| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
World Health Organization Collaborating Centre for Neonatal Vaccinology, University of Geneva, Geneva, Switzerland;
Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA 52242; and
Loeb Research Institute, Ottawa Civic Hospital, Ottawa, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-5 by
Ag-specific T cells. However, in spite of their capacity to trigger
neonatal B cell proliferation in vitro, CpG-ODN only partially enhanced
early life Ab responses. Finally, using Th1-driving CpG-ODN with the
boosting dose of a protein vaccine was sufficient to redirect adult but
not neonatally primed Th2 responses. These observations could be
important for the development of novel vaccines that will have to be
effective early in life. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, TNF-
, and CTL responses
that are essential for protection against many intracellular pathogens,
and whose induction is thus considered desirable for numerous new
vaccines.
In contrast to conventional vaccines, DNA vaccines were recently
identified as capable to elicit strong Th1 and CTL responses early in
life (9, 10, 11, 12). This capacity of DNA vaccines to induce strong
neonatal Th1 responses was initially thought to result from the in vivo
synthesis of Ag that would result in class I MHC presentation and
thereby activation of CD8+ T cells, as well as the
prolonged in vivo induction of Ag expression that follows DNA
immunization. This Ag expression has been shown in adult mice to last
for about 2 wk after the induction of immune responses, at which time
Ag-expressing cells are destroyed by CTL (13). Because expression of a
nonimmunogenic protein such as luciferase can persist for several
months (13, 14), presumably Ag expression could persist in neonates
until Th1 and CTL responses were fully developed. However, it
was recently found that bacterial DNA and oligonucleotides
(ODN)3 containing
unmethylated CpG dinucleotides in particular base contexts (CpG motifs)
have direct stimulatory effects on immune responses of adult mice.
These stimulatory effects include induction of IFN-ß, IL-6, IL-12,
granulocyte-macrophage-CSF, chemokines, and TNF- by
monocyte/macrophages (15, 16, 17, 18, 19, 20, 21), as well as secretion of IFN- by NK
cells, which all contribute to the subsequent differentiation of T cell
responses toward the Th1 subset (20, 22). Accordingly, CpG-ODN, used in
coinjection with various Ags, were shown to induce significant
Th1-driving adjuvant activity in adult mice (23, 24, 25, 26, 27, 28, 29, 30). Whether CpG-ODN
would be able to circumvent the high activation requirements of
neonatal APC and the weak functional capacity of neonatal NK cells was
thus open for study.
In this report, we took advantage of our defined models of neonatal immunizations with various vaccine Ags, the immunodominant tetanus toxoid peptide (TTP30), the attenuated measles virus (MV), and the live recombinant canarypox expressing MV-hemagglutinin (HA) (ALVAC-HA), to evaluate the capacity of a potent Th1-driving CpG-rich ODN (27, 29) to modulate T cell neonatal vaccine responses to Ag presentation systems inducing exclusively Th2 responses (TTP30) or preferential Th2 responses (measles vaccines) in early life. Because part of the adjuvant activity of CpG-rich ODN is attributed to the strong direct stimulation of B cell proliferation and differentiation (16), we asked whether the B cell-promoting effect of CpG-ODN could enhance the weak Ab production capacity of early life. Finally, we asked whether CpG-ODN were capable of redirecting Th2 responses to a protein vaccine established after neonatal or adult priming when only used at booster time.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Specific pathogen-free adult BALB/c inbred mice were purchased from Iffa Credo (L’Arbresle, France) or The Jackson Laboratory (Bar Harbor, ME) and kept under specific pathogen-free conditions. Breeding cages were checked daily for new births, and the day of birth was recorded as the day the litter was found. Pups were kept with mothers until they were weaned at the age of 4 wk.
Vaccines
Live MV Schwarz strain (MV-S; 5 x 105 CCID50 per dose), was obtained from Pasteur Mérieux Sérums et Vaccins (Lyon, France). Live recombinant canarypox, expressing the MV-HA (vCp85, ALVAC-HA, 5 x 107 pfu/dose) was obtained from Virogenetics (Troy, NY). TTP30 (1) was used in a dose of 100 µg. Unless otherwise indicated, TTP30 was adsorbed to aluminum hydroxide (AlOH; Sclavo, Siena, Italy), 0.25 mg for young mice and 1 mg for adult mice, immediately before immunization.
Immunization procedures
Mice were immunized i.p. in groups of six to eight. For the experiments with TTP30, the CpG or non-CpG control-ODN were administered at a dose of 100 µg per adult and 20 µg per 1-wk-old mice, to adjust for body weight. For the experiments with the more immunogenic MV-S and ALVAC-HA, the dose of ODN was reduced to 3 µg per young mouse (1 or 2 wk old). The sequence of the CpG-ODN "1826" (27) was TCCATGACGTTCCTGACGTT and that of the control-ODN "1982" (27) was TCCAGGACTTCTCTCAGGTT. ODN were synthesized with a nuclease resistant phosphorothioate backbone by Oligos Etc. (Wilsonville, OR) or Hybridon (Milford, MA). ODN had undetectable endotoxin levels (less than 1 ng/mg) by Limulus assay (Whittaker Bioproducts, Walkersville, MD). The Na+ salts of the ODN were ethanol precipitated and then resuspended in 10 mM Tris (pH 7.0), 1 mM EDTA for storage at -20°C before dilution into PBS for injection.
Quantification of vaccine-specific Abs
Mice were bled at regular interval for the determination of vaccine-specific serum Abs. Serum MV-HA and TTP30 Abs were measured by ELISA as described (1) using Ag-coated plates or Ltk-HA-transfected cells. Incubation was performed with serial serum dilution starting at 1/100. After washing, the relevant isotype-specific peroxidase-conjugated goat or rabbit anti-mouse Ab (Zymed Laboratories, San Francisco, CA) was added for 2 h at 37°C before washing, incubation with substrate, and reading. Results of MV-HA and TTP30 Abs were expressed by reference to serial dilution of a titrated serum pool from immunized adult mice. Ab titers below the cut off of the assay were given an arbitrary titer of one-half of the cut off value to allow calculation of geometric mean Ab titers.
Determination of T cell responses
Splenocytes were harvested 3 wk after immunization. They were
incubated at 37°C with vaccine Ag or in DMEM-10% FCS medium alone
(control wells). Cell supernatants were collected after 48 h and
72 h for measurement of IL-5 and IFN- content by capture ELISA
(1). Values for IL-5 and IFN- were expressed by reference to a
standard curve constructed by assaying serial dilution of the
respective mouse cytokines. Values below the cut off of the assay were
given an arbitrary titer of one-half of the cut-off value. Ag-specific
cytokine secretion was obtained by subtracting the cytokine content of
the supernatant from splenocytes incubated with DMEM alone.
Determination of cellular responses in vitro
Single spleen cell suspensions were prepared and cultured at
37°C in 5% CO2 humidified incubator in RPMI 1640
supplemented with 10% (v/v) heat inactivated FCS, 1.5 mM
L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100
µg/ml streptomycin, essentially as described (16). Briefly, cells
were treated with medium or ODN at the indicated concentrations at a
density of 106 cells/200 µl/well for experiments to
measure induction of cytokine expression or at of 105
cells/200 µl/well for proliferation assays. This procedure was
previously shown to only induce proliferation of B cells (16). At the
end of the incubation, serial dilution of culture supernatants were
analyzed for IL-12 and IFN- content by ELISA using Abs from
PharMingen (San Diego, CA). For proliferation assays, the cells were
pulsed with 1 µCi of [3H]thymidine before harvest and
scintillation counting (16). SDs of the triplicate wells were <5%.
Statistical analysis
Significance analysis between results obtained from various groups of mice was performed by using the Mann-Whitney U test. Differences with probability values >0.05 were considered insignificant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To assess the capacity of CpG-ODN to enhance early life Ab
responses, we first selected a relatively weak Ag, TTP30. When
immunization was performed in 1-wk-old or adult BALB/c mice with TTP30
alone (100 µg resuspended in PBS, in the absence of any adjuvant),
even repeated immunization combined with large doses (100 µg in
adults, 20 µg in young mice) of CpG-ODN failed to result in a
significant induction of anti-TTP30-specific Abs (data not shown).
In contrast, with the addition of CpG-ODN together with AlOH to the
vaccine formulation, a strong enhancement of Ab responses was observed.
In a first set of experiments, adult or 1-wk-old BALB/c mice received a
single vaccine dose of AlOH-adjuvanted TTP30 together with either CpG
or control-ODN (Fig. 1
a). The
positive influence of CpG-ODN on TTP30 total IgG Abs was already
significant 2 wk after priming of adult mice. In contrast, Ab responses
triggered in 1-wk-old mice by either CpG or control-ODN remained
equally weak for 3 wk after priming. However, between the 3rd and 5th
week after priming, a strong increase of TTP30 Ab titers was
observed in the absence of any boosting event in the group immunized
with TTP30-AlOH plus the CpG-ODN, whereas only a slow and weak Ab
response was observed in mice primed with TTP30-AlOH and control-ODN.
Thus, the influence of neonatal CpG-ODN addition to TTP30-AlOH only
became evident 4 wk after immunization and even then, responses
remained weaker than those induced in adults; CpG-ODN increased final
Ab titers induced by a single vaccine dose by a factor of 20 when
administered to 1-wk-old mice, compared with a 350-fold enhancement in
adult mice. When priming was followed by boosting 3 wk after the
initial injection (Fig. 1b), immunization with the
TTP30-AlOH preparation supplemented with CpG-ODN resulted in a strong
increase of total anti-TTP30 IgG Abs. In this case, titers were
equally high in mice primed at 1 wk of age or as adults and these high
levels persisted for at least 3 mo.
|
a). The direct influence of CpG-ODN
on early life B cells was next assessed in vitro by incubation of
spleen cells with CpG or control-ODN, a procedure previously shown to
only induce proliferation of B cells (16). When cells from either 1- or
4-wk-old mice were incubated with CpG-ODN for 30 h, a strong
proliferation, assessed through [3H]thymidine
incorporation at the end of the incubation period, was induced in both
age groups, whereas control-ODN remained without detectable influence
(Table I). Although lower proliferation
indices were observed in 1-wk-old mice, differences were not
significant. Thus, the limitation of the Ab-producing capacity observed
in vivo in early life could not be related to a failure of B cell
proliferation in response to CpG-ODN, as assessed under these in vitro
experimental conditions.
|
The influence of CpG-ODN on the pattern of T cell vaccine
responses was first addressed through assessing the isotypic
distribution of IgG1 and IgG2a vaccine Abs, previously demonstrated as
reliable markers of Th2/Th1 responses in this immunization model (1).
IgG2a Abs were not detected in mice that received a single
administration of TTP30-AlOH with added control-ODN (Fig. 1c). In contrast, both adult and 1-wk-old primed mice
immunized with TTP30-AlOH-CpG exhibited significant IgG2a vaccine Abs 5
wk after immunization. Similar IgG2a/IgG1 ratios were observed (Fig. 1c) whether mice had been immunized once at 1 wk, 4 wk (Fig. 2, left panel, group 3),
or as adults. When a second vaccine dose was given 3 wk after priming,
IgG1 and IgG2a Abs reached levels (>5 log10) that were
similar in 1-wk-old and adult primed mice. The capacity of CpG-ODN to
induce IgG2a Abs in early life was confirmed in another immunization
model in which 1-wk-old BALB/c mice were immunized with MV-S in the
absence of AlOH; IgG2a Abs remained undetectable after MV-S
immunization together with PBS or control-ODN, whereas they reached >3
log10 in mice immunized in the presence of CpG-ODN. These
results suggested the capacity of CpG-ODN to induce both Th1 and Th2
differentiation already at 1 wk of age.
|
To directly evaluate the influence of CpG-ODN on early life T cell
responses, we selected immunization models that lead to strong T cell
responses after a single immunization in early life; this is not
readily achieved with the weak TTP30 immunogen. In the first
set of experiments, BALB/c mice were immunized once with MV-S in the
absence of AlOH with either CpG or control-ODN at the age of 1 wk, 2
wk, or as adults (controls). Three weeks later, Ag-specific cytokine
production (IFN- and IL-5) was assessed in the supernatants of in
vitro restimulated splenocytes (Table II). Splenocytes from 1-wk-old mice,
having received control-ODN, secreted lower levels of IFN- and
significantly higher levels of IL-5 (p = 0.01)
in response to antigenic restimulation, as compared with adult mice.
This confirmed the previously observed Th2 polarization of early life T
cell responses to live attenuated MV-S vaccine. Immunization at 1 wk of
age in the presence of CpG-ODN significantly enhanced Ag-specific
IFN- production, restoring it to the same level as that which is
generated in adult mice, and had a very strong inhibiting effect on the
IL-5 production observed in mice immunized in early life (Table II).
Control mice primed at 2 wk of age generated IFN- levels similar to
adult mice, and these were not further enhanced by addition of CpG-ODN.
In contrast, their IL-5 production was reduced to barely detectable
levels by CpG-ODN coadministration.
|
and to reduce the excessive
IL-5 production of neonatally primed T cells was assessed in another
immunization model using ALVAC-HA and also given in the absence of AlOH
(Ref. 1 and Table II). When 1-wk-old mice were immunized with ALVAC-HA
and CpG-ODN, we observed a significant increase of IFN- and a
complete inhibition of the neonatal IL-5 burst compared with mice
coimmunized with the control-ODN (Table II). Levels of both cytokines
were indeed similar to those generated by cells from adult controls.
This finding suggested the capacity of CpG-ODN to activate neonatal APC
so as to support the induction of Th1 responses already in early life.
When splenocytes from either 1-wk- or 4-wk-old mice were incubated in
vitro for 24 h with either CpG or control-ODN, significant and
similar levels of IL-12 were indeed detected in the supernatant of
cells from either age group incubated with CpG but not in control-ODN
(Table I). High amounts of IFN- (>400 pg/ml) were also detected in
the supernatant of splenocytes from 1-wk-old mice incubated for 48
h with 3 or 0.3 µg/ml of CpG-, but not control-, ODN (data not
shown). Thus, neonatal APC were capable to respond to CpG-ODN
stimulation by adult-like IL-12 production and a strong production of
IFN-. Influence of CpG on neonatally triggered vaccine responses
We asked whether CpG-ODN, as a potent Th1-driving agent, could
successfully redirect neonatally triggered Th2 responses. One-week-old
BALB/c mice were primed with TTP30-AlOH in the presence of control-ODN
and were boosted 3 wk later in the presence of either CpG- or
control-ODN. Other control mice were not immunized at 1 wk of age and
only received the injection at 4 wk of age. When mice were primed and
boosted with TTP30-AlOH and control-ODN, IgG2a Abs remained below
detection levels, reflecting the preferential Th2 polarization
previously observed (Fig. 2, left panel). When mice
primed with TTP30-AlOH and control-ODN were boosted in the presence of
CpG-ODN, some IgG2a Abs were induced but they remained at very low
levels (3 log10). In fact, IgG2a Abs remained significantly
lower than those induced by a single immunization of TTP30-AlOH-CpG
given at 4 wk of age (4.5 log10). In contrast, when adult
mice were primed with TTP30-AlOH and control-ODN and boosted in
presence of CpG-ODN, IgG2a Abs reached high levels (>5
log10) that were similar to those induced by 2
doses of TTP30-AlOH-CpG (Fig. 2, right panel). Thus,
neonatal priming with control-ODN formulation limited the subsequent
induction of TTP30 IgG2a Abs in a persistent manner, whereas TTP30
responses similarly triggered in adults could be fully redirected by
the use of CpG-ODN at the time of boost only.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Evidence that CpG-ODN could induce adult-like Th1/Th2 responses in
early life was obtained in three distinct immunization models
characterized by the induction of preferential Th2 responses after
early immunization. In the presence of CpG-ODN, Th1-driven IgG2a Abs to
TTP30 and to MV-S were induced in mice primed at 1 wk of age.
Furthermore, when CpG-ODN were coadministered to 1- or 2-wk-old mice
with two types of live viral vaccines that replicate either poorly
(MV-S) or not (ALVAC-HA) in mice, T cell responses were characterized
by complete suppression of the neonatal IL-5 burst that characterizes
the preferential Th2 polarization of neonatal vaccine responses and by
the significant increase of IFN-. Thus, the Th1-driving capacity of
CpG-rich ODN in early life was demonstrated for responses to both live
and subunit vaccines.
The in vivo adjuvant effect of CpG-ODN is likely to be related to an
effect on APC (17, 20, 21, 22, 24, 32, 33, 34) and NK cells (35) that promote
the subsequent preferential induction of Th1 and CTL responses (20, 27, 28, 29, 32). Suboptimal neonatal APC activation is currently considered
responsible for the relatively weak generation of Th1/CTL responses in
early life, and the existence of distinct activation thresholds for
neonatal vs adult APC has been postulated (8). Although progress is
being made, the exact molecular mechanisms by which CpG-ODN activate
APC are not known. Our direct demonstration that APC from 1-wk-old mice
can respond to CpG-ODN with adult-like IL-12 production indicates that
all the CpG-related molecular events, including production of reactive
oxygen species and NF-
B and certain mitogen-activated protein
kinases activation (31, 36, 37, 38, 39), can be induced very early in life.
After APC activation and IL-12 production, significant amounts of
IFN- were detected early (48 h) in the supernatant of neonatal
splenocytes incubated with CpG-, but not control-, ODN. Although this
has not been formally assessed, this rapid and Ag-independent
production of IFN- is likely to result from the activation of NK
cells (18, 21). The observation that neonatal NK cells can be activated
by CpG-ODN could be of significant interest for resistance to pathogens
requiring strong innate immune defenses until specific T cell-mediated
immunity develops. CpG-ODN were recently shown to protect adult BALB/c
mice against Listeria monocytogenes (40), and this pathogen
is indeed responsible for severe infections in human neonates. Also,
the successful induction of neonatal Th1 responses by CpG-activated
APC/NK cells will likely enhance associated CTL responses in a number
of immunization models, as previously demonstrated in adult mice (28, 29, 41). In the measles model, no direct correlation between Th1/Th2
balance and CTL induction was observed because 1-wk-old mice could
generate CTLs to MV-S in spite of limited Ag-specific IFN- and high
IL-5 responses compared with adults (42). This was also observed by
others (43). In contrast, CTL responses to recombinant hepatitis B
virus Ag (HBsAg), an Ag that self-assembles into virus-like particles,
are only generated if a Th1 environment is provided (29). As expected,
CTL responses were observed in mice immunized at 1 wk of age with
HBsAg+alum+CpG but not with HBsAg+alum (C. L. Brazolot Millan, et
al., unpublished observations). Thus, the addition of CpG-ODN
could benefit vaccine Ags that induce preferential Th2 neonatal/adult
responses and that benefit from a stronger Th1 environment for
enhanced-CTL induction.
The influence of CpG-ODN on Ab production follows both direct B cell activation and enhancement of T cell help (27, 28, 29, 31). When the influence of CpG-ODN on Ab response was studied in vivo with a weakly immunogenic peptide (TTP30) in the absence of AlOH, repeated immunization with large doses of CpG-ODN failed to enhance Ab responses either in young or in adult mice. This result is in contrast to coimmunizations with more immunogenic soluble proteins in which the addition of CpG-ODN alone resulted in a significant adjuvant effect in adult mice (28, 29). However, even when used with the stronger HBsAg immunogen, CpG administration also remained ineffective in 1-wk-old mice in the absence of AlOH (data not shown). Thus, in spite of their strong adjuvant potential, CpG-ODN may not be able to transform any weak Ag into highly immunogenic products, particularly in early life. However, TTP30 adsorption to AlOH was sufficient to allow CpG-ODN to strongly enhance TTP30-specific IgG Abs in both young and adult mice. This is likely due to the depot effect of alum, which probably retains the Ag/CpG formulation. However, this depot effect is unlikely to last for several weeks, i.e., until young mice reach immunological maturity, because CpG-ODN-containing formulations only had significant Th1 influence on the vaccine responses of mice immunized at 7 but not at 3 days of age (data not shown). This finding indicates that although alum doubtless has some depot function, it must be fairly short lived. The intrinsic influence of CpG-ODN on early life Ab responses was also demonstrated using measles vaccines that are given without AlOH and are unlikely to persist in vivo given their restricted replication patterns. The fact that otherwise undetectable MV-S IgG2a Abs reached >3 log10 after a single MV-S immunization with CpG-ODN indicates an early influence of CpG on neonatal Ab responses. Thus, when CpG-ODN are given with protein+alum vaccines, they probably capitalize on the depot effect of alum. Indeed, induction of IgG2a Abs to TTP30 is only achieved with the addition of CpG-ODN, even in immunologically mature adult mice.
However, very obvious differences persisted between Ab responses triggered at 1 wk of age and as adults, both in terms of kinetics and magnitude of Ab production. First, early life Ab responses to TTP30-AlOH after immunization with CpG-ODN only became apparent 4 wk postimmunization, i.e., at 5 wk of age; whereas, 2 wk were sufficient in adult mice. Second, although final TTP30 Ab titers raised in CpG-adjuvanted 1-wk-old mice were higher that those of adult controls, they remained at least 10-fold inferior to those of adults receiving CpG-ODN. As a result of this persisting immaturity, adult-like TTP30 Ab levels were only achieved in early life after the administration of a second vaccine dose at 4 wk of age, i.e., at a time of enhanced-B cell maturation.
It has been shown previously that >95% unprimed adult B cells, exposed in vitro to large doses of CpG-ODN, enter the cell cycle and begin to release IL-6, which leads to their polyclonal activation and IgM secretion (16). We show here that similarly strong proliferative responses could be elicited by CpG-ODN in vitro at 1 or at 4 wk of age. The relative discrepancy between the in vitro responses and suboptimal in vivo early life B cell responses could have several explanations. First, the polyclonal activation observed in vitro could occur in vivo and interfere with the induction of Ag-specific Ab responses. However, under the described experimental conditions, CpG-ODN failed to enhance total IgM Abs upon immunization of either adult or 1-wk-old mice (data not shown), as would have been expected in the presence of strong polyclonal activation (44). Second, early life B cells could be activated by CpG-ODN and induced to proliferate, but remain unable to terminally differentiate into Ab-producing plasmocytes before the age of 4 wk. The description of a 4-wk requirement for the maturation of specific tyrosine kinases in B cells (45) is consistent with this hypothesis. Alternatively, signaling through the B cell receptor that is required for synergy with CpG-mediated activation could remain suboptimal in early life B cells (16). Finally, yet suboptimal APC/T cell/B cell interactions could explain the slower and weaker in vivo IgG Ab responses observed in early life, but the demonstration of adult-like neonatal APC and T cell cytokine production in response to CpG-ODN does not directly support this hypothesis either.
In addition to the weak capacity of CpG-ODN to rapidly enhance early life Ab responses, another potential limitation to their use in early life immunization programs was identified as their relative failure to redirect neonatally triggered Th2 vaccine responses when CpG-ODN were added only to the booster dose of TTP30+AlOH. We observed that a single immunization with TTP30-AlOH-CpG at 4 wk of age induced significantly higher IgG2a Ab responses than a booster immunization with the same vaccine in mice neonatally primed with TTP30-AlOH and control-ODN. In contrast, CpG-ODN did successfully redirect Th2 responses triggered by TTP30+AlOH in adults, as previously observed in adult mice after priming with hen egg lysozyme Ag in CFA (27). This result indicates that once a Th2 response is established by neonatal priming, it may be more difficult to redirect it to a Th1 response than after adult priming, even when boosting is performed with Th1-driving formulations as strong as CpG-ODN. This is in accordance with our previous observations using the same peptide with a water-in-oil squalene adjuvant formulation (46), as well as with experiments using a canarypox recombinant (ALVAC-HA) and measles DNA vaccines at time of priming and boosting, respectively (9). Interestingly, parallel experiments suggest that CpG-ODN may be able to better redirect neonatally triggered TH2 responses when used with a stronger immunogen (C. L. Brazolot Millan et al., unpublished observations). The weaker vaccine responses frequently observed in early life could thus favor the persistence of the TH2 pattern of neonatally induced responses to some vaccine Ags, as compared with the situation in adults. Whatever the exact mechanisms, this indicates the importance of the immunogenicity of the vaccine formulation used for neonatal priming.
Could CpG-ODN represent the strong but safe adjuvants required for
early life immunization? In comparison to DNA vaccines, the use of
CpG-ODN as adjuvants would avoid the risk of chromosomal integration.
However, their potent and dose-dependent immune stimulation capacity
could prove toxic if the doses are excessive. CpG-ODN administration to
adult mice at very high doses resulted in toxicity and death (47). Even
relatively low doses of CpG caused toxicity by releasing high
quantities of TNF- in galactosamine-sensitized mice (48) and by
priming for the Schwartzmann reaction (18). This could be an important
issue in early life because repeated vaccine doses are often required
to induce sufficient immune responses. The capacity of neonates to
tolerate excessive immune activation could also be lower than later in
life. Accordingly, although the use of CpG-ODN was generally free of
local or systemic toxicity, we have observed an increased morbidity and
mortality of 1-wk-old mice administered 20 µg of CpG-ODN with certain
live viral vaccines (data not shown). The theoretical risk of eliciting
autoimmune Th1-mediated reactions through the use of CpG-ODN (49, 50),
in contrast, should not be greater in the more Th2-prone neonatal
period than in adult life. Given the interesting properties of CpG-ODN
for the induction of Th1/CTL responses in early life, further studies
assessing their characteristics and long term safety appear important.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Jiri Kovarik, W.H.O. Collaborating Centre for Neonatal Vaccinology, University of Geneva, C.M.U., Rue Michel Servet 1, 1211 Geneva 4, Switzerland. E-mail address:
3 Abbreviations used in this paper: ODN, oligodeoxynucleotides; CpG-ODN, ODNs containing CpG motifs; control-ODN, ODNs containing no CpG motifs; MV, attenuated measles virus; MV-S, measles virus Schwarz strain; HA, hemagglutinin; ALVAC-HA, live recombinant canarypox viral vector expressing the measles virus HA; TTP30, peptide containing the immunodominant epitope of tetanus toxin; AlOH, aluminum hydroxide; HBsAg; hepatitis B virus Ag.
Received for publication July 13, 1998. Accepted for publication October 26, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
production by stimulation of interleukin-12 and tumor necrosis factor-. Cell. Immunol. 167:72.[Medline]
. Proc. Natl. Acad. Sci. USA 93:2879. production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
B and IBß and sustained activation of nuclear factor-B/c-rel. J. Immunol. 160:1240.This article has been cited by other articles:
|
|
 |
|
  S. J. Opiela, T. Koru-Sengul, and B. Adkins Murine neonatal recent thymic emigrants are phenotypically and functionally distinct from adult recent thymic emigrants Blood, May 28, 2009; 113(22): 5635 - 5643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Belnoue, M. Pihlgren, T. L. McGaha, C. Tougne, A.-F. Rochat, C. Bossen, P. Schneider, B. Huard, P.-H. Lambert, and C.-A. Siegrist APRIL is critical for plasmablast survival in the bone marrow and poorly expressed by early-life bone marrow stromal cells Blood, March 1, 2008; 111(5): 2755 - 2764. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Belnoue, P. Fontannaz-Bozzotti, S. Grillet, P.-H. Lambert, and C.-A. Siegrist Protracted Course of Lymphocytic Choriomeningitis Virus WE Infection in Early Life: Induction but Limited Expansion of CD8+ Effector T Cells and Absence of Memory CD8+ T Cells J. Virol., July 15, 2007; 81(14): 7338 - 7350. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Pedras-Vasconcelos, D. Goucher, M. Puig, L. H. Tonelli, V. Wang, S. Ito, and D. Verthelyi CpG oligodeoxynucleotides protect newborn mice from a lethal challenge with the neurotropic tacaribe arenavirus. J. Immunol., April 15, 2006; 176(8): 4940 - 4949. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pihlgren, M. Friedli, C. Tougne, A.-F. Rochat, P.-H. Lambert, and C.-A. Siegrist Reduced Ability of Neonatal and Early-Life Bone Marrow Stromal Cells to Support Plasmablast Survival J. Immunol., January 1, 2006; 176(1): 165 - 172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Caprio-Young, J. J. Bell, H.-H. Lee, J. Ellis, D. Nast, G. Sayler, B. Min, and H. Zaghouani Neonatally Primed Lymph Node, but Not Splenic T Cells, Display a Gly-Gly Motif within the TCR {beta}-Chain Complementarity-Determining Region 3 That Controls Affinity and May Affect Lymphoid Organ Retention J. Immunol., January 1, 2006; 176(1): 357 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ma and A. C. Ross The anti-tetanus immune response of neonatal mice is augmented by retinoic acid combined with polyriboinosinic:polyribocytidylic acid PNAS, September 20, 2005; 102(38): 13556 - 13561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ito, K. J. Ishii, M. Gursel, H. Shirotra, A. Ihata, and D. M. Klinman CpG Oligodeoxynucleotides Enhance Neonatal Resistance to Listeria Infection J. Immunol., January 15, 2005; 174(2): 777 - 782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Regner, X. Martinez, E. Belnoue, C.-M. Sun, F. Boisgerault, P.-H. Lambert, C. Leclerc, and C.-A. Siegrist Partial Activation of Neonatal CD11c+ Dendritic Cells and Induction of Adult-Like CD8+ Cytotoxic T Cell Responses by Synthetic Microspheres J. Immunol., August 15, 2004; 173(4): 2669 - 2674. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. De Wit, V. Olislagers, S. Goriely, F. Vermeulen, H. Wagner, M. Goldman, and F. Willems Blood plasmacytoid dendritic cell responses to CpG oligodeoxynucleotides are impaired in human newborns Blood, February 1, 2004; 103(3): 1030 - 1032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Dakic, Q.-x. Shao, A. D'Amico, M. O'Keeffe, W.-f. Chen, K. Shortman, and L. Wu Development of the Dendritic Cell System during Mouse Ontogeny J. Immunol., January 15, 2004; 172(2): 1018 - 1027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pihlgren, C. Tougne, P. Bozzotti, A. Fulurija, M. A. Duchosal, P.-H. Lambert, and C.-A. Siegrist Unresponsiveness to Lymphoid-Mediated Signals at the Neonatal Follicular Dendritic Cell Precursor Level Contributes to Delayed Germinal Center Induction and Limitations of Neonatal Antibody Responses to T-Dependent Antigens J. Immunol., March 15, 2003; 170(6): 2824 - 2832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Adkins, Y. Bu, and P. Guevara Murine Neonatal CD4+ Lymph Node Cells Are Highly Deficient in the Development of Antigen-Specific Th1 Function in Adoptive Adult Hosts J. Immunol., November 1, 2002; 169(9): 4998 - 5004. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Fadel, D. A. Ozaki, and M. Sarzotti Enhanced Type 1 Immunity After Secondary Viral Challenge in Mice Primed as Neonates J. Immunol., September 15, 2002; 169(6): 3293 - 3300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dadaglio, C.-M. Sun, R. Lo-Man, C. A. Siegrist, and C. Leclerc Efficient In Vivo Priming of Specific Cytotoxic T Cell Responses by Neonatal Dendritic Cells J. Immunol., March 1, 2002; 168(5): 2219 - 2224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. K. Ballas, A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, and G. J. Weiner Divergent Therapeutic and Immunologic Effects of Oligodeoxynucleotides with Distinct CpG Motifs J. Immunol., November 1, 2001; 167(9): 4878 - 4886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Baek, S. J. Ha, and Y. C. Sung A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages J. Immunol., September 1, 2001; 167(5): 2847 - 2854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Al-Mariri, A. Tibor, P. Mertens, X. De Bolle, P. Michel, J. Godefroid, K. Walravens, and J.-J. Letesson Protection of BALB/c Mice against Brucella abortus 544 Challenge by Vaccination with Bacterioferritin or P39 Recombinant Proteins with CpG Oligodeoxynucleotides as Adjuvant Infect. Immun., August 1, 2001; 69(8): 4816 - 4822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Peng, H. Wang, X. Mao, K. T. HayGlass, and F. E. R. Simons CpG oligodeoxynucleotide vaccination suppresses IgE induction but may fail to down-regulate ongoing IgE responses in mice Int. Immunol., January 1, 2001; 13(1): 3 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Lee, M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H.-K. Cheong, C. Cheong, and Y. C. Sung Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials J. Immunol., October 1, 2000; 165(7): 3631 - 3639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Olszewska, C. D. Partidos, and M. W. Steward Antipeptide Antibody Responses following Intranasal Immunization: Effectiveness of Mucosal Adjuvants Infect. Immun., September 1, 2000; 68(9): 4923 - 4929. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Chu, T. McCool, N. S. Greenspan, J. R. Schreiber, and C. V. Harding CpG Oligodeoxynucleotides Act as Adjuvants for Pneumococcal Polysaccharide-Protein Conjugate Vaccines and Enhance Antipolysaccharide Immunoglobulin G2a (IgG2a) and IgG3 Antibodies Infect. Immun., March 1, 2000; 68(3): 1450 - 1456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al. Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo J. Immunol., February 1, 2000; 164(3): 1617 - 1624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Klinman, J. Conover, and C. Coban Repeated Administration of Synthetic Oligodeoxynucleotides Expressing CpG Motifs Provides Long-Term Protection against Bacterial Infection Infect. Immun., November 1, 1999; 67(11): 5658 - 5663. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
