hogarth
The IgG Fc Contains Distinct Fc Receptor (FcR) Binding Sites: The Leukocyte Receptors Fc{gamma}RI and Fc{gamma}RIIa Bind to a Region in the Fc Distinct from That Recognized by Neonatal FcR and Protein A
J. Immunol., May 15, 2000; 164(10): 5313 - 5318.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. van Zandbergen, R. Westerhuis, N. K. Mohamad, J. G. J. van de Winkel, M. R. Daha, and C. van Kooten
Crosslinking of the Human Fc Receptor for IgA (Fc{alpha}RI/CD89) Triggers FcR {gamma}-Chain-Dependent Shedding of Soluble CD89
J. Immunol., December 1, 1999; 163(11): 5806 - 5812.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Pleass, J. I. Dunlop, C. M. Anderson, and J. M. Woof
Identification of Residues in the CH2/CH3 Domain Interface of IgA Essential for Interaction with the Human Fcalpha Receptor (Fcalpha R) CD89
J. Biol. Chem., August 13, 1999; 274(33): 23508 - 23514.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Launay, B. Grossetete, M. Arcos-Fajardo, E. Gaudin, S. P. Torres, L. Beaudoin, N. Patey-Mariaud de Serre, A. Lehuen, and R. C. Monteiro
Fc{alpha} Receptor (CD89) Mediates the Development of Immunoglobulin A (IgA) Nephropathy (Berger's Disease): Evidence for Pathogenic Soluble Receptor-IgA Complexes in Patients and CD89 Transgenic Mice
J. Exp. Med., June 6, 1999; 191(11): 1999 - 2010.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Pleass, T. Areschoug, G. Lindahl, and J. M. Woof
Streptococcal IgA-binding Proteins Bind in the Calpha 2-Calpha 3 Interdomain Region and Inhibit Binding of IgA to Human CD89
J. Biol. Chem., March 9, 2001; 276(11): 8197 - 8204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Maenaka, P. A. van der Merwe, D. I. Stuart, E. Y. Jones, and P. Sondermann
The Human Low Affinity Fcgamma Receptors IIa, IIb, and III Bind IgG with Fast Kinetics and Distinct Thermodynamic Properties
J. Biol. Chem., November 21, 2001; 276(48): 44898 - 44904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS