The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thayer, W. P.
Right arrow Articles by Jensen, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thayer, W. P.
Right arrow Articles by Jensen, P. E.
The Journal of Immunology, 1999, 162: 1502-1509.
Copyright © 1999 by The American Association of Immunologists

Class II-Associated Invariant Chain Peptide-Independent Binding of Invariant Chain to Class II MHC molecules1

Wesley P. Thayer*, Leszek Ignatowicz{dagger}, Dominique A. Weber* and Peter E. Jensen2,*

* Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA 30322; and {dagger} Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, GA 39912


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The class II-associated invariant chain peptide (CLIP) region of invariant chain (Ii) is believed to play a critical role in the assembly and transport of MHC class II {alpha}ßIi complexes through its interaction with the class II peptide-binding site. The role of the CLIP sequence was investigated by using mutant Ii molecules with altered affinity for the DR1 peptide-binding site. Both high- and low-affinity mutants were observed to efficiently assemble with DR1 and mediate transport to endosomal compartments in COS cell transfectants. Using N- and C-terminal truncations, a region adjacent to CLIP within Ii(103–118) was identified that can complement loss of affinity for the peptide-binding site in mediating efficient assembly of {alpha}ßIi. A C-terminal fragment completely lacking the CLIP region, Ii(103–216), was observed binding stably to class II molecules in immunoprecipitation studies and experiments with purified proteins. The Ii(103–118) region was required for this binding, which occurs through interactions outside of the {alpha}ß peptide-binding groove. We conclude that strong interactions involving Ii(103–118) and other regions of Ii cooperate in the assembly of functional {alpha}ßIi under conditions where CLIP has little or no affinity for the class II peptide-binding site. Our results support the hypothesis that the CLIP sequence has evolved to avoid high-stability interactions with the peptide-binding sites of MHC class II molecules rather than as a promiscuous binder with moderate affinity for all class II molecules.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The nonpolymorphic type II membrane protein, invariant chain (Ii),3 has multiple important functions in the MHC class II Ag-processing pathway (1, 2, 3). Ii homotrimers rapidly assemble with newly synthesized class II {alpha}ß heterodimers in the endoplasmic reticulum (ER) (4, 5) to form nonameric complexes (6) that are transported through the Golgi and targeted to endosomal compartments. Ii is released after sequential cleavage by endopeptidases (7, 8, 9, 10), leaving only a fragment encoded by exon 3, class II-associated invariant chain peptides (CLIP), which is protected from proteases because it is largely buried in the peptide-binding groove (11). This last fragment is removed by HLA-DM, which catalyzes peptide-exchange reactions in class II molecules (12, 13, 14). Ii facilitates the initial assembly and transport of {alpha}ß heterodimers (15, 16, 17, 18, 19, 20), and its cytoplasmic domain plays a dominant role in endosomal targeting and retention (21, 22). Ii also prevents premature peptide loading in the early secretory pathway (23, 24, 25), and it influences the repertoire of peptides that bind class II molecules in endosomal compartments (17, 26, 27, 28, 29, 30).

Though unproved, there is good reason to believe that CLIP occupies the peptide-binding groove in intact {alpha}ßIi complexes. MHC class II intermediates accumulate in DM-deficient cells with CLIP fragments bound in a manner completely analogous to peptide Ags (11). Complexes with mutant Ii proteins containing a CLIP sequence designed to have high affinity for the peptide-binding site can be stable in SDS (31), a property conferred by occupancy of the binding site (32). This would explain the inability of {alpha}ßIi to bind peptide Ags. Class II molecules with unoccupied binding sites are less stable and more likely to misfold and denature (33, 34, 35, 36). Thus, binding-site occupancy may be the mechanism through which Ii promotes the folding and early transport of some class II heterodimers. Indeed, Zhong et al. (37) demonstrated that groove occupancy alone is sufficient for promoting transport of class II molecules through the secretory pathway. Given the apparent importance of binding-site occupancy, it is remarkable that the conserved sequence of CLIP can appropriately interact with all class II molecules despite extensive polymorphism in the binding site. Class II molecules have been shown to differ widely in their affinities for CLIP (38, 39).

The present study was initiated to investigate the role of the CLIP sequence and its affinity for the peptide-binding site in mediating assembly and transport of {alpha}ßIi complexes. The results indicate that a mutant Ii protein containing a CLIP sequence designed to have very low affinity for DR1 efficiently assembles with DR1 and mediates its transport to endosomal compartments. The loss of affinity for the peptide-binding site is complemented by other interactions involving a segment of Ii on the C-terminal side of CLIP. We demonstrate that a C-terminal fragment of Ii binds stably to a site in class II molecules outside the peptide-binding groove, with no requirement for the N-terminal or CLIP regions of Ii. These results support the conclusion that no minimal affinity for the peptide-binding site is required for the assembly and transport of class II-Ii complexes, consistent with the ability of Ii to regulate the transport of all class II molecules regardless of affinity for CLIP.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
DNA constructs

All mammalian expression constructs were cloned into pCDNA3.1 Zeo (Qiagen, Valencia, CA), and genes were sequenced. The DR{alpha}- and ß-chains, generously provided by Dr. Eric Long (National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health, Bethesda, MD) in vector CDM8, were subcloned into pCDNA3.1 Zeo using 5' blunt and 3' XhoI digested PCR product generated with the following primers: forward: {alpha}-F, 5'-GAAGAAAATGGCCATAAGTGGAGTCC and ß-F, 5'-CAGCATGGTGTGTCTGAAGCTCCTG; reverse: CDM8-R, 5'-TCCCTCGAGGTCACACCACAGAAGTAAGG. A{alpha}b in pcEXV-3 was the kind gift of Dr. Ronald Germain (NIAID, Bethesda, MD) and was cloned into pCDNA3.1 Zeo using two primers (forward, 5'-GGCAAGCTTGGTACCGTTACTTCTGCTCTAAAAGC; and reverse, 5'-ATAAGAATGCGGCCGCCTCGAGATTCTAGTTGTGGTTTGTCC) followed by digestion with KpnI and XhoI. Aßb-E{alpha} (40) in ptZ was subcloned using existing EcoRI sites.

The human Iip33/35 construct was also provided by Dr. Eric Long. Using overlapping PCR, the murine Ii (mIi) cytoplasmic domain (mIip31-pcEXV-3 construct provided by Dr. Jim Miller, University of Chicago, Chicago, IL) was engineered onto the human version with the following primers: pcEXV-3-F, 5'-GGAAGTGGTACCTCTGCTCTAAAAGC with hIi.mcyt-R 5'-GCTCCACGGCTGCACCTTTC and hIi.mcyt-F 5'-GAAAGGTGCAGCCGTGGAGCCCTGTACACAGGC with hIi.polyA-R 5'-CTAATCTCGAGCTTTTATTCTAATGTGAACCATGGC, followed by a fusion using the end set of primers in Taq-based overlapping PCR. This construct was then digested with KpnI and XhoI and ligated into pcDNA3.1 Zeo. These same end primers were used to fuse all full-length Ii mutants constructs, and the hybrid Ii was used as template for both Ii mutants. For the BAD-Ii construct, the internal forward primer was 5'-CGGTCGCGCACCACGCTCCTGGAGCAGGCGCTGCCCATGGGAGCC, while the internal reverse primer was 5'-GAGCGTGGTGCGCGACCGCGACTTGCTCACAGGCTTGGG. For the M91Y-Ii construct, the internal forward primer was 5'-TGAGCAAGTACCGCATGGCCACCCCGCTGCTGATG, while the internal reverse primer was 5'-GCCATGCGGTACTTGCTCACAGGCTTGGGAGGC. The fusion reaction and ligation were conducted as above.

To generate C-terminal Ii truncations, stop codons followed by 3' XhoI sites were inserted after positions 83K, 103P, 118Y, 143K, 163K, and 183E using PCR techniques. For N-terminal truncations, the DRß signal sequence was engineered using a DRß fusion piece derived from primers: pcDNA3.1 Zeo vector primer T7-F, 5'-TAATACGACTCACTATAGGG, and DRßsig-R, 5'-AGCCAAAGCCAGTGGGGAGCTCAG on vector DRß-pcDNA3.1.Zeo, and fused with Ii fragments generated with the following primers: (58–216)-F, 5'-GCTCCCCACTGGCTTTGGCTCAGCAGGGCCGGCTGGACAAACTG ; (103–216)-F, 5'-GCTCCCCACTGGCTTTGGCTCCCATGGGAGCCCTGCCCCAGGGGCCCATGC; or (118–216)-F, 5'-GCTCCCCACTGGCTTTGGCTTATGGCAACATGACAGAGGACC, each with hIi.polyA-R. The end primers for the fusion reaction were T7-F and hIi.polyA-R, resulting in cDNAs with 5' KpnI and 3' XhoI sites for digestion and ligation.

Ii ectodomain constructs were generated using the BamHI-enterokinase encoding Ii primers (103–216)-F 5'-ACCGGATCCGATGACGATGACAAACCCATGGGAGCCCTGCCCCAGGGGCCCATGC; (118–216)F 5'-GGCGGATCCGATGACGATGACAAATATGGCAACATGACAGAGGACC, and the SalI encoding reverse primer, 5'-GGCGCAGTCGACTCACATGGGGACTGGGCCCAGATCCTGCTTG. PCR fragments were digested and ligated into the overexpression vector pQE9 from Qiagen.

Transient expression

COS 7.2 cells were transiently transfected with cDNA constructs using the DEAE-dextran method as described (41). Briefly, 5 x 105 cells were plated per 60-mm tissue culture dish with DMEM and 10% FCS 24 h before transfection. Cells were washed twice with DMEM and 10 mM HEPES, and each dish was incubated in 2 ml of DMEM and 10 mM HEPES containing 500 µg of DEAE-dextran, 100 µM chloroquine, and DNA (0.5 µg of each class II {alpha}- and ß-chain construct ±1.0 µg of various Ii constructs). After 3 h at 37°C, the cells were treated with 10% DMSO in DMEM and 10 mM HEPES for 1–2 min at room temperature, then incubated 46 h in DMEM and 10% FCS before use in immunoprecipitation or immunofluorescence experiments.

Metabolic radiolabeling, immunoprecipitation, and gel electrophoresis

Transfected COS plates were each washed twice and Cys/Met depleted for 30 min at 37°C with 3 ml of Met/Cys-deficient DMEM-5% dialyzed FCS, then labeled for 30 min in 2 ml Met/Cys-deficient DMEM-5% dialyzed FCS medium containing 0.05 mCi/ml of 35[S]-trans Cys/Met (Trans35S-Label, ICN Pharmaceuticals, Irvine, CA). Plates were subsequently washed, harvested by trypsinization, and lysed on ice for 1 h in 0.5% Nonidet P-40 lysis buffer, 0.15 M NaCl, 50 mM Tris (pH 7.5), 0.01% Azide, and a protease inhibitor mixture (42). The precleared detergent lysates were split and immunoprecipitated with mAb prebound to protein A- or G-Sepharose beads (Sigma, St. Louis, MO) for 1 h, rocking at 4°C. Beads were preloaded by incubating 1.0 ml of supernatant or 10 µg of purified mAb with 40-µl beads for 1 h, rocking at 4°C, then washed three times in PBS. After incubating with lysates, beads were washed four times with 500 µl of 0.2% Nonidet P-40 wash buffer, 0.15 M NaCl, 50 mM Tris (pH 7.0), and 0.5 mM EDTA. Samples were eluted with 2% SDS and 5% 2-ME buffer by boiling 5 min and resolved using 12% polyacrylamide gels.

Immunofluorescence

Transfected COS were harvested by trypsinization and centrifuged onto slides using a Shandon Southern Cytospin, fixed in 95% ethanol at -20°C, and stained with L243 (DR) followed by goat anti-mouse FITC. Cells were visualized on a Leica microscope and captured using a MCID Image Analysis System (Imaging Research, Ontario, Canada) at x40.

Purification of Ii ectodomains

Escherichia coli strain, XL1-Blue (Stratagene, La Jolla, CA), was transformed with each pQE-9 construct. Bacteria were incubated at 37°C in LB broth containing 50 µg/ml of ampicillin, and protein expression was induced with 1 mM isopropyl ß-D-thiogalactoside at OD600 of 0.4. Four hours after induction, cells were harvested, and the bacterial pellet was resuspended in PBS with protease inhibitors. The cells were sonicated, and the lysate was cleared for 10 min at 10,000 x g. Cleared lysate from 800 ml of induced culture was mixed with 2 ml of Ni-nitrilotriacetic acid (NTA) resin (Qiagen). The resin was washed four times with PBS containing 10 mM imidazole and eluted in PBS and 250 mM imidazole. Ion-exchange chromatography of histidine-tagged fragments was performed using a Bio-Scale Q2 anion exchange column (Bio-Rad, Hercules, CA) and Bio-Rad Biologic high resolution liquid chromatography system. A linear gradient from 0.02 to 1.0 M NaCl and 50 mM Tris (pH 7.0) was used, and the major peak was collected for further study. Purified proteins were labeled with either fluorescein isothiocyanate or biotinamidocaproate N-hydroxysuccinimide ester. Briefly, either reagent, dissolved in DMSO at 2 mg/ml, was added to the PBS-dialyzed protein at a 2:1 molar ratio, rocking 1 h at room temperature. The reaction was terminated by the addition of Tris (pH 8.0) for 10 min followed by dialysis.

Abs, DR, DM, and peptides

The mAbs L243 (43), Tu36 (44), YAe (45), and IN-1 (46) were all purified from hybridoma supernatant using protein A- or G-Sepharose affinity chromatography. Bu45 was obtained from The Binding Site (Birmingham, U.K.). HLA-DR1 and HLA-DM were purified as previously described (47). Peptides were synthesized by fluorenyl methoxycarbonyl chemistry with a Ranin Instruments (Emoryville, CA) Symphony multiple peptide synthesizer, and certain ones were labeled with a biotin at the {alpha}-amino group before or after deprotection and cleavage by reaction with biotin-amido caproate N-hydroxysuccinimide as described (48).

Binding assays

Peptide affinity for DR1 was measured by competition inhibition assays in which 50 nM DR1 was incubated with 0.5 µM biotin-CLIP(81–104) or various concentrations of biotin-rIi(103–216) in 0.2% Nonidet P-40, 100 mM citrate/phosphate (pH 5.0) for 18 h at 37°C with varying concentrations of competitor peptide. After incubation, the samples were captured on microtiter assay plates coated with L243, and biotinylated ligand binding to DR1 was quantified with europium-streptavidin fluorescence as described (49).

Binding of FITC-rIi(103–216) to DR1 was also assessed using high-performance size-exclusion chromatography (HPSEC) as described for FITC peptide (47). Briefly, samples with or without 1 µM purified DR1 were incubated with 0.5 µM FITC-rIi(103–216) in 0.02% Nonidet P-40, and 100 mM citrate/phosphate (pH 7.0) for 2 h at 37°C with various competitor ligands. After incubation, 10 µl of each sample was removed and DR1-FITC-Ii(103–216) complexes were quantified with a Tosohaas (Montgomeryville, CA) TSK GFC 200 HPSEC column (7.8 x 150 mm) and Shimadzu (Columbia, MD) RF-10A fluorometer with 490-nm excitation and detection at 520 nm. The column buffer was 50 mM phosphate, 150 mM NaCl, and 0.2 mM dodecyl ß-D-maltoside (pH 7.0). DR-bound complexes eluted between 2.6 and 3.35 min with a flow rate of 1 ml/min. Any modifications to this protocol are indicated in the figure legends.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation and expression of Ii constructs

To investigate the role of CLIP affinity for the class II peptide-binding site in Ii function, variants were generated in which the sequence of CLIP was mutated to decrease or increase its affinity for DR1. The low-affinity sequence (BAD-CLIP) has five substitutions at anchor positions (11) designed to substantially reduce affinity for DR1, which strongly prefers peptides with a large hydrophobic residue in the dominant pocket, P1 (50) (Fig. 1GoA). Positively charged Arg at P4 should be disfavored because of charge repulsion from Arg ß71, and Thr is not optimally accommodated in the shallow P6 pocket (50). Similarly, Glu is inappropriate for the environment provided by the hydrophobic P9 pocket. A synthetic BAD-CLIP peptide was observed to have a substantially reduced affinity for DR1 as determined in competition-inhibition binding assays (Fig. 2GoA). The high affinity mutant CLIP sequence (M91Y) was previously shown to increase the stability of the DR1-peptide complex by ~160-fold, despite having little effect on the apparent affinity measured in competition assays (47) (Fig. 2GoA). Full-length mutant human p31 Ii cDNA constructs, encoding the mouse Ii cytoplasmic domain as a marker, were generated by site-directed mutagenesis and cloned into a mammalian cell expression vector (Fig. 1GoB). Expression was confirmed in metabolically labeled COS cell transfectants by immunoprecipitation with mAb specific for the cytoplasmic tail of mIi, IN-1 (Fig. 3GoA, lowerpanel).



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 1. Human p31Ii and CLIP with the mutants used in this study. A, Schematic representation of human CLIP and the two mutant CLIP sequences used in this study. Residues that correspond to DR1 pockets are underlined. B, Schematic representation of mutant Ii constructs generated by overlapping PCR. Each construct was ligated into pcDNA 3.1 Zeo using engineered 5' KpnI and 3' XhoI restriction sites. Also note that the cytoplasmic domains of all human Ii constructs were replaced with the murine sequence. C, Schematic representation of truncated Ii molecules. The DRß signal sequence was included in the N-terminally truncated molecules.

 


View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 2. BAD-CLIP and Ii(103–118) synthetic peptides have low affinity for DR1. Purified DR1 was incubated with 0.5 µM biotin-CLIP(81–104) in 0.2% Nonidet P-40, 100 mM citrate/phosphate (pH 5.0) for 18 h at 37°C with varying concentrations of competitor peptide. After incubation, the samples were captured on microtiter assay plates coated with L243, and biotinylated peptide bound to DR1 was quantified with europium-streptavidin fluorescence.

 


View larger version (56K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of CLIP mutations on association of Ii with DR1. COS cells were transfected with DR{alpha}ß and the indicated full-length (A) or truncated (B) Ii constructs. Cells were labeled for 30 min with 35[S]-trans Cys/Met, and precleared detergent lysates were split and immunoprecipitated with mAb Tu36 (DR) or In-1 (Ii). The positions of the Ii bands are indicated by arrows. The mutant protein, Ii.BAD, was observed to have slightly slower mobility than wt Ii or Ii.M91Y on SDS-PAGE.

 
DR association and function of mutant forms of Ii

Ii mutants were coexpressed in COS cells with human class II DR1{alpha} and ß-chains, and proteins from pulse-labeled cells were precipitated using mAbs specific for either DR1 (Tu36) or IN-1 (Ii). Ii and Ii.M91Y associate efficiently with DR1, as expected (Fig. 3GoA). Surprisingly, Ii.BAD-CLIP was also observed to efficiently coprecipitate with DR1. The capacity of the mutant Ii proteins to facilitate the transport and targeting of DR to endosomal compartments was analyzed by immunofluorescence. In the absence of Ii, DR fluorescence is distributed in a fine reticular pattern (Fig. 4Go). DR is redistributed to endosomal compartments characterized by a discrete vesicular staining pattern after cotransfection with Ii. Both the high- and low-affinity mutant Ii proteins were also able to target DR to the endosomal pathway (Fig. 4Go). These results suggest that the affinity of the CLIP region has little, if any, impact on the capacity of Ii to associate with DR and direct its transport to Ag-processing compartments.



View larger version (86K):
[in this window]
[in a new window]
  		FIGURE 4. Ii mutants target DR1 to endosomal compartments. Transfected COS cells expressing DR{alpha}ß alone or in combination with wt or mutant Ii were harvested and centrifuged onto slides using a Shandon (Pittsburgh, PA) Southern Cytospin, fixed in 95% ethanol at -20°C, and stained with L243 (DR) followed by goat anti-mouse FITC. Cells were visualized on a Leica (Deerfield, IL) microscope, and images were captured using a MCID Image Analysis System (Imaging Research) at x40.

 
Our findings raised the concern that the BAD-CLIP sequence may have sufficient affinity to mediate stable association with the DR1 peptide-binding site despite the inclusion of inappropriate anchors and data showing low affinity in peptide binding experiments with purified DR1. To address this concern, several C-terminal deletions were made before and after the CLIP region in wt and mutant Ii (Fig. 1GoC). It has been shown previously that C-terminal Ii deletion mutants up to, but not including, the CLIP region associate with class II heterodimers, suggesting that CLIP is essential for stable interaction (51, 52). We confirmed this observation by demonstrating that Ii(1–103) but not Ii(1–83) efficiently coprecipitate with DR1 (Fig. 3GoB). However, BAD(1–103) does not associate with DR1, demonstrating that the low-affinity BAD-CLIP sequence is insufficient to mediate assembly with DR in the absence of the Ii C-terminal region. These results imply that some portion of the C-terminal domain of Ii is able to complement the loss of affinity for the peptide-binding groove in full-length Ii.BAD-CLIP.

The Ii(103–117) region of Ii is required for CLIP-independent association with DR1

To identify the C-terminal domain of Ii responsible for association of BAD-Ii with DR1, a series of C-terminal deletions were generated (Fig. 1GoC) and cotransfected with DR1{alpha}ß into COS cells. By immunoprecipitation, we observed that each BAD-Ii C-terminal deletion mutant was able to associate with DR1 except for the shortest, BAD-Ii(1–103), implying that the 104–118 region is sufficient to complement the loss of affinity for the peptide-binding site (Fig. 5GoA). To further characterize the role of the 104–118 region, a series of wt Ii N-terminal deletions were generated that included signal peptides to direct translocation into the ER (Fig. 1GoC). Not only did the entire lumenal domain fragment (58–216), which contains the wt CLIP sequence, associate with DR1, but a shorter soluble fragment (103–216), which completely lacks a CLIP region, also associates with DR1 (Fig. 5GoB). This result clearly demonstrates that interactions involving the C-terminal domain of Ii can independently mediate stable association with DR. Further deletion of the 15-amino acid region (103–117) abrogates association, confirming that the region immediately C-terminal to CLIP is required for CLIP-independent binding (Fig. 5GoB).



View larger version (83K):
[in this window]
[in a new window]
  		FIGURE 5. The 103–117 region of Ii is required for CLIP-independent association with DR1. A, C-terminal truncations. B, N-terminal truncations (constructs contain the DRß signal sequence). COS cells were transfected with DR{alpha}ß and the indicated Ii construct. Cells were labeled for 30 min with 35[S]-trans Cys/Met, and precleared detergent lysates were split and immunoprecipitated with Tu36 (DR), In-1 (A, Ii N terminus), or Bu45 (B, Ii C terminus). The positions of the Ii bands are indicated by arrows.

 
Because fragment 103–117 is very close to the CLIP sequence, we considered the possibility that the physical orientation of Ii relative to DR may shift such that fragment 103–117 actually binds in the peptide-binding groove to mediate association with DR1. However, a synthetic Ii(103–118) peptide was observed to have very low affinity in competitive binding experiments with purified DR1 (Fig. 2GoB). To further address this possibility, we evaluated the ability of Ii(103–216) to associate with a class II molecule in which the peptide-binding site was occupied by a covalently tethered peptide. Ii(103–216) was observed to coprecipitate with IAb-E{alpha} complexes immunoprecipitated with the YAe mAb, which only recognizes IAb molecules containing the E{alpha} peptide in the peptide-binding groove (Fig. 6Go). The quantity of coprecipitated Ii fragment was relatively low but clearly detectable. It is possible that the covalent peptide linker partially interferes with Ii association or that mAb YAe has greater affinity for free IAb than IAb-Ii complexes. Nevertheless, we conclude that the 103–117 region of Ii interacts with class II molecules through a site outside of the peptide-binding groove.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 6. The Ii C-terminal domain binds stably to class II molecules with an occupied peptide-binding groove. COS cells were transfected with or without constructs encoding A{alpha}b, Aßb-E{alpha} and Ii(103–216). Cells were labeled for 30 min with 35[S]-trans Cys/Met, and precleared detergent lysates were split and immunoprecipitated with YAe (IAb-E{alpha}) or Bu45 (Ii). The arrow indicates the glycosylated form of Ii(103–216).

 
Generation and analysis of recombinant soluble C-terminal Ii fragments

To further investigate the binding of the Ii C-terminal domain to class II molecules, soluble His-tagged 103–216 and 118–216 fragments of Ii were expressed in E. coli, isolated by Ni-chelation, and further purified by ion exchange chromatography (Fig. 7Go). Chemical crosslinking showed that the fragments can trimerize (Fig. 7GoC and data not shown), as was previously demonstrated by Park et al. (53) for rIi(118–216).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 7. rIi(103–216) and Ii(118–216) C-terminal fragments. A, Schematic representation of human rIi fragments. B, Ion-exchange chromatography (Bio-Scale Q) of histidine-tagged fragment Ii(103–216) initially isolated on a Ni-chelated resin. A linear gradient from 0.02 to 1.0 M NaCl, 50 mM Tris (pH 7.0) was used, and the major peak was collected for further study. C, Coomassie-stained SDS-PAGE of rIi(103–216) cross-linked with various concentrations of BS3 [Bis(sulfosuccinimidyl) suberate].

 
Fluorescein (Fl)-labeled rIi(103–216) protein was observed to bind to purified DR1 by using HPSEC to separate bound from free protein (Fig. 8GoA). Binding was inhibited by excess unlabeled rIi(103–216) but not rIi(118–216), confirming that the 103–117 region is required. No inhibition was observed with a 100-fold excess of synthetic Ii(103–118). Thus, this sequence is essential but not sufficient for binding. The conclusion that association occurs through interactions outside of the peptide-binding groove was confirmed by the observation that the high affinity, synthetic Ii(89–100) M91Y peptide did not inhibit binding. The association kinetics were reasonably rapid, with apparent saturation within 5 h (Fig. 8GoB). The binding kinetics, not yet analyzed in detail, may be complicated because of the capacity of rIi(103–216) to form homotrimers. Saturable binding of biotin-labeled rIi(103–216) could also be measured using a europium fluorescence immunoassay, with an apparent equilibrium dissociation constant in the submicromolar range (Fig. 8GoD). It is interesting that the binding of the Ii C-terminal domain to DR1 is highly dependent on pH, with optimal binding at neutral pH and considerably reduced binding at acidic pH (Fig. 8GoC). Thus, the acidic environment present in endosomal compartments may directly contribute to the release of Ii by disrupting CLIP-independent interactions involving the C-terminal domain of Ii.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 8. Binding of rIi(103–216) to purified DR1. A, Unlabeled rIi(103–216), but not a high-affinity groove-binding peptide, or shorter fragments 118–216 and 103–118, inhibit binding of Fl-Ii(103–216) to DR1. Samples with or without 1 µM purified DR1 were incubated with 0.5 µM Fl-rIi(103–216) in 0.02% Nonidet P-40, 100 mM citrate/phosphate (pH 7.0) for 2 h at 37°C with various unlabeled competitors. DR1-Fl-Ii(103–216) complexes were quantified by HPSEC as described in Materials and Methods. B, Purified DR1 (1 µM) was incubated with 0.5 µM FITC-rIi(103–216) in 0.02% Nonidet P-40, 100 mM citrate/phosphate (pH 7.0) for the indicated time periods, and complexes were quantified as above. C, DR1 (1 µM) was incubated with 0.5 µM FITC-rIi(103–216) in 0.02% Nonidet P-40 containing 100 µM M91Y (89–100) peptide (to prevent groove binding) for 2 h at 37°C at the indicated pH, and complexes were quantified by HPSEC . D, Purified DR1 (50 nM) was incubated with the indicated concentration of biotin-rIi(103–216) in 0.2% Nonidet P-40, 100 mM citrate/phosphate (pH 7.0) for 18 h at 37°C. Bound biotin-rIi(103–216) was captured on microtiter assay plates coated with L243 (DR1) and quantified with europium-streptavidin fluorescence.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we observed that a mutant Ii protein, designed to have little or no affinity for the peptide-binding site of DR1, efficiently associates with DR1 and directs its transport to endosomal compartments in COS cell transfectants. The loss of affinity for the peptide-binding site was confirmed by the observation that a C-terminally truncated form of the Ii protein, BAD(1–103), which includes a mutant CLIP sequence, does not associate with DR1 in contrast to wt Ii(1–103). Thus, the wt but not the mutant CLIP region can mediate assembly of the membrane-anchored N-terminal fragment of Ii with DR. The ability of full-length Ii.BAD-CLIP to associate with DR1 suggested that the loss of affinity for the peptide-binding groove can be complemented by interactions involving the C-terminal domain of Ii. Cotransfection with C-terminally truncated forms of Ii.BAD-CLIP demonstrated that the Ii(104–117) region immediately adjacent to CLIP was required to complement loss of affinity for the peptide-binding site. Remarkably, a C-terminal fragment completely lacking the CLIP region, Ii(103–216), was observed to efficiently associate with DR1 in transfected cells. Furthermore, rIi(103–216) bound specifically to purified DR1. Ii(118–216) did not associate with DR1 in cotransfection studies or experiments with purified proteins, confirming a critical role of the (104–118) region.

We considered the possibility that the Ii(103–118) region may directly interact with the peptide-binding site, replacing the function of the CLIP sequence. Several observations excluded this possibility. A synthetic peptide representing this sequence did not bind to purified DR1 in competitive binding experiments, indicating that it has very low affinity for the peptide-binding site. Immunoprecipitation experiments with the YAe mAb, which only recognizes IAb containing the E{alpha} peptide in the peptide-binding groove (54), demonstrated that Ii(103–216) can associate with class II molecules in which the groove is occupied by a defined peptide. Finally, a 100-fold molar excess of a high-affinity DR1-binding peptide had no effect on the binding of rIi(103–216) to purified DR1. Thus, the C-terminal domain and the Ii(103–118) region must interact with a site in class II molecules outside the peptide-binding groove.

Previous studies with deletion mutants and C-terminally truncated Ii have demonstrated that the CLIP region can play a critical role in mediating the assembly of Ii with class II molecules in the ER (51, 52, 55). It is clear from the present study that interactions involving the Ii(103–118) region can compensate for a loss of affinity between CLIP and the peptide-binding site. It is likely that interactions involving other sites in Ii also participate in stabilizing {alpha}ßIi complexes. The observation that Ii(103–216), but not the synthetic Ii(103–118) peptide, binds DR1 suggests that other sites in the C terminus cooperate with 103–118. This is not likely to be a result of a conformational constraint placed on 103–118 in the context of the complete C-terminal domain because the 103–118 region is also required for binding of the 1–118 N-terminal fragment of Ii.BAD-CLIP, which lacks the remainder of the C terminus. Park et al. (53) have provided evidence for another interaction site in the C terminus by demonstrating that rIi(118–208) can enhance the binding of radiolabeled peptide Ag to DR1, implying a specific interaction. Our results indicate that this interaction is relatively weak compared with the binding of the larger Ii(103–216) C-terminal fragment. The results are in agreement with those of Newcomb et al. (56), who reported that a C-terminal fragment of Ii, beginning at Gly110, remains associated with DR after in vitro digestion of purified {alpha}ßIi with proteinase K. The 110–118 segment contains a predicted N-linked glycosylation site at position 114. However, the glycosylation mutant, Ii.BAD-CLIP(N114A), was observed to coprecipitate efficiently with DR1 (data not shown), indicating that carbohydrate at this position is not required for binding.

There is also strong evidence that an N-terminal segment adjacent to the core CLIP sequence contributes to the interaction of Ii with class II {alpha}ß (31, 57, 58, 59). Kropshofer and colleagues (57, 58) reported that N-terminal segment of CLIP, 81–89, which does not interact with pockets in the class II binding site (11), can facilitate the dissociation of CLIP from DR molecules. Stumptner and Benaroch (31) provided evidence that the Ii(81–90) region can influence the conformation of the peptide-binding site and enhance the DR association of various mutant Ii constructs with deletions or substitutions in the CLIP region. Most recently, Siebenkotten et al. (59) demonstrated coprecipitation of the Ii deletion mutant {Delta}88–127 but not {Delta}81–127 with DR in COS cell transfectants. This suggests that the 81–87 region may be able to complement the loss of interactions mediated by both the core sequence of CLIP, 91–99, and the 103–118 segment identified in the present study. However, it is clear from previous work (51, 52) and the present study that interactions involving Ii(81–87) are not sufficient to mediate stable association with class II {alpha}ß in the absence of other C-terminal regions of Ii. The C-terminal domain appears to make a quantitatively greater contribution given that Ii(103–216) binds to DR1 with high affinity to form stable complexes, whereas binding of Ii(1–103).BAD-CLIP cannot be detected.

It is likely that non-CLIP interactions play an extremely important role by providing a scaffolding that orients the core CLIP sequence into the peptide-binding groove. The fact that two interacting regions, Ii(103–118) and Ii(81–87), immediately flank the core CLIP sequence may provide a considerable advantage to Ii in competing with partially unfolded polypeptides or short peptides for occupying the peptide-binding site. It is likely that there are many polypeptides available in the ER with sequences that have affinities equal to or greater than that of CLIP for a given class II molecule. We suspect that these flanking interactions may also constrain the register within which CLIP interacts with pockets in the peptide-binding site. However, it remains to be proven that CLIP interacts with all class II molecules in the same register.

The pH dependence of the interactions between DR and the C-terminal fragment, Ii(103–216), suggests that the acidic environment of endosomal vesicles may contribute to the release of Ii from class II {alpha}ß. Acidic pH should reduce the overall stability of the {alpha}ßIi complex through its effects on C-terminal interactions, and it may increase the susceptibility of the C terminus to endopeptidases by releasing it from intimate association with {alpha}ß. The C-terminal domain is the site of initial proteolytic cleavage of {alpha}ßIi (7, 8, 9, 10). After release of the C terminus, the {alpha}ß-p12Ii complex becomes susceptible to DM-mediated release whether or not there is further proteolytic cleavage on the N-terminal side of CLIP (14, 60, 61, 62). It is not known whether the inability of DM to interact with intact {alpha}ßIi molecules (62) results from steric hindrance mediated by the Ii C terminus or from an indirect effect on the conformation of the class II molecule. In preliminary experiments, we found no evidence that rIi(103–216) inhibits DM-catalyzed peptide dissociation or exchange.

Given the capacity of Ii.BAD-CLIP to associate efficiently with DR1 and direct its transport to endosomal compartments, one must question the role of interactions between CLIP and the peptide-binding groove in Ii function. Our working hypothesis upon initiation of this study was that a major function of Ii is to provide a surrogate peptide (CLIP) to fill the peptide-binding site and stabilize class II molecules during initial folding in the ER and transport to endosomal compartments. Indeed, Zhong et al. (37) demonstrated that binding-site occupancy alone can be sufficient to facilitate the transport of newly synthesized class II molecules in COS cell transfectants. Class II heterodimers with unoccupied binding sites are relatively unstable and prone to aggregation (33, 34, 35, 36). However, it has recently been demonstrated that empty IEk molecules are surprisingly stable, with thermal melting transitions greater than many peptide-loaded MHC class I molecules (36). Thus, some class II molecules may have little dependence on binding-site occupancy for folding and transport. However, molecules such as IAb have a clear dependence on Ii for efficient folding and transport (17, 18, 19), but the exact role of Ii is unknown. It is possible that interactions outside the peptide-binding groove help to stabilize class II molecules in the ER. An attractive possibility is that occupancy of the peptide-binding site is important but there is no requirement for anchor-pocket interactions. The scaffolding function of Ii may orient CLIP in the peptide-binding site, allowing the network of hydrogen bonds to form between main chain atoms in CLIP and conserved residues in {alpha}ß as observed in {alpha}ß-peptide crystal structures (50). Non-CLIP interactions with Ii may stabilize this structure even if the binding-site pockets are not occupied by appropriate side chains. In support of this hypothesis, Sadegh-Nasseri et al. (35) demonstrated that short-lived peptide interactions (presumably lacking stable anchor-pocket interactions) can stabilize empty class II molecules. Non-CLIP interactions may stabilize {alpha}ßIi, maintaining binding-site occupancy even in class II molecules whose pockets cannot optimally accommodate the anchors available in the CLIP sequence.

It is evident that the CLIP sequence has been selected to play a special role as a promiscuous binder able to interact productively with all class II molecules despite extensive polymorphism in the peptide-binding site. The core sequence contains no side chains at anchor positions that prevent interaction with pockets differing in size, charge, and hydrophobicity through steric hindrance or charge repulsion. Thus charged and large aromatic residues are not present. Conversely, it is unlikely that CLIP can form highly stable complexes with any class II molecule because these amino acids are generally required to interact optimally with dominant pockets in the peptide-binding sites of different class II molecules. We suggest that CLIP has coevolved with class II molecules to be able to bind many class II molecules but none too well. The results of the present study indicate that there is no major detriment to having a CLIP sequence that interacts poorly with pockets in the peptide-binding site. By contrast, it would be extremely detrimental if CLIP bound very stably to a particular class II allele such that it was not efficiently removed in the DM-containing compartments of APC.


   Acknowledgments
 
We thank Dr. Claire-Anne Gutekunst for advice and Joe Moore for excellent technical assistance.


   Footnotes
 
1 This work was supported by National Institutes of Health Grants AI30554 and AI33614. Back

2 Address correspondence and reprint requests to Dr. Peter E. Jensen, Department of Pathology and Laboratory Medicine, Room 7309 Woodruff Memorial Building, Emory University School of Medicine, Atlanta, GA 30322. E-mail address: Back

3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated invariant chain peptide(s); ER, endoplasmic reticulum; Fl, fluorescein; HPSEC, high-performance size exclusion chromatography; wt, wild type; m, murine; h, human. Back

Received for publication August 4, 1998. Accepted for publication October 15, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ceman, S., A. J. Sant. 1995. The function of invariant chain in class II-restricted antigen presentation. Semin. Immunol. 7:373.[Medline]
  2. Pieters, J.. 1997. MHC class II restricted antigen presentation. Curr. Opin. Immunol. 9:89.[Medline]
  3. Jensen, P. E.. 1997. Peptide binding and antigen presentation by class II histocompatibility glycoproteins. Biopolymers 43:303.[Medline]
  4. Machamer, C. E., P. Cresswell. 1982. Biosynthesis and glycosylation of the invariant chain associated with HLA-DR antigens. J. Immunol. 129:2564.[Abstract]
  5. Kvist, S., K. Wilman, L. Claesson, P. A. Peterson, B. Dobberstein. 1982. Membrane insertion and oligomeric assembly of HLA-DR histocompatibility antigens. Cell 29:61.[Medline]
  6. Roche, P. A., M. S. Marks, P. Cresswell. 1991. Formation of a nine-subunit complex by HLA class II glycoproteins and the invariant chain. Nature 354:392.[Medline]
  7. Blum, J. S., P. Cresswell. 1988. Role for intracellular proteases in the processing and transport of class II HLA antigens. Proc. Natl. Acad. Sci. USA 85:3975.[Abstract/Free Full Text]
  8. Thomas, L. J., Q. V. Nguyen, W. L. Elliott, R. E. Humphreys. 1988. Proteolytic cleavage of Ii to p25. J. Immunol. 140:2670.[Abstract]
  9. Maric, M. A., M. D. Taylor, J. S. Blum. 1994. Endosomal aspartic proteinases are required for invariant-chain processing. Proc. Natl. Acad. Sci. USA 91:2171.[Abstract/Free Full Text]
  10. Riese, R. J., P. R. Wolf, D. Bromme, L. R. Natkin, J. A. Villadandos, H. L. Ploegh, H. A. Chapman. 1996. Essential role for cathepsin S in MHC class II-associated invariant chain processing and peptide loading. Immunity 4:357.[Medline]
  11. Ghosh, P., M. Amaya, E. Mellins, D. C. Wiley. 1995. The structure of an intermediate in class II MHC maturation: CLIP bound to HLA-DR3. Nature 378:457.[Medline]
  12. Sherman, M. A., D. A. Weber, P. E. Jensen. 1995. DM enhances peptide binding to class II MHC by release of invariant chain-derived peptide. Immunity 3:197.[Medline]
  13. Sloan, V. S., P. Cameron, G. Porter, M. Gammon, M. Amaya, E. Mellins, D. M. Zaller. 1995. Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature 375:802.[Medline]
  14. Denzin, L. K., P. Cresswell. 1995. HLA-DM induces CLIP dissociation from MHC class II {alpha}ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
  15. Anderson, M. S., J. Miller. 1992. Invariant chain can function as a chaperone protein for class II major histocompatibility complex molecules. Proc. Natl. Acad. Sci. USA 89:2282.[Abstract/Free Full Text]
  16. Layet, C., R. N. Germain. 1991. Invariant chain promotes egress of poorly expressed, haplotype-mismatched class II major histocompatibility complex A{alpha}Aß dimers from the endoplasmic reticulum/cis-Golgi compartment. Proc. Natl. Acad. Sci. USA 88:2346.[Abstract/Free Full Text]
  17. Viville, S., J. Neefjes, V. Lotteau, A. Dierich, M. LeMeur, H. Ploegh, C. Benoist, D. Mathis. 1993. Mice lacking the MHC class II-associated invariant chain. Cell 72:635.[Medline]
  18. Bikoff, E. K., L. Y. Huang, V. Episkopou, J. van Meerwijk, R. N. Germain, E. J. Robertson. 1993. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4+ T cell selection in mice lacking invariant chain expression. J. Exp. Med. 177:1699.[Abstract/Free Full Text]
  19. Elliott, E. A., J. R. Drake, S. Amigorena, J. Elsemore, P. Webster, I. Mellman, R. A. Flavell. 1994. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J. Exp. Med. 179:681.[Abstract/Free Full Text]
  20. Bikoff, E. K., R. N. Germain, E. J. Robertson. 1995. Allelic differences affecting invariant chain dependency of MHC class II subunit assembly. Immunity 2:301.[Medline]
  21. Bakke, O., B. Dobberstein. 1990. MHC class II-associated invariant chain contains a sorting signal for endosomal compartments. Cell 63:707.[Medline]
  22. Jr Loss, G. E., A. J. Sant. 1993. Invariant chain retains MHC class II molecules in the endocytic pathway. J. Immunol. 150:3187.[Abstract]
  23. Roche, P. A., P. Cresswell. 1990. Invariant chain association with HLA-DR molecules inhibits immunogenic peptide binding. Nature 345:615.[Medline]
  24. Teyton, L., D. O’Sullivan, P. W. Dickson, V. Lotteau, A. Sette, P. Fink, P. A. Peterson. 1990. Invariant chain distinguishes between the exogenous and endogenous antigen presentation pathways. Nature 348:39.[Medline]
  25. Busch, R., I. Cloutier, R. P. Sekaly, G. J. Hammerling. 1996. Invariant chain protects class II histocompatibility antigens from binding intact polypeptides in the endoplasmic reticulum. EMBO J. 15:418.[Medline]
  26. Peterson, M., J. Miller. 1990. Invariant chain influences the immunological recognition of MHC class II molecules. Nature 345:172.[Medline]
  27. Peterson, M., J. Miller. 1992. Antigen presentation enhanced by the alternatively spliced invariant chain gene product p41. Nature 357:596.[Medline]
  28. Bodmer, H., S. Viville, C. Benoist, D. Mathis. 1994. Diversity of endogenous epitopes bound to MHC class II molecules limited by invariant chain. Science 263:1284.[Abstract/Free Full Text]
  29. Momburg, F., S. Fuchs, J. Drexler, R. Busch, M. Post, G. J. Hammerling, L. Adorini. 1993. Epitope-specific enhancement of antigen presentation by invariant chain. J. Exp. Med. 178:1453.[Abstract/Free Full Text]
  30. Busch, R., I. Y. Vturina, J. Drexler, F. Momburg, G. J. Hammerling. 1995. Poor loading of major histocompatibility complex class II molecules with endogenously synthesized short peptides in the absence of invariant chain. Eur. J. Immunol. 25:48.[Medline]
  31. Stumptner, P., P. Benaroch. 1997. Interaction of MHC class II molecules with the invariant chain: role of the invariant chain (81–90) region. EMBO J. 16:5807.[Medline]
  32. Germain, R. N., L. R. Hendrix. 1991. MHC class II structure, occupancy and surface expression determined by post-endoplasmic reticulum antigen binding. Nature 353:134.[Medline]
  33. Stern, L. J., D. C. Wiley. 1992. The human class II MHC protein HLA-DR1 assembles as empty {alpha}ß heterodimers in the absence of antigenic peptide. Cell 68:465.[Medline]
  34. Germain, R. N., Jr A. G. Rinker. 1993. Peptide binding inhibits protein aggregation of invariant-chain free class II dimers and promotes surface expression of occupied molecules. Nature 363:725.[Medline]
  35. Sadegh-Nasseri, S., L. J. Stern, D. C. Wiley, R. N. Germain. 1994. MHC class II function preserved by low-affinity peptide interactions preceding stable binding. Nature 370:647.[Medline]
  36. Reich, Z., J. D. Altman, J. J. Boniface, D. S. Lyons, H. Kozono, G. Ogg, C. Morgan, M. M. Davis. 1997. Stability of empty and peptide-loaded class II major histocompatibility complex molecules at neutral and endosomal pH: comparison to class I proteins. Proc. Natl. Acad. Sci. USA 94:2495.[Abstract/Free Full Text]
  37. Zhong, G., F. Castellino, P. Romagnoli, R. N. Germain. 1996. Evidence that binding site occupancy is necessary and sufficient for effective major histocompatibility complex (MHC) class II transport through the secretory pathway redefines the primary function of class II-associated invariant chain peptides (CLIP). J. Exp. Med. 184:2061.[Abstract/Free Full Text]
  38. Sette, A., S. Southwood, J. Miller, E. Appella. 1995. Binding of major histocompatibility complex class II to the invariant chain-derived peptide, CLIP, is regulated by allelic polymorphism in class II. J. Exp. Med. 181:677.[Abstract/Free Full Text]
  39. Liang, M. N., C. Beeson, K. Mason, H. M. McConnell. 1995. Kinetics of the reactions between the invariant chain (85–99) peptide and proteins of the murine class II MHC. Int. Immunol. 7:1397.[Abstract/Free Full Text]
  40. Ignatowicz, L., G. Winslow, J. Bill, J. Kappler, P. Marrack. 1995. Cell surface expression of class II MHC proteins bound by a single peptide. J. Immunol. 154:3852.[Abstract]
  41. Cullen, B. R.. 1987. Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152:684.[Medline]
  42. Sherman, M. A., H. A. Runnels, J. C. Moore, L. J. Stern, P. E. Jensen. 1994. Membrane interactions influence the peptide binding behavior of DR1. J. Exp. Med. 179:229.[Abstract/Free Full Text]
  43. Lampson, L. A., R. Levy. 1980. Two populations of Ia-like molecules on a human cell line. J. Immunol. 125:293.[Abstract]
  44. Shaw, S., A. Zeigler, R. DeMars. 1985. Specificity of monoclonal antibodies directed against human and murine class II histocompatibility antigens as analyzed by binding to HLA-deletion mutant cell lines. Hum. Immunol. 12:191.[Medline]
  45. Murphy, D., D. Lo, S. Rath, R. Brinster, R. Flavell, A. Slanetz, C. Janeway. 1989. A novel MHC class II epitope expressed in thymic medulla but not cortex. Nature 338:765.[Medline]
  46. Lipp, J., B. Dobberstein. 1986. Signal recognition particle-dependent membrane insertion of mouse invariant chain: a membrane-spanning protein with a cytoplasmically exposed amino terminus. J. Cell Biol. 102:2169.[Abstract/Free Full Text]
  47. Weber, D. A., B. D. Evavold, P. E. Jensen. 1996. Enhanced dissociation of HLA-DR-bound peptides in the presence of HLA-DM. Science 274:618.[Abstract/Free Full Text]
  48. Jensen, P. E.. 1991. Enhanced binding of peptide antigen to purified class II major histocompatibility glycoproteins at acidic pH. J. Exp. Med. 174:1111.[Abstract/Free Full Text]
  49. Tompkins, S. M., P. A. Rota, J. C. Moore, P. E. Jensen. 1993. A europium fluoroimmunoassay for measuring binding of antigen to class II MHC glycoproteins. J. Immunol. Methods 163:209.[Medline]
  50. Stern, L. J., J. H. Brown, T. S. Jardetzky, J. C. Gorga, R. G. Urban, J. L. Strominger, D. C. Wiley. 1994. Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus peptide. Nature 368:215.[Medline]
  51. Bijlmakers, M. J., P. Benaroch, H. L. Ploegh. 1994. Mapping functional regions in the lumenal domain of the class II-associated invariant chain. J. Exp. Med. 180:623.[Abstract/Free Full Text]
  52. Romagnoli, P., R. N. Germain. 1994. The CLIP region of invariant chain plays a critical role in regulating major histocompatibility complex class II folding, transport, and peptide occupancy. J. Exp. Med. 180:1107.[Abstract/Free Full Text]
  53. Park, S. J., S. Sadegh-Nasseri, D. C. Wiley. 1995. Invariant chain made in Escherichia coli has an exposed N-terminal segment that blocks antigen binding to HLA-DR1 and a trimeric C-terminal segment that binds empty HLA-DR1. Proc. Natl. Acad. Sci. USA 92:11289.[Abstract/Free Full Text]
  54. Rudensky, A. Y., S. Rath, P. Preston-Hurlburt, D. B. Murphy, Jr C. A. Janeway. 1991. On the complexity of self. Nature 353:660.[Medline]
  55. Freisewinkel, I. M., K. Schenck, N. Koch. 1993. The segment of invariant chain that is critical for association with major histocompatibility complex class II molecules contains the sequence of a peptide eluted from class II polypeptides. Proc. Natl. Acad. Sci. USA 90:9703.[Abstract/Free Full Text]
  56. Newcomb, J. R., C. Carboy-Newcomb, P. Cresswell. 1996. Trimeric interactions of the invariant chain and its association with major histocompatibility complex class II {alpha}ß dimers. J. Biol. Chem. 271:24249.[Abstract/Free Full Text]
  57. Kropshofer, H., A. B. Vogt, G. J. Hammerling. 1995. Structural features of the invariant chain fragment CLIP controlling rapid release from HLA-DR molecules and inhibition of peptide binding. Proc. Natl. Acad. Sci. USA 92:8313.[Abstract/Free Full Text]
  58. Kropshofer, H., A. B. Vogt, L. J. Stern, G. J. Hammerling. 1995. Self-release of CLIP in peptide loading of HLA-DR molecules. Science 270:1357.[Abstract/Free Full Text]
  59. Siebenkotten, I. M., C. Carstens, N. Koch. 1998. Identification of a sequence that mediates promiscuous binding of invariant chain to MHC class II allotypes. J. Immunol. 160:3355.[Abstract/Free Full Text]
  60. Sanderson, F., C. Thomas, J. Neefjes, J. Trowsdale. 1996. Association between HLA-DM and HLA-DR in vivo. Immunity 4:87.[Medline]
  61. Stebbins, C. C., M. E. Peterson, W. M. Suh, A. J. Sant. 1996. DM-mediated release of a naturally occurring invariant chain degradation intermediate from MHC class II molecules. J. Immunol. 157:4892.[Abstract]
  62. Denzin, L. K., C. Hammond, P. Cresswell. 1996. HLA-DM interactions with intermediates in HLA-DR maturation and a role for HLA-DM in stabilizing empty HLA-DR molecules. J. Exp. Med. 184:2153.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Poult. Sci.Home page
H. Ye, F. Z. Xu, and W. Y. Yu
The intracellular localization and oligomerization of chicken invariant chain with major histocompatibility complex class II subunits
Poult. Sci., August 1, 2009; 88(8): 1594 - 1600.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Honey, K. Forbush, P. E. Jensen, and A. Y. Rudensky
Effect of Decreasing the Affinity of the Class II-Associated Invariant Chain Peptide on the MHC Class II Peptide Repertoire in the Presence or Absence of H-2M1
J. Immunol., April 1, 2004; 172(7): 4142 - 4150.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. H. Koonce, G. Wutz, E. J. Robertson, A. B. Vogt, H. Kropshofer, and E. K. Bikoff
DM Loss in k Haplotype Mice Reveals Isotype-Specific Chaperone Requirements
J. Immunol., April 1, 2003; 170(7): 3751 - 3761.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Q. Ye, P. W. Finn, R. Sweeney, E. K. Bikoff, and R. J. Riese
MHC Class II-Associated Invariant Chain Isoforms Regulate Pulmonary Immune Responses
J. Immunol., February 1, 2003; 170(3): 1473 - 1480.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms
Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes
PNAS, September 26, 2001; (2001) 221220998.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. K. Bikoff, G. Wutz, G. A. Kenty, C. H. Koonce, and E. J. Robertson
Relaxed DM Requirements During Class II Peptide Loading and CD4+ T Cell Maturation in BALB/c Mice
J. Immunol., April 15, 2001; 166(8): 5087 - 5098.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. S. Arneson, M. Peterson, and A. J. Sant
The MHC Class II Molecule I-Ag7 Exists in Alternate Conformations That Are Peptide Dependent
J. Immunol., August 15, 2000; 165(4): 2059 - 2067.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. B. Ashman and J. Miller
A Role for the Transmembrane Domain in the Trimerization of the MHC Class II-Associated Invariant Chain
J. Immunol., September 1, 1999; 163(5): 2704 - 2712.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms
Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes
PNAS, October 9, 2001; 98(21): 12168 - 12173.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thayer, W. P.
Right arrow Articles by Jensen, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thayer, W. P.
Right arrow Articles by Jensen, P. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS