HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Freedman, D. O. Articles by Furtado, A. Search for Related Content PubMed PubMed Citation Articles by Freedman, D. O. Articles by Furtado, A.

Biased TCR Repertoire in Infiltrating Lesional T Cells in Human Bancroftian Filariasis¹

David O. Freedman^2,*, David Adam Plier^*, Adriana de Almeida^*, Janaina Miranda, Cynthia Braga, Maria C. Maia e Silva, Jianming Tang^* and Andre Furtado

^* Division of Geographic Medicine, Department of Medicine, University of Alabama, Birmingham, AL 35294; and Aggeu Magalhães Research Centre, Recife, Pernambuco, Brazil

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
To investigate the hypothesis that T cells recognizing specific Ags localize to the site of disease activity in human bancroftian filariasis, we have compared the repertoire of TCR Vß gene segments in lesions vs blood in individual patients by RT-PCR ELISA. Vß14 and Vß24 were overrepresented (5% greater in tissue compared with PBMCs and/or tissue/PBMC ratios in the highest 5% of all tissue/PBMC ratios for all Vßs for all subjects) in 50% and 40% of study subjects, respectively. Overrepresentation of these two Vßs did not occur in any control subject. In comparing three patient groups, the proportion of individuals meeting at least one criterion for Vß14 overrepresentation was shown to increase in tandem with our current concepts of disease progression (asymptomatic filariasis = 25%; clinical filariasis with active infection = 60%; clinical filariasis without active infection = 71%). In 6 of the 10 individuals with Vß14 overrepresentation, Vß14 represented >20% of the entire lesional Vß repertoire. All but one of the 20 study subjects had at least one Vß gene segment that was overrepresented in tissue compared with PBMCs. Only a small number of Vßs, usually three or less, were overrepresented in any single filariasis patient. However, in the same tissue, no differences between patient groups were found when IFN-, TNF-, IL-4, IL-5, and IL-12 mRNA expression were examined. Taken together, these findings suggest that, in principle, in essentially all patients, whether with subclinical or with clinical filariasis, distinct and limited T cell populations are concentrated in affected tissue.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
More than 120 million people in 76 countries are infected with the lymphatic filarial parasites (1). Infection of the human host occurs when third-stage larvae of the parasite enter the body following the bite of an infected vector mosquito. These infectious larvae mature over a period of months into lymphatic-dwelling adult worms that subsequently release immature larvae called microfilariae into the bloodstream of the host.

Filarial tissue inflammation is currently thought to be substantially more complex than the simple blockade of lymphatic vessels or the circumscribed reaction to dying intralymphatic adult worms (pathological events that are now thought to occur only uncommonly). Early damage to lymphatic vessels is now thought to be noninflammatory in nature (2, 3). Current paradigms on the subsequent evolution of the immunological inflammatory disease occurring in surrounding tissue have been largely extrapolated from studies of circulating PBMCs in infected individuals (4). We have recently begun to study the actual site of disease to investigate relevant compartmental immune mechanisms in individuals infected with Wuchereria bancrofti (5).

The development of chronic, immune-mediated inflammation is dependent upon the infiltration of circulating PBMCs across the endothelial cell lining of postcapillary venules into affected tissues. Filarial lymphedema and elephantiasis are most commonly accompanied by a generalized tissue inflammatory component in which the dominant local lesion is a CD8⁺ T cell pericapillary/perivenular infiltrate and in which the very late Ag-4 (VLA-4)³/VCAM-1 pathway has been implicated (6, 7). A subclinical CD4⁺ infiltrate is also present in the majority of clinically asymptomatic individuals with filariasis. Characterization of the antigenic specificity and of the functionality of these infiltrating T cell populations could serve to enhance understanding of disease pathogenesis.

The nature and function of clonally expanded subsets of T cells within disease lesions has been an important focus of research into the pathogenesis of a number of diseases. The presence of a biased TCR repertoire in lesions compared with blood provides good supporting evidence that some type of Ag selection process occurs locally and indicates recognition of a limited number of Ags. Important results have been obtained from the study of human autoimmune diseases; more recently, study of the lesions of infectious diseases of humans is beginning to be similarly productive (8, 9, 10, 11, 12). Nominal Ag is recognized by T lymphocytes via TCRs in the context of the MHC molecules on APCs. TCRs are heterodimers that are predominantly made up of - and ß-chains (in blood and local lesions); each chain is encoded (like Ig) by rearranged V(D)J gene segments and a C region. Both antigenic specificity and the generation of a diverse TCR repertoire are determined by the selection of T cells bearing specific V, D, and J gene elements. The known human Vß families can be reproducibly amplified by PCR using Vß-specific primers combined with a single Cß region primer (9, 13, 14).

The identification of distinct functional subsets of T cells in the local tissues of humans with infectious disease has resulted largely from the work of Modlin and colleagues (9, 15, 28). Lesions from both leprosy and leishmaniasis patients with localized disease demonstrate a "type 1" cytokine pattern that is exemplified by IFN- and IL-2 production in tissue and by T cell clones derived from the same tissue. In contrast, individuals with disseminated forms of those infections demonstrate an IL-4, IL-5, and IL-10 phenotype that is typical of a "type 2" response (15, 16).

To investigate the hypothesis that T cells recognizing specific Ags localize to the site of disease activity, we have compared the repertoire of TCR Vß gene segments in infiltrating lesional T cells vs blood in individual patients. At the same time, we have examined the tissue levels of cytokine mRNA from biopsies in these patients. For comparison, the patients were grouped into three categories based on clinical and current infection status according to a previously defined framework. Finding Vß gene segment families that are overrepresented in infiltrating lesional T cells compared with blood may delineate which Ag-reactive populations are important in the pathogenesis of the filarial inflammatory lesion.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Study population

Standardized histories were obtained and physical examinations were performed on 48 study participants residing in neighboring communities of metropolitan Recife, Brazil, where W. bancrofti is endemic (17, 18). Subjects were classified into three discrete groups based on their infection and clinical status, as described previously (19): asymptomatic infected individuals (Dis^-CAg⁺), that is, those individuals who had no current or previous history of adenolymphangitis, erysipelas, cellulitis, or limb swelling; individuals with overt clinical filariasis and active infection (Dis⁺CAg⁺), that is, individuals who had a spectrum of clinical manifestations ranging from acute adenolymphangitis to chronic lymphedema or elephantiasis and who were currently infected as determined by circulating adult parasite Ag (CAg) in serum (TropBio, Townsville, Australia); and individuals with overt clinical filariasis without active infection (Dis⁺CAg^-), that is, individuals with the same clinical manifestations as the previous group but who were CAg^-. Study patients were otherwise free of any intercurrent illness and had received no diethylcarbamazine therapy within the previous 5 years. Every patient received standard diethylcarbamazine treatment after the study. Due to limitations in the ability to obtain patient specimens, not every experiment was performed on every patient. Of the 48 study subjects, tissue and blood were examined for TCR Vß repertoire in 20 patients and for cytokine mRNA in 45 patients.

Skin specimens

The 5-mm punch biopsies of the skin and the underlying dermal lymphatic vessels were obtained from the medial aspect of the calf of individuals in the three patient groups described above and of four healthy North American controls. Previously reported immunocytochemical studies of skin biopsies from a similar cohort of patients from the same endemic area have shown abnormally dilated lymphatic vessels with a perivascular CD3⁺ infiltrate in tissue, regardless of patient classification (7). Tissue was fixed in OCT compound (Miles Laboratories, Elkhart, IN) and snap-frozen in liquid nitrogen within 2 min of being obtained. The 50–100 8-µm sections from each skin biopsy were treated with RNAzol B (Tel-Test, Friendsworth, TX), and RNA was extracted with chloroform, precipitated with isopropanol, and reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) as described previously (20), for the analysis of the TCR Vß gene segment repertoire and cytokine expression by PCR. For those tissue samples for which only limited amounts of RNA could be extracted, samples were randomly selected for an analysis of either TCR Vß gene repertoire or cytokine expression.

Isolation and stimulation of PBMCs

PBMCs were isolated by Ficoll-diatrizoate gradient centrifugation and cultured for 72 h in the presence or absence of adult filarial Ag as described previously (19). RNA extraction of cultured as well as uncultured and unstimulated PBMCs was performed by the RNAzol B method as described above.

PCR amplification of cytokine mRNA from tissue

mRNA transcripts for the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT), CD4, and the cytokines IFN-, TNF-, IL-4, IL-5, and IL-12 were measured by RT-PCR essentially as described previously (20). Briefly, 200 ng of reverse-transcribed total RNA was used for the specific amplification of HPRT or a particular cytokine using Taq DNA polymerase (Promega, Madison, WI). The primers used have been described previously (21, 22), and 35 cycles were used in each experiment. All samples included in the experiments were positive for CD4 by PCR, indicating the presence of T cell infiltrate in the biopsies. mRNA for HPRT, IFN-, IL-4, and IL-5 was visualized by the ELISA method as described below; due to the lack of appropriate probes for a visualization of products by ELISA, mRNA for TNF- and IL-12 was visualized on a 1.8% agarose gel.

PCR amplification of TCR Vß mRNA

TCR Vß mRNA amplification was performed using 28 oligonucleotide primers (13, 14), slightly modified as denoted below, that were specific for individual Vß gene segment families or family members combined with a consensus Cß primer recognizing sequences conserved between the Cß1 and Cß2 genes (14). The consistency and reproducibility of this approach using this primer set in providing a meaningful estimate of the Vß repertoire has been established (9). PCR reactions contained 0.2 mM of deoxynucleoside triphosphate, 1x PCR buffer (50 mM KCl, 10 mM Tris-HCl (pH 9.0 at 25°C), and 0.1% Triton X-100), 2.5 U of Taq DNA polymerase (Promega), and 0.2 µM each of one 5' Vß primer and the biotinylated 3' Cß primer, all in a final volume of 50 µl. The 5' Vß and 3' Cß primers were as follows (5'-3'): Vß1, GGGGTCGACGCACAACAGTTCCCTGACTTGCAC; Vß2, GGGGTCGACTCATCAACCATGCAAGCCTGACCT; Vß3, GGGGTCGACGTCTCTAGAGAGAAGAAGGAGCGC; Vß4, GGGGTCGACACATATGAGAGTGGATTTGTCATT; Vß5.1, GGGGTCGACATACTTCAGTGAGACACAGAGAAAC; Vß5.2/3, GGGGTCGACTTCCCTAACTATAGCTCTGAGCTG; Vß6.1/2/3, GGGGTCGACAGGCCTGAGGGATCCGTCTC; Vß6.5/8/9, GAGAGGCCTAAGGGATCTTTCTCCAC; Vß6.6/7, GACAGGACTGGGGGATCCGTCTCCAC; Vß7, GGGGTCGACCCTGAATGCCCCAACAGCTCTC; Vß8, GGGGTCGACATTTACTTTAACAACAACGTTCCG; Vß9, GGGGTCGACCCTAAATCTCCAGACAAAGCTCAC; Vß10, GGGGTCGACCTCCAAAAACTCATCCTGTACCTT; Vß11, GGGGTCGACTCAACAGTCTCCAGAATAAGGACG; Vß12, GGGGTCGACAAAGGAGAAGTCTCAGAT; Vß13.1, GGGGTCGACCAAGGAGAAGTCCCCAATGGC; Vß13.2, GGGGTCGACGGTGAGGGTACAACTGCCAAA; Vß14, GGGGTCGACGTCTCTCGAAAAGAGAAGAGGAAT; Vß15, GGGGTCGACAGTGTCTCTCGACAGGCACAGGCT; Vß16, GGGGTCGACAAAGAGTCTAAACAGGATGAGTCC; Vß17, GGGGTCGACCAGATAGTAAATGACTTTCAG; Vß18, GGGGTCGACGATGAGTCAGGAATGCCAAAGGAA; Vß19, GGGGTCGACCAGATAGTAAATGACTTTCAG; Vß20, GGGGTCGACAGCTCTGAGGTGCCCCAGAATCTC; Vß21, GGGGCGTCGACCTGCAGAACTTGGGAC; Vß22, GGGGTCGTCGACTTTGAACCATAACGTC; Vß23, GGGGGTCGACAAATCTTGGGGGCAGAAAGTCG; Vß24, CAGCAGAAGTCGACTCAGGCCCCAAAGC; and Cß, GGGAAGCTTCTGATGGCTCAAACACAG. cDNA equivalent to 10 ng of reverse-transcribed RNA from PBMCs and 50 ng of reverse-transcribed RNA from skin biopsies was amplified by PCR. Only samples testing positively for the presence of Cß mRNA by PCR were used. PCR was performed for 30 s at 94°C for denaturation and for 1 min at 65°C for annealing/extension for 35 cycles, with the 65°C temperature segment lengthened by 2 s per cycle to assure complete chain extension of the amplified product.

ELISA-based quantitation of PCR products

PCR ELISA was performed as described previously (23). Biotinylation of the antisense primer alone in the TCR Vß and cytokine RT-PCRs yielded amplification products that were then bound to streptavidin (New England Biolabs, Beverly, MA)-coated microtiter plates (Dynatech, Chantilly, VA). The unbiotinylated sense strand was then removed by denaturation with 1 N NaOH. A fluorescein-labeled oligonucleotide probe (sense strand) was hybridized to the single plate-bound DNA strand under stringent conditions (42°C; 20x sodium-sodium phosphate EDTA (SSPE) (where 1x SSPE = 150 mM NaCl, 10 mM NaH₂PO₄, and 1 mM EDTA (pH 7.4)), 0.02% SDS, 1x Denhardt’s solution, and 0.1% N-lauryl sarcosine; 15 min). Two probes specific for Cß1 (5'-GAAAAACGTGTTCCCACCCGAGGTCGCCC-3') and Cß2 (5'-GAACAAGGTGTTCCCACCCGAGGTCGCCC-3') were used to detect TCR Vß RT-PCR products (14). For cytokine RT-PCR products, probe sequences were exactly as described previously (24). After stringency washes (42°C; 1x SSPE, 0.1% SDS; 10 min), an anti-fluorescein-alkaline phosphatase-conjugated Fab fragment (Boehringer Mannheim, Indianapolis, IN) was added; after washes with Tris-buffered saline/Tween (25 mM Tris (pH 7.5), 75 mM NaCl, and 0.05% Tween 20), DNA-probe-Ab complexes were quantitated using a substrate amplification system (ImmunoSelect ELISA Amplification System, Life Technologies), with OD read at 495 nm.

The 28 TCR Vß mRNA RT-PCR products from each patient sample tested were run in triplicate wells on one ELISA plate, and average OD values were obtained for each Vß gene family. The OD measured for each Vß gene family was divided by the total OD measured in the repertoire of Vß genes surveyed and expressed as the percentage of the total Vß repertoire. To ensure that all sample ODs fell in the linear range of the system, the same positive and negative control samples were run in every experiment. Initially, serial dilutions of cDNA (from 1 µg of reverse-transcribed RNA from random donor PBMCs) were amplified for the 28 Vßs by PCR, and an ELISA was performed as above. Dilutions corresponding to the top and the bottom of the linear range of the ELISA were then used as the positive and negative controls, respectively. Samples for which any Vß was greater than the positive control were rerun after appropriate dilution. The RT-PCR ELISA methodology has been validated by others (25) and was verified in our study by repeating a complete Vß analysis with aliquots of mRNA from both tissue and blood from the same patient three times. The mean SE in the three replicates for all 28 Vßs was 16.7%.

Vß gene families in skin that were >5% of the total Vß repertoire and >5% higher compared with PBMCs from the same patient were classified as overrepresented (9, 26, 27). In addition, the percentage of the total Vß repertoire for each Vß gene family in tissue was divided by the percentage of the total Vß repertoire of the same Vß family in PBMCs and expressed as the tissue/PBMC ratio (28, 29). Vß gene families with a tissue/PBMC ratio in the highest 5% of all the tissue/PBMC ratios for all of the Vßs for all of the patients studied were also classified as overrepresented.

For HPRT, IFN-, IL-4, and IL-5, the PCR products from each patient sample were also run in triplicate wells on one ELISA plate; results were expressed as a ratio of the OD measured for each cytokine to the OD measured for the HPRT gene (19).

HLA-DR molecular typing

Class II HLA-DRB1 allele assignments were made by automated sequencing using the autoload solid phase sequencing kit in the ALFexpress DNA sequencer (Amersham-Pharmacia Biotech, Piscataway, NJ). Exon 3 of DRB1 was amplified by PCR with eight group-specific 5' primers and one biotinylated general 3' primer. The 260-bp products were absorbed onto streptavidin-coated 4-tooth combs, followed by sequencing with a Cy5-labeled internal 5' primer. The sequencing products were eluted from combs at 55°C and resolved through 6% long-ranger gel prepared in 1x TBE buffer (8.9 mM Tris, 8.9 mM boric acid, and 0.2 mM EDTA) and 6 M urea. Alleles were assigned using the HLA SequiTyper software package (Amersham-Pharmacia Biotech). Samples with ambiguous allele combinations were resequenced using PCR products generated from individual group-specific primers.

Statistical analysis

The Mann-Whitney U test was used to compare differences in the ratio of cytokine mRNA expression to HPRT among the patient groups and was also used to compare differences between the patient groups in the number of overrepresented Vßs per patient. The Wilcoxon signed-rank test was used to compare differences between tissue and PBMCs in the mean percentage of the total Vß repertoire for each Vß gene family.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Study population

As in our previous studies in this endemic area, individuals were segregated into three groups: 1) asymptomatic filariasis (Dis^-CAg⁺) (n = 21; 8 female, 13 male; 14 microfilaremic); clinical filariasis with active infection (Dis⁺CAg⁺) (n = 11; 1 female, 10 male; 6 microfilaremic); and 3) clinical filariasis without active infection (Dis⁺CAg^-) (n = 16; 12 female, 4 male). As reported previously for this area of Brazil (30), and representing what is thought to be the natural history of a chronic progressive disease, Dis⁺CAg^- individuals were significantly older (with a median age of 40.5 years) than Dis^-CAg⁺ or Dis⁺CAg⁺ individuals (median ages of 25 and 27 years, respectively). Dis⁺CAg⁺ individuals had statistically indistinguishable levels of circulating Ag compared with Dis^-CAg⁺ individuals.

TCR Vß bias of lesional T cells compared with PBMCs

To investigate whether T cell populations with biased antigenic specificities are overrepresented in tissue-infiltrating T cells in lymphatic filariasis, we determined the TCR Vß gene repertoire in tissue biopsies. The biopsies used sample the superficial lymphatic vessels and the accompanying perivascular infiltrate in filariasis patients that have been shown to consist of predominantly CD8⁺ cells. Established RT-PCR techniques adapted to ELISA-based detection methodology (23, 25) were used to compare the relative expression of 28 Vß gene segment families or family members in infiltrating lesional T cells with that of PBMCs from the same individual.

To look for significant differences in Vß gene usage between tissue and PBMCs, the mean percentage of the total Vß repertoire for each Vß gene family in tissue was compared with the mean percentage in PBMCs for each patient or control group. Among the normal controls, the comparative gene expression between tissue and PBMCs for each of the 28 individual Vß families (Fig. 1A) was not found to be significantly different in any instance. However, in the Dis⁺CAg^- group (Fig. 1B), the mean expression of Vß24 was significantly greater in tissue compared with PBMCs (6.7% ± 1.4% vs 2.8% ± 0.6%; p = 0.03). In this patient group, Vß14 also showed a markedly increased expression in tissue compared with PBMCs (13.5% ± 3.0% vs 5.0% ± 1.1%; p = 0.06), but this Vß14 increase did not reach statistical significance. Similarly, when all CAg⁺ individuals were examined (the Dis⁺CAg⁺ and Dis^- groups taken together; Fig. 1C), the mean expression of Vß24 was significantly greater in tissue compared with PBMCs (5.6% ± 1.4% vs 2.6% ± 0.4%; p = 0.05); however, the apparent difference in Vß14 (13.5% ± 3.5% vs 4.6% ± 0.6%; p = 0.08) did not reach statistical significance.

View larger version (25K): [in this window] [in a new window]   FIGURE 1. Comparison of the mean percentage of utilization of the total Vß repertoire for each Vß gene family for each patient group in tissue compared with PBMCs. Each bar represents the group mean for the number of patients shown in each panel; error bars indicate the SE. *, statistical significance at p < 0.05.

View larger version (14K): [in this window] [in a new window]   FIGURE 2. Amplification by RT-PCR of the Vß gene segment families in tissue compared with PBMCs from a representative patient. A, Percentage of repertoire represents the OD measured for each Vß gene family amplification divided by the sum of the total OD present in all the Vß genes in the repertoire surveyed and expressed as the percentage of the total Vß repertoire. Arrows indicate overrepresented Vß families for which the percentage of the repertoire in tissue represents >5% of the total TCR Vß repertoire and was >5% higher compared with PBMCs from the same patient. B, Tissue/PBMC ratio represents the percentage of the total repertoire for each Vß gene family in tissue divided by the percentage of the total repertoire of the same Vß family in PBMCs from the same patient. Arrows indicate overrepresented Vß families with tissue/PBMC ratios of >4.3 (highest 5% of all ratios).

View larger version (74K): [in this window] [in a new window]   FIGURE 3. Number of subjects in each patient group with the corresponding number of TCR Vß genes meeting the criteria for overrepresentation, either separately (A and B) or in aggregate (C). The criteria for overrepresentation are as follows: A, 5% greater in tissue compared with PBMCs; B, tissue/PBMC ratio in the highest 5% of all tissue/PBMC ratios for all Vßs for all subjects.

Because TCR V region gene usage is correlated with HLA type, DRB1 alleles in individuals with Vß14 and Vß24 expansions were compared with alleles in individuals without Vß overexpression (Table II). Statistically significant correlations of even these relatively limited TCR usage patterns with HLA types would require much larger numbers of patients than we were able to study. Nevertheless, it is interesting that 57.1% of Vß14⁺ individuals vs 20.0% of Vß14^- individuals and 50.0% of Vß24⁺ individuals vs 20.0% of Vß24^- individuals had the DRB1*13 allele.

To determine whether there were differences in cytokine production by infiltrating T cells in tissue from the three patient groups as well as from controls, tissue was tested for IFN-, TNF-, IL-4, IL-5, and IL-12 mRNA expression. The results for IFN-, IL-4 and IL-5, are shown in Fig. 4 as a ratio of the cytokine OD value to its corresponding HPRT OD value. Dis⁺CAg⁺ individuals had significantly less expression of IFN- in tissue compared with Dis⁺CAg^- individuals (p < 0.01) or with Dis^-CAg⁺ individuals (p < 0.01) (Fig. 4A). However, there were no significant differences in tissue levels of IFN- expression between any of the patient groups compared with the normal controls. Moreover, there were no differences in levels of IL-4 or IL-5 expression among the patient groups or when each group of patients was compared with the normal controls (Fig. 4, B and C). A total of three to four skin biopsies in every patient group were tested for TNF-; all were positive, with the exception of one in the asymptomatic microfilaremic group, and there were no differences among the groups (data not shown). In contrast, every tissue tested for IL-12 expression was negative (data not shown).

View larger version (22K): [in this window] [in a new window]   FIGURE 4. Ratio of IFN- (A), IL-4 (B), and IL-5 (C) OD values to the HPRT OD values obtained from skin biopsy samples of Dis-CAg+ individuals, Dis+CAg+ individuals, Dis+CAg- individuals, and normal controls (NC) by the PCR ELISA method. Box plots display the 25th, 50th, and 75th percentiles of the cytokine/HPRT ratios. Individual circles on the shaded area denote individual patients from every group for which there was no cytokine detection. **, p < 0.01, when compared with the Dis-CAg+ or the Dis+CAg- groups.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Current concepts on the immunopathogenesis of filarial disease derive predominantly from the extrapolation of studies of circulating PBMCs in infected individuals. Despite considerable work, discrete pathogenic Ags or epitopes with pronounced T cell stimulatory activity have not been identified. The actual site of disease provides a more direct opportunity to investigate relevant immune mechanisms. In studies of affected tissue, we have shown previously that the dominant local lesion is a CD8⁺ T cell pericapillary/perivenular infiltrate, and one in which the VLA-4/VCAM-1 pathway has been implicated. A subclinical CD4⁺ infiltrate is also present in the majority of clinically asymptomatic individuals with filariasis.

Recently, the nature and function of clonally expanded subsets of T cells within disease lesions has been an important focus of research into the pathogenesis of diseases that are thought to be immune-mediated. The presence of a biased TCR repertoire in lesions compared with peripheral blood provides good supporting evidence that some type of Ag selection process occurs locally and indicates recognition of a limited number of Ags. Important results have come from the study of human autoimmune diseases like rheumatoid arthritis, Lyme arthritis, and multiple sclerosis. Study of the lesions of infectious diseases of humans are beginning to be similarly productive. In Mycobacterium leprae-infected patients, T cells using the Vß6-, Vß12-, Vß14-, and Vß19-encoded TCRs are strikingly overrepresented in lesions as compared with blood (10). Similarly, Vß3, Vß6, and Vß7 were dominant in the lesions of 50% of patients with Leishmania braziliensis infection (9). This magnitude of TCR bias is clearly an important indicator of a role for a small number of discrete Ags, given the outbred nature of human populations and the likely heterogeneity in disease manifestations in broadly categorized clinical groups of patients. To our knowledge, the possible presence of a TCR repertoire bias has not been examined in the local lesions of any of the human helminthic infections.

Recently, in a small in vitro study, filaria Ag-stimulated PBMCs from four individuals with brugian filariasis demonstrated selective usage of several defined Vß genes (including Vß9 in three of four individuals) in comparison with unstimulated PBMCs from the same patients (31). However, this study was limited to peripheral blood responses only and to individuals infected with Brugia malayi, a related but much less common filarial parasite of humans. Ags recognized by PBMCs may relate more to protective immune responses than to those relevant to inflammation in local tissues. To test the hypothesis that T cells recognizing specific Ags localize to the site of disease activity in filariasis, we have compared the repertoire of TCR Vß gene segments in lesions vs blood in individual patients and controls. At the same time, we have examined the tissue levels of cytokine mRNA from biopsies in these patients to further investigate relevant compartmental immune mechanisms in individuals infected with W. bancrofti.

The ability to measure circulating filarial Ag in patient serum has advanced the ability to study the immunopathogenesis of lymphatic filariasis by improving the precision of patient classification. In studying peripheral immune responses in filariasis, cytokine responses, especially IFN-, appear to segregate according to the presence of CAg rather than according to the results of a clinical examination looking for the presence or absence of overt chronic pathology. Thus, a patient classification that accounts for both clinical status and CAg status seems most workable. In the present study examining local immune mechanisms, the same approach to patient classification was adopted. Study subjects have been classified into three groups based on both clinical and current infection status (see Ref. 5 for a detailed discussion of this model).

Our results support the concept that, as in other infectious diseases that have been studied in this manner, the recognition of limited numbers of specific filarial Ags is related to disease pathogenesis. Two Vß gene families, Vß14 and Vß24, were overrepresented to varying degrees in each of the patient groups studied. The bias toward these two Vß families is supported by several analytical approaches. We initially examined patient group means for each Vß gene family. The preferential usage of Vß14 and Vß24 was shown when the mean percentage of the total Vß repertoire for each Vß gene family in tissue was compared with the mean percentage in PBMCs for each patient or control group. This finding was dissected further on a patient-by-patient basis within each study group using two different established statistical comparisons of the Vß repertoire. The first criterion for delineating an overrepresented Vß family was defined as the percentage of the repertoire in tissue representing >5% of the total TCR Vß repertoire and being >5% higher compared with PBMCs from the same patient. The second criteria required overrepresented Vß families to have tissue/PBMC ratios of >4.3 (highest 5% of all ratios). The numerical cutoffs used in establishing each of these criteria for the present study were as strict or stricter than the cutoffs applied by others employing these analytical approaches (9, 26, 27, 28, 29).

Overall, when all filariasis patients in all three groups were aggregated together, Vß14 and Vß24 were overrepresented (met one or both of the overrepresentation criteria) in 50% and 40% of study subjects, respectively (Table I). In comparing the three patient groups, the proportion of individuals meeting at least one criterion for Vß14 overrepresentation was shown to increase in tandem with our current concepts of disease progression (Dis^-CAg⁺ = 25%; Dis⁺CAg⁺ = 60%; Dis⁺CAg^- = 71%). In 6 of 10 individuals with Vß14 overrepresentation, Vß14 represented >20% of the entire lesional Vß repertoire. Also of importance was the finding that all but 1 of the 20 study subjects had at least one Vß gene segment, even if not Vß14 or Vß24, that was overrepresented in tissue compared with PBMCs. At the same time, only a small number of Vßs, usually three or less, were overrepresented in any single filariasis patient (Fig. 3).

In contrast to the findings in the filariasis patients, TCR overexpression in tissue compared with PBMCs was found in one of four individuals among our normal nonendemic controls (for Vß6.1 and Vß6.6). In general, the literature reporting TCR Vß usage in normal control skin shows widely varying results, which is most likely reflective of differing skin microenvironmental exposures in genetically different individuals living with differing exposures. For example, three different studies report an overexpression of Vß-2, -4, -5, -6, -8, -12, and -21 (32); Vß-6.1, -6.5, -6.6, and -13.1 (26); and Vß-7, -14, and -16 (29) in normal skin of half or more of the individuals studied. For the most part, these studies used less rigid criteria to define overexpression than did our investigation.

Taken together, these findings suggest that, in principle, distinct and limited T cell populations are concentrated in affected tissue in essentially all patients, regardless of whether such patients have subclinical or clinical filariasis. This observation builds on earlier work by us and others indicating that infection and disease progression might be thought of as a continuum that partially straddles attempts to classify patients into rigid groups. Essentially, the concept is that all infected individuals have some disease, whether it is clinically manifest or not. A proportion of clinically asymptomatic infected individuals (the Dis^-CAg⁺ group) have both significant underlying damage to lymph vessel anatomy/function, as demonstrated by lymphoscintigraphy, as well as an ongoing CD3⁺CD4⁺ perivascular infiltrate in tissue, as demonstrated by immunohistology. That some of these individuals have a lesional TCR Vß bias overlapping with that of individuals with clinically apparent disease supports the concept of incipient progression to the next stage along the disease continuum.

We were not able to obtain tissue from endemic Brazilian controls of similar socioeconomic status living outside of the filaria transmission area. Consequently, we must acknowledge the possibility that our findings may not relate to filarial infection per se but may instead be the result of other skin infections (bacterial, fungal) superimposed upon underlying filarial processes. However, we think this unlikely in this patient population in Brazil. Detailed histological examinations of biopsies from a spectrum of patients from this endemic area are consistent with immunological rather than infectious infiltrates (5, 7, 33). Upon clinical examination, no patient in the present study had any evidence of an ongoing infectious process or break in skin integrity that could serve as a portal of entry for an infectious agent.

To determine if there was any correlation between the lesional T cell infiltrate and the pattern of cytokine expression at the site of disease, RT-PCR for IFN-, TNF-, IL-4, IL-5, and IL-12 was performed in skin tissue from patients in the three study groups. Tissue from 85% of the patients, regardless of infection status, expressed both IFN- and TNF-. These cytokines are proinflammatory by definition and are also implicated in the activation of adhesion molecules such as ICAM-1 and VCAM-1 (16). The VLA-4/VCAM-1 pathway has been shown to play a role in the tissue inflammation associated with filarial disease (6). The presence of IFN- in skin from filarial patients suggests that inflammatory reactions may occur in the early stages of infection, when clinical disease is not apparent. One can speculate that this early inflammation is non-Ag-specific in nature, because it has been shown that the presence of circulating filarial Ag in serum is associated with the absence of Ag-specific IFN- in peripheral blood (19, 34). Alternatively, the relationship of local IFN- expression to the presence of filariasis is unclear. There were no significant differences in tissue levels of IFN- expression between any of the patient groups compared with the normal controls. To a great extent, the microbial flora of the normal skin microenvironment determines the local cytokine milieu; insults to the skin environment barrier in individuals, regardless of whether or not they have filariasis, are common.

Little IL-4 was found in any tissue examined, and only low levels of IL-5 were found in 50% of the samples. IL-4 mRNA expression did not correlate with the levels of IL-4 that were constantly present in supernatants from Ag-stimulated PBMC cultures in every patient. One explanation may be that the interaction between filarial Ags and APCs in tissue is not as intense as in the case of intracellular parasites; the moderate numbers of T cells recruited to the site of disease may not be active producers of type 2 cytokines. It is possible that a cytokine or soluble mediator other than those studied here may be responsible for the local inflammatory response in human lymphatic filariasis.

In summary, we have found that in individuals with filariasis, whether subclinical or with clinical manifestations, distinct and limited T cell populations are concentrated in affected tissue. Two Vß gene families in particular, Vß14 and Vß24, are overrepresented in tissue compared with peripheral blood in 50% and 40% of patients, respectively. The predominance of Vß14 overrepresentation in tissue appears to increase in tandem with our current concepts of disease progression. Further analysis and sequencing of the implicated Vß genes could lead to an increased understanding of discrete target Ags that would be relevant to the immunopathogenesis of filarial disease.

	Acknowledgments

	Footnotes

 
¹ This work was supported by Grant AI-31552 from the National Institute of Allergy and Infectious Diseases (Bethesda, MD).

² Address correspondence and reprint requests to Dr. David O. Freedman, Division of Geographic Medicine, University of Alabama, 845 19th Street S, Room 544, Box 7, Birmingham, AL 35294-2170. E-mail address:

³ Abbreviations used in this paper: VLA, very late Ag; CAg, circulating adult parasite Ag; Dis^-CAg⁺, asymptomatic infected individuals; Dis⁺CAg⁺, individuals with overt clinical filariasis and active infection; Dis⁺CAg^-, individuals with overt clinical filariasis without active infection; HPRT, hypoxanthine-guanine phosphoribosyltransferase; SSPE, sodium-sodium phosphate-EDTA.

Received for publication June 16, 1998. Accepted for publication October 13, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Michael, E., D. A. P. Bundy, B. T. Grenfell. 1996. Re-assessing the global prevalence and distribution of lymphatic filariasis. Parasitology 112:409.
2. Noroes, J., D. Addiss, A. Santos, Z. Medeiros, A. Coutinho, G. Dreyer. 1996. Ultrasonographic evidence of abnormal lymphatic vessels in young men with adult Wuchereria bancrofti infection in the scrotal area. J. Urol. 156:409.[Medline]
3. Case, T. C., M. H. Witte, D. L. Way, C. L. Witte, C. A. Crandall, R. B. Crandall. 1992. Videomicroscopy of intralymphatic-dwelling Brugia malayi. Ann. Trop. Med. Parasitol. 86:435.[Medline]
4. Maizels, R. M., E. Sartono, A. Kurniawan, F. Partono, M. E. Selkirk, M. Yazdanbakhsh. 1995. T-cell activation and the balance of antibody isotypes in human lymphatic filariasis. Parasitol. Today 11:50.[Medline]
5. Freedman, D. O.. 1998. Immune dynamics in the pathogenesis of human lymphatic filariasis. Parasitol. Today 14:229.
6. Freedman, D. O., S. Parker-Cook, M. C. Maia e Silva, C. Braga, A. Maciel. 1996. Very late antigen-4/VCAM-1 (VLA-4/VCAM-1) pathway is involved in the transendothelial migration of lymphocytes in bancroftian filariasis. J. Immunol. 156:2901.[Abstract]
7. Freedman, D. O., T. D. Horn, C. M. E. Silva, C. Braga, A. Maciel. 1995. Predominant CD8⁺ infiltrate in limb biopsies of individuals with filarial lymphedema and elephantiasis. Am. J. Trop. Med. Hyg. 53:633.
8. Roessner, K., H. Trivedi, L. Gaur, D. Howard, J. Aversa, S. M. Cooper, L. H. Sigal, R. C. Budd. 1998. Biased T-cell antigen receptor repertoire in Lyme arthritis. Infect. Immun. 66:1092.[Abstract/Free Full Text]
9. Uyemura, K., C. Pirmez, P. A. Sieling, K. Kiene, M. Paes-Oliveira, R. L. Modlin. 1993. CD4⁺ type 1 and CD8⁺ type 2 T cell subsets in human leishmaniasis have distinct TCR repertoires. J. Immunol. 151:7095.[Abstract]
10. Uyemura, K., J. D. Ohmen, C. L. Grisso, P. A. Sieling, R. Wyzykowski, D. M. Reisinger, T. H. Rea, R. L. Modlin. 1992. Limited T-cell receptor ß-chain diversity of a T-helper cell type 1-like response to Mycobacterium leprae. Infect. Immun. 60:4542.[Abstract/Free Full Text]
11. Olive, C.. 1995. T cell receptor usage in autoimmune disease. Immunol. Cell Biol. 73:297.[Medline]
12. Islam, D., B. Wretlind, A. A. Lindberg, B. Christensson. 1996. Changes in the peripheral blood T-cell receptor Vß repertoire in vivo and in vitro during shigellosis. Infect. Immun. 64:1391.[Abstract]
13. Choi, Y., J. A. Lafferty, J. R. Clements, J. K. Todd, E. W. Gelfand, J. Kappler, P. Marrack, B. L. Kotzin. 1990. Selective expansion of T cells expressing Vß2 in toxic shock syndrome. J. Exp. Med. 172:981.[Abstract/Free Full Text]
14. DerSimonian, H., H. Band, M. B. Brenner. 1991. Increased frequency of T cell receptor V 12.1 expression on CD8⁺ T cells: evidence that V participates in shaping the peripheral T cell repertoire. [Published erratum appears in 1991 J. Exp. Med. 174:1286.]. J. Exp. Med. 174:639.[Abstract/Free Full Text]
15. Pirmez, C., M. Yamamura, K. Uyemura, M. Paes-Oliveira, F. Conceicao-Silva, R. L. Modlin. 1993. Cytokine patterns in the pathogenesis of human leishmaniasis. J. Clin. Invest. 91:1390.
16. Uyemura, K., M. Yamamura, D. F. Fivenson, R. L. Modlin, B. J. Nickoloff. 1993. The cytokine network in lesional and lesion-free psoriatic skin is characterized by a T-helper type 1 cell-mediated response. J. Invest. Dermatol. 101:701.[Medline]
17. Freedman, D. O., A. de Almeida, J. Miranda, D. A. Plier, C. Braga. 1997. Field trial of a rapid card test for Wuchereria bancrofti. Lancet 350:1675.[Medline]
18. Albuquerque, M. F. M., M. C. Marzochi, P. C. Sabroza, M. C. Braga, T. Padilha, M. C. Silva, M. R. Silva, H. C. Schindler, M.A. Maciel, W. Souza, et al 1995. Bancroftian filariasis in two urban areas of Recife, Brazil: pre-control observations on infection and disease. Trans. R. Soc. Trop. Med. Hyg. 89:373.[Medline]
19. de Almeida, A. B., M. C. Maia e Silva, M. A. Maciel, D. O. Freedman. 1996. The presence or absence of active infection, not clinical status, is most closely associated with cytokine responses in lymphatic filariasis. J. Infect. Dis. 173:1453.[Medline]
20. Wynn, T. A., I. Eltoum, A. W. Cheever, F. A. Lewis, W. C. Gause, A. Sher. 1993. Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni. J. Immunol. 151:1430.[Abstract]
21. Wynn, T. A., I. Eltoum, I. P. Oswald, A. W. Cheever, A. Sher. 1994. Endogenous interleukin 12 (IL-12) regulates granuloma formation induced by eggs of Schistosoma mansoni, and exogenous IL-12 both inhibits and prophylactically immunizes against egg pathology. J. Exp. Med. 179:1551.[Abstract/Free Full Text]
22. Karp, C. L., S. H. el-Safi, T. A. Wynn, M. M. Satti, A. M. Kordofani, F. A. Hashim, M. Hag-Ali, F. A. Neva, T. B. Nutman, D. L. Sacks. 1993. In vivo cytokine profiles in patients with kala-azar: marked elevation of both interleukin-10 and interferon-. J. Clin. Invest. 91:1644.
23. Nutman, T. B., P. A. Zimmerman, J. Kubofcik, D. D. Kostyu. 1994. A universally applicable diagnostic approach to filarial and other infections. Parasitol. Today 10:239.
24. Yamamura, M., X. H. Wang, J. D. Ohmen, K. Uyemura, T. H. Rea, B. R. Bloom, R. L. Modlin. 1992. Cytokine patterns of immunologically mediated tissue damage. J. Immunol. 149:1470.[Abstract]
25. Hall, L. L., G. R. Bicknell, L. Primrose, J. H. Pringle, J. A. Shaw, P. N. Furness. 1998. Reproducibility in the quantification of mRNA levels by RT-PCR-ELISA and RT competitive-PCR-ELISA. Biotechniques 24:652.[Medline]
26. Ohmen, J. D., R. L. Moy, D. Zovich, A. Lieberman, R. J. Wyzykowski, L. Sullivan, R. L. Modlin, K. Uyemura. 1994. Selective accumulation of T cells according to T-cell receptor Vß gene usage in skin cancer. J. Invest. Dermatol. 103:751.[Medline]
27. Yamazaki, K., T. Nakajima, E. Gemmell, M. Kjeldsen, G. J. Seymour, K. Hara. 1996. Biased expression of T cell receptor Vß genes in periodontitis patients. Clin. Exp. Immunol. 106:329.[Medline]
28. Wang, X. H., J. D. Ohmen, K. Uyemura, T. H. Rea, M. Kronenberg, R. L. Modlin. 1993. Selection of T lymphocytes bearing limited T-cell receptor ß chains in the response to a human pathogen. Proc. Natl. Acad. Sci. USA 90:188.[Abstract/Free Full Text]
29. Dunn, D. A., A. S. Gadenne, S. Simha, E. A. Lerner, M. Bigby, P. A. Bleicher. 1993. T-cell receptor Vß expression in normal human skin. Proc. Natl. Acad. Sci. USA 90:1267.[Abstract/Free Full Text]
30. Freedman, D. O., P. J. de Almeida Filho, S. Besh, M. C. Maia e Silva, C. Braga, A. Maciel. 1994. Lymphoscintigraphic analysis of lymphatic abnormalities in symptomatic and asymptomatic human filariasis. J. Infect. Dis. 170:927.[Medline]
31. Sartono, E., M. C. van Eggermond, A. Kurniawan, R. M. Maizels, P. J. van den Elsen, M. Yazdanbakhsh. 1997. Selective usage of defined TCRBV genes in response to filarial antigens. Int. Immunol. 9:955.[Abstract/Free Full Text]
32. Moss, P., P. Charmley, E. Mulvihill, S. Ziegler, G. J. Raugi, D. Kern, M. Piepkorn, R. Gelinas. 1997. The repertoire of T cell antigen receptor ß-chain variable regions associated with psoriasis vulgaris. J. Invest. Dermatol. 109:14.[Medline]
33. Jungmann, P., J. Silva-Figueredo, G. Dreyer. 1992. Bancroftian lymphangitis in northeastern Brazil: a histopathological study of 17 cases. J. Trop. Med. Hyg. 95:114.[Medline]
34. Dimock, K. A., M. L. Eberhard, P. J. Lammie. 1996. Th1-like antifilarial immune responses predominate in antigen-negative persons. Infect. Immun. 64:2962.[Abstract]

This article has been cited by other articles:

				J. Clarencio, C. I. de Oliveira, G. Bomfim, M. M. Pompeu, M. J. Teixeira, T. C. Barbosa, S. Souza-Neto, E. M. Carvalho, C. Brodskyn, A. Barral, et al. Characterization of the T-Cell Receptor V{beta} Repertoire in the Human Immune Response against Leishmania Parasites. Infect. Immun., August 1, 2006; 74(8): 4757 - 4765. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Freedman, D. O. Articles by Furtado, A. Search for Related Content PubMed PubMed Citation Articles by Freedman, D. O. Articles by Furtado, A.