|
|
||||||||

*
Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA 30322; and
Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, GA 39912
| Abstract |
|---|
|
|
|---|
ßIi complexes through its
interaction with the class II peptide-binding site. The role of the
CLIP sequence was investigated by using mutant Ii molecules with
altered affinity for the DR1 peptide-binding site. Both high- and
low-affinity mutants were observed to efficiently assemble with DR1 and
mediate transport to endosomal compartments in COS cell transfectants.
Using N- and C-terminal truncations, a region adjacent to CLIP within
Ii(103118) was identified that can complement loss of affinity for
the peptide-binding site in mediating efficient assembly of
ßIi. A
C-terminal fragment completely lacking the CLIP region, Ii(103216),
was observed binding stably to class II molecules in
immunoprecipitation studies and experiments with purified proteins. The
Ii(103118) region was required for this binding, which occurs through
interactions outside of the
ß peptide-binding groove. We conclude
that strong interactions involving Ii(103118) and other regions of Ii
cooperate in the assembly of functional
ßIi under conditions where
CLIP has little or no affinity for the class II peptide-binding site.
Our results support the hypothesis that the CLIP sequence has evolved
to avoid high-stability interactions with the peptide-binding sites of
MHC class II molecules rather than as a promiscuous binder with
moderate affinity for all class II molecules. | Introduction |
|---|
|
|
|---|
ß
heterodimers in the endoplasmic reticulum (ER) (4, 5) to form nonameric
complexes (6) that are transported through the Golgi and targeted to
endosomal compartments. Ii is released after sequential cleavage by
endopeptidases (7, 8, 9, 10), leaving only a fragment encoded by exon 3,
class II-associated invariant chain peptides (CLIP), which is protected
from proteases because it is largely buried in the peptide-binding
groove (11). This last fragment is removed by HLA-DM, which catalyzes
peptide-exchange reactions in class II molecules (12, 13, 14). Ii
facilitates the initial assembly and transport of
ß heterodimers
(15, 16, 17, 18, 19, 20), and its cytoplasmic domain plays a dominant role in endosomal
targeting and retention (21, 22). Ii also prevents premature peptide
loading in the early secretory pathway (23, 24, 25), and it influences the
repertoire of peptides that bind class II molecules in endosomal
compartments (17, 26, 27, 28, 29, 30).
Though unproved, there is good reason to believe that CLIP occupies the
peptide-binding groove in intact
ßIi complexes. MHC class II
intermediates accumulate in DM-deficient cells with CLIP fragments
bound in a manner completely analogous to peptide Ags (11). Complexes
with mutant Ii proteins containing a CLIP sequence designed to have
high affinity for the peptide-binding site can be stable in SDS (31), a
property conferred by occupancy of the binding site (32). This would
explain the inability of
ßIi to bind peptide Ags. Class II
molecules with unoccupied binding sites are less stable and more likely
to misfold and denature (33, 34, 35, 36). Thus, binding-site occupancy may be
the mechanism through which Ii promotes the folding and early transport
of some class II heterodimers. Indeed, Zhong et al. (37) demonstrated
that groove occupancy alone is sufficient for promoting transport of
class II molecules through the secretory pathway. Given the apparent
importance of binding-site occupancy, it is remarkable that the
conserved sequence of CLIP can appropriately interact with all class II
molecules despite extensive polymorphism in the binding site. Class II
molecules have been shown to differ widely in their affinities for CLIP
(38, 39).
The present study was initiated to investigate the role of the CLIP
sequence and its affinity for the peptide-binding site in mediating
assembly and transport of
ßIi complexes. The results indicate that
a mutant Ii protein containing a CLIP sequence designed to have very
low affinity for DR1 efficiently assembles with DR1 and mediates its
transport to endosomal compartments. The loss of affinity for the
peptide-binding site is complemented by other interactions involving a
segment of Ii on the C-terminal side of CLIP. We demonstrate that a
C-terminal fragment of Ii binds stably to a site in class II molecules
outside the peptide-binding groove, with no requirement for the
N-terminal or CLIP regions of Ii. These results support the conclusion
that no minimal affinity for the peptide-binding site is required for
the assembly and transport of class II-Ii complexes, consistent with
the ability of Ii to regulate the transport of all class II molecules
regardless of affinity for CLIP.
| Materials and Methods |
|---|
|
|
|---|
All mammalian expression constructs were cloned into pCDNA3.1
Zeo (Qiagen, Valencia, CA), and genes were sequenced. The DR
- and
ß-chains, generously provided by Dr. Eric Long (National
Institute of Allergy and Infectious Diseases (NIAID), National
Institutes of Health, Bethesda, MD) in vector CDM8, were subcloned into
pCDNA3.1 Zeo using 5' blunt and 3' XhoI digested PCR
product generated with the following primers: forward:
-F,
5'-GAAGAAAATGGCCATAAGTGGAGTCC and ß-F,
5'-CAGCATGGTGTGTCTGAAGCTCCTG; reverse: CDM8-R,
5'-TCCCTCGAGGTCACACCACAGAAGTAAGG. A
b in pcEXV-3 was
the kind gift of Dr. Ronald Germain (NIAID, Bethesda, MD) and was
cloned into pCDNA3.1 Zeo using two primers (forward,
5'-GGCAAGCTTGGTACCGTTACTTCTGCTCTAAAAGC; and reverse,
5'-ATAAGAATGCGGCCGCCTCGAGATTCTAGTTGTGGTTTGTCC) followed by
digestion with KpnI and XhoI.
Aßb-E
(40) in ptZ was subcloned using existing
EcoRI sites.
The human Iip33/35 construct was also provided by Dr. Eric Long. Using overlapping PCR, the murine Ii (mIi) cytoplasmic domain (mIip31-pcEXV-3 construct provided by Dr. Jim Miller, University of Chicago, Chicago, IL) was engineered onto the human version with the following primers: pcEXV-3-F, 5'-GGAAGTGGTACCTCTGCTCTAAAAGC with hIi.mcyt-R 5'-GCTCCACGGCTGCACCTTTC and hIi.mcyt-F 5'-GAAAGGTGCAGCCGTGGAGCCCTGTACACAGGC with hIi.polyA-R 5'-CTAATCTCGAGCTTTTATTCTAATGTGAACCATGGC, followed by a fusion using the end set of primers in Taq-based overlapping PCR. This construct was then digested with KpnI and XhoI and ligated into pcDNA3.1 Zeo. These same end primers were used to fuse all full-length Ii mutants constructs, and the hybrid Ii was used as template for both Ii mutants. For the BAD-Ii construct, the internal forward primer was 5'-CGGTCGCGCACCACGCTCCTGGAGCAGGCGCTGCCCATGGGAGCC, while the internal reverse primer was 5'-GAGCGTGGTGCGCGACCGCGACTTGCTCACAGGCTTGGG. For the M91Y-Ii construct, the internal forward primer was 5'-TGAGCAAGTACCGCATGGCCACCCCGCTGCTGATG, while the internal reverse primer was 5'-GCCATGCGGTACTTGCTCACAGGCTTGGGAGGC. The fusion reaction and ligation were conducted as above.
To generate C-terminal Ii truncations, stop codons followed by 3' XhoI sites were inserted after positions 83K, 103P, 118Y, 143K, 163K, and 183E using PCR techniques. For N-terminal truncations, the DRß signal sequence was engineered using a DRß fusion piece derived from primers: pcDNA3.1 Zeo vector primer T7-F, 5'-TAATACGACTCACTATAGGG, and DRßsig-R, 5'-AGCCAAAGCCAGTGGGGAGCTCAG on vector DRß-pcDNA3.1.Zeo, and fused with Ii fragments generated with the following primers: (58216)-F, 5'-GCTCCCCACTGGCTTTGGCTCAGCAGGGCCGGCTGGACAAACTG ; (103216)-F, 5'-GCTCCCCACTGGCTTTGGCTCCCATGGGAGCCCTGCCCCAGGGGCCCATGC; or (118216)-F, 5'-GCTCCCCACTGGCTTTGGCTTATGGCAACATGACAGAGGACC, each with hIi.polyA-R. The end primers for the fusion reaction were T7-F and hIi.polyA-R, resulting in cDNAs with 5' KpnI and 3' XhoI sites for digestion and ligation.
Ii ectodomain constructs were generated using the BamHI-enterokinase encoding Ii primers (103216)-F 5'-ACCGGATCCGATGACGATGACAAACCCATGGGAGCCCTGCCCCAGGGGCCCATGC; (118216)F 5'-GGCGGATCCGATGACGATGACAAATATGGCAACATGACAGAGGACC, and the SalI encoding reverse primer, 5'-GGCGCAGTCGACTCACATGGGGACTGGGCCCAGATCCTGCTTG. PCR fragments were digested and ligated into the overexpression vector pQE9 from Qiagen.
Transient expression
COS 7.2 cells were transiently transfected with cDNA constructs
using the DEAE-dextran method as described (41). Briefly, 5
x 105 cells were plated per 60-mm tissue culture dish with
DMEM and 10% FCS 24 h before transfection. Cells were washed
twice with DMEM and 10 mM HEPES, and each dish was incubated in 2 ml of
DMEM and 10 mM HEPES containing 500 µg of DEAE-dextran, 100 µM
chloroquine, and DNA (0.5 µg of each class II
- and ß-chain
construct ±1.0 µg of various Ii constructs). After 3 h at
37°C, the cells were treated with 10% DMSO in DMEM and 10 mM HEPES
for 12 min at room temperature, then incubated 46 h in DMEM and
10% FCS before use in immunoprecipitation or immunofluorescence
experiments.
Metabolic radiolabeling, immunoprecipitation, and gel electrophoresis
Transfected COS plates were each washed twice and Cys/Met depleted for 30 min at 37°C with 3 ml of Met/Cys-deficient DMEM-5% dialyzed FCS, then labeled for 30 min in 2 ml Met/Cys-deficient DMEM-5% dialyzed FCS medium containing 0.05 mCi/ml of 35[S]-trans Cys/Met (Trans35S-Label, ICN Pharmaceuticals, Irvine, CA). Plates were subsequently washed, harvested by trypsinization, and lysed on ice for 1 h in 0.5% Nonidet P-40 lysis buffer, 0.15 M NaCl, 50 mM Tris (pH 7.5), 0.01% Azide, and a protease inhibitor mixture (42). The precleared detergent lysates were split and immunoprecipitated with mAb prebound to protein A- or G-Sepharose beads (Sigma, St. Louis, MO) for 1 h, rocking at 4°C. Beads were preloaded by incubating 1.0 ml of supernatant or 10 µg of purified mAb with 40-µl beads for 1 h, rocking at 4°C, then washed three times in PBS. After incubating with lysates, beads were washed four times with 500 µl of 0.2% Nonidet P-40 wash buffer, 0.15 M NaCl, 50 mM Tris (pH 7.0), and 0.5 mM EDTA. Samples were eluted with 2% SDS and 5% 2-ME buffer by boiling 5 min and resolved using 12% polyacrylamide gels.
Immunofluorescence
Transfected COS were harvested by trypsinization and centrifuged onto slides using a Shandon Southern Cytospin, fixed in 95% ethanol at -20°C, and stained with L243 (DR) followed by goat anti-mouse FITC. Cells were visualized on a Leica microscope and captured using a MCID Image Analysis System (Imaging Research, Ontario, Canada) at x40.
Purification of Ii ectodomains
Escherichia coli strain, XL1-Blue (Stratagene, La Jolla, CA), was transformed with each pQE-9 construct. Bacteria were incubated at 37°C in LB broth containing 50 µg/ml of ampicillin, and protein expression was induced with 1 mM isopropyl ß-D-thiogalactoside at OD600 of 0.4. Four hours after induction, cells were harvested, and the bacterial pellet was resuspended in PBS with protease inhibitors. The cells were sonicated, and the lysate was cleared for 10 min at 10,000 x g. Cleared lysate from 800 ml of induced culture was mixed with 2 ml of Ni-nitrilotriacetic acid (NTA) resin (Qiagen). The resin was washed four times with PBS containing 10 mM imidazole and eluted in PBS and 250 mM imidazole. Ion-exchange chromatography of histidine-tagged fragments was performed using a Bio-Scale Q2 anion exchange column (Bio-Rad, Hercules, CA) and Bio-Rad Biologic high resolution liquid chromatography system. A linear gradient from 0.02 to 1.0 M NaCl and 50 mM Tris (pH 7.0) was used, and the major peak was collected for further study. Purified proteins were labeled with either fluorescein isothiocyanate or biotinamidocaproate N-hydroxysuccinimide ester. Briefly, either reagent, dissolved in DMSO at 2 mg/ml, was added to the PBS-dialyzed protein at a 2:1 molar ratio, rocking 1 h at room temperature. The reaction was terminated by the addition of Tris (pH 8.0) for 10 min followed by dialysis.
Abs, DR, DM, and peptides
The mAbs L243 (43), Tu36 (44), YAe (45), and IN-1 (46) were all
purified from hybridoma supernatant using protein A- or G-Sepharose
affinity chromatography. Bu45 was obtained from The Binding Site
(Birmingham, U.K.). HLA-DR1 and HLA-DM were purified as previously
described (47). Peptides were synthesized by fluorenyl methoxycarbonyl
chemistry with a Ranin Instruments (Emoryville, CA) Symphony multiple
peptide synthesizer, and certain ones were labeled with a biotin at the
-amino group before or after deprotection and cleavage by reaction
with biotin-amido caproate N-hydroxysuccinimide as described
(48).
Binding assays
Peptide affinity for DR1 was measured by competition inhibition assays in which 50 nM DR1 was incubated with 0.5 µM biotin-CLIP(81104) or various concentrations of biotin-rIi(103216) in 0.2% Nonidet P-40, 100 mM citrate/phosphate (pH 5.0) for 18 h at 37°C with varying concentrations of competitor peptide. After incubation, the samples were captured on microtiter assay plates coated with L243, and biotinylated ligand binding to DR1 was quantified with europium-streptavidin fluorescence as described (49).
Binding of FITC-rIi(103216) to DR1 was also assessed using high-performance size-exclusion chromatography (HPSEC) as described for FITC peptide (47). Briefly, samples with or without 1 µM purified DR1 were incubated with 0.5 µM FITC-rIi(103216) in 0.02% Nonidet P-40, and 100 mM citrate/phosphate (pH 7.0) for 2 h at 37°C with various competitor ligands. After incubation, 10 µl of each sample was removed and DR1-FITC-Ii(103216) complexes were quantified with a Tosohaas (Montgomeryville, CA) TSK GFC 200 HPSEC column (7.8 x 150 mm) and Shimadzu (Columbia, MD) RF-10A fluorometer with 490-nm excitation and detection at 520 nm. The column buffer was 50 mM phosphate, 150 mM NaCl, and 0.2 mM dodecyl ß-D-maltoside (pH 7.0). DR-bound complexes eluted between 2.6 and 3.35 min with a flow rate of 1 ml/min. Any modifications to this protocol are indicated in the figure legends.
| Results |
|---|
|
|
|---|
To investigate the role of CLIP affinity for the class II
peptide-binding site in Ii function, variants were generated in which
the sequence of CLIP was mutated to decrease or increase its affinity
for DR1. The low-affinity sequence (BAD-CLIP) has five substitutions at
anchor positions (11) designed to substantially reduce affinity for
DR1, which strongly prefers peptides with a large hydrophobic residue
in the dominant pocket, P1 (50) (Fig. 1
A). Positively charged Arg at
P4 should be disfavored because of charge repulsion from Arg ß71, and
Thr is not optimally accommodated in the shallow P6 pocket (50).
Similarly, Glu is inappropriate for the environment provided by the
hydrophobic P9 pocket. A synthetic BAD-CLIP peptide was observed to
have a substantially reduced affinity for DR1 as determined in
competition-inhibition binding assays (Fig. 2
A). The high affinity mutant
CLIP sequence (M91Y) was previously shown to increase the stability of
the DR1-peptide complex by
160-fold, despite having little effect on
the apparent affinity measured in competition assays (47) (Fig. 2
A). Full-length mutant human p31 Ii cDNA constructs,
encoding the mouse Ii cytoplasmic domain as a marker, were generated by
site-directed mutagenesis and cloned into a mammalian cell expression
vector (Fig. 1
B). Expression was confirmed in metabolically
labeled COS cell transfectants by immunoprecipitation with mAb specific
for the cytoplasmic tail of mIi, IN-1 (Fig. 3
A, lowerpanel).
|
|
|
Ii mutants were coexpressed in COS cells with human class II
DR1
and ß-chains, and proteins from pulse-labeled cells were
precipitated using mAbs specific for either DR1 (Tu36) or IN-1 (Ii). Ii
and Ii.M91Y associate efficiently with DR1, as expected (Fig. 3
A). Surprisingly, Ii.BAD-CLIP was also observed to
efficiently coprecipitate with DR1. The capacity of the mutant Ii
proteins to facilitate the transport and targeting of DR to endosomal
compartments was analyzed by immunofluorescence. In the absence of Ii,
DR fluorescence is distributed in a fine reticular pattern (Fig. 4
). DR is redistributed to endosomal
compartments characterized by a discrete vesicular staining pattern
after cotransfection with Ii. Both the high- and low-affinity mutant Ii
proteins were also able to target DR to the endosomal pathway (Fig. 4
).
These results suggest that the affinity of the CLIP region has little,
if any, impact on the capacity of Ii to associate with DR and direct
its transport to Ag-processing compartments.
|
The Ii(103117) region of Ii is required for CLIP-independent association with DR1
To identify the C-terminal domain of Ii responsible for
association of BAD-Ii with DR1, a series of C-terminal deletions were
generated (Fig. 1
C) and cotransfected with DR1
ß into
COS cells. By immunoprecipitation, we observed that each BAD-Ii
C-terminal deletion mutant was able to associate with DR1 except for
the shortest, BAD-Ii(1103), implying that the 104118 region is
sufficient to complement the loss of affinity for the peptide-binding
site (Fig. 5
A). To further
characterize the role of the 104118 region, a series of wt Ii
N-terminal deletions were generated that included signal peptides to
direct translocation into the ER (Fig. 1
C). Not only did the
entire lumenal domain fragment (58216), which contains the wt CLIP
sequence, associate with DR1, but a shorter soluble fragment
(103216), which completely lacks a CLIP region, also associates with
DR1 (Fig. 5
B). This result clearly demonstrates that
interactions involving the C-terminal domain of Ii can independently
mediate stable association with DR. Further deletion of the 15-amino
acid region (103117) abrogates association, confirming that the
region immediately C-terminal to CLIP is required for CLIP-independent
binding (Fig. 5
B).
|
complexes immunoprecipitated with the YAe mAb, which only recognizes
IAb molecules containing the E
peptide in the
peptide-binding groove (Fig. 6
|
To further investigate the binding of the Ii C-terminal domain to
class II molecules, soluble His-tagged 103216 and 118216 fragments
of Ii were expressed in E. coli, isolated by Ni-chelation,
and further purified by ion exchange chromatography (Fig. 7
). Chemical crosslinking showed that the
fragments can trimerize (Fig. 7
C and data not shown), as was
previously demonstrated by Park et al. (53) for rIi(118216).
|
|
| Discussion |
|---|
|
|
|---|
We considered the possibility that the Ii(103118) region may directly
interact with the peptide-binding site, replacing the function of the
CLIP sequence. Several observations excluded this possibility. A
synthetic peptide representing this sequence did not bind to purified
DR1 in competitive binding experiments, indicating that it has very low
affinity for the peptide-binding site. Immunoprecipitation experiments
with the YAe mAb, which only recognizes IAb containing the
E
peptide in the peptide-binding groove (54), demonstrated that
Ii(103216) can associate with class II molecules in which the groove
is occupied by a defined peptide. Finally, a 100-fold molar excess of a
high-affinity DR1-binding peptide had no effect on the binding of
rIi(103216) to purified DR1. Thus, the C-terminal domain and the
Ii(103118) region must interact with a site in class II molecules
outside the peptide-binding groove.
Previous studies with deletion mutants and C-terminally truncated Ii
have demonstrated that the CLIP region can play a critical role in
mediating the assembly of Ii with class II molecules in the ER (51, 52, 55). It is clear from the present study that interactions involving the
Ii(103118) region can compensate for a loss of affinity between CLIP
and the peptide-binding site. It is likely that interactions involving
other sites in Ii also participate in stabilizing
ßIi complexes.
The observation that Ii(103216), but not the synthetic Ii(103118)
peptide, binds DR1 suggests that other sites in the C terminus
cooperate with 103118. This is not likely to be a result of a
conformational constraint placed on 103118 in the context of the
complete C-terminal domain because the 103118 region is also required
for binding of the 1118 N-terminal fragment of Ii.BAD-CLIP, which
lacks the remainder of the C terminus. Park et al. (53) have provided
evidence for another interaction site in the C terminus by
demonstrating that rIi(118208) can enhance the binding of
radiolabeled peptide Ag to DR1, implying a specific interaction. Our
results indicate that this interaction is relatively weak compared with
the binding of the larger Ii(103216) C-terminal fragment. The results
are in agreement with those of Newcomb et al. (56), who reported that a
C-terminal fragment of Ii, beginning at Gly110, remains associated with
DR after in vitro digestion of purified
ßIi with proteinase K. The
110118 segment contains a predicted N-linked glycosylation
site at position 114. However, the glycosylation mutant,
Ii.BAD-CLIP(N114A), was observed to coprecipitate efficiently with DR1
(data not shown), indicating that carbohydrate at this position is not
required for binding.
There is also strong evidence that an N-terminal segment adjacent to
the core CLIP sequence contributes to the interaction of Ii with class
II
ß (31, 57, 58, 59). Kropshofer and colleagues (57, 58) reported
that N-terminal segment of CLIP, 8189, which does not interact with
pockets in the class II binding site (11), can facilitate the
dissociation of CLIP from DR molecules. Stumptner and Benaroch (31)
provided evidence that the Ii(8190) region can influence the
conformation of the peptide-binding site and enhance the DR association
of various mutant Ii constructs with deletions or substitutions in the
CLIP region. Most recently, Siebenkotten et al. (59) demonstrated
coprecipitation of the Ii deletion mutant
88127 but not
81127
with DR in COS cell transfectants. This suggests that the 8187 region
may be able to complement the loss of interactions mediated by both the
core sequence of CLIP, 9199, and the 103118 segment
identified in the present study. However, it is clear from previous
work (51, 52) and the present study that interactions involving
Ii(8187) are not sufficient to mediate stable association with class
II
ß in the absence of other C-terminal regions of Ii. The
C-terminal domain appears to make a quantitatively greater contribution
given that Ii(103216) binds to DR1 with high affinity to form stable
complexes, whereas binding of Ii(1103).BAD-CLIP cannot be detected.
It is likely that non-CLIP interactions play an extremely important role by providing a scaffolding that orients the core CLIP sequence into the peptide-binding groove. The fact that two interacting regions, Ii(103118) and Ii(8187), immediately flank the core CLIP sequence may provide a considerable advantage to Ii in competing with partially unfolded polypeptides or short peptides for occupying the peptide-binding site. It is likely that there are many polypeptides available in the ER with sequences that have affinities equal to or greater than that of CLIP for a given class II molecule. We suspect that these flanking interactions may also constrain the register within which CLIP interacts with pockets in the peptide-binding site. However, it remains to be proven that CLIP interacts with all class II molecules in the same register.
The pH dependence of the interactions between DR and the C-terminal
fragment, Ii(103216), suggests that the acidic environment of
endosomal vesicles may contribute to the release of Ii from class II
ß. Acidic pH should reduce the overall stability of the
ßIi
complex through its effects on C-terminal interactions, and it may
increase the susceptibility of the C terminus to endopeptidases by
releasing it from intimate association with
ß. The C-terminal
domain is the site of initial proteolytic cleavage of
ßIi (7, 8, 9, 10).
After release of the C terminus, the
ß-p12Ii complex becomes
susceptible to DM-mediated release whether or not there is further
proteolytic cleavage on the N-terminal side of CLIP (14, 60, 61, 62). It is
not known whether the inability of DM to interact with intact
ßIi
molecules (62) results from steric hindrance mediated by the Ii C
terminus or from an indirect effect on the conformation of the class II
molecule. In preliminary experiments, we found no evidence that
rIi(103216) inhibits DM-catalyzed peptide dissociation or exchange.
Given the capacity of Ii.BAD-CLIP to associate efficiently with DR1 and
direct its transport to endosomal compartments, one must question the
role of interactions between CLIP and the peptide-binding groove in Ii
function. Our working hypothesis upon initiation of this study was that
a major function of Ii is to provide a surrogate peptide (CLIP) to fill
the peptide-binding site and stabilize class II molecules during
initial folding in the ER and transport to endosomal compartments.
Indeed, Zhong et al. (37) demonstrated that binding-site occupancy
alone can be sufficient to facilitate the transport of newly
synthesized class II molecules in COS cell transfectants. Class II
heterodimers with unoccupied binding sites are relatively unstable and
prone to aggregation (33, 34, 35, 36). However, it has recently been
demonstrated that empty IEk molecules are surprisingly
stable, with thermal melting transitions greater than many
peptide-loaded MHC class I molecules (36). Thus, some class II
molecules may have little dependence on binding-site occupancy for
folding and transport. However, molecules such as IAb have
a clear dependence on Ii for efficient folding and transport (17, 18, 19),
but the exact role of Ii is unknown. It is possible that interactions
outside the peptide-binding groove help to stabilize class II molecules
in the ER. An attractive possibility is that occupancy of the
peptide-binding site is important but there is no requirement for
anchor-pocket interactions. The scaffolding function of Ii may orient
CLIP in the peptide-binding site, allowing the network of hydrogen
bonds to form between main chain atoms in CLIP and conserved residues
in
ß as observed in
ß-peptide crystal structures (50).
Non-CLIP interactions with Ii may stabilize this structure even if the
binding-site pockets are not occupied by appropriate side chains. In
support of this hypothesis, Sadegh-Nasseri et al. (35) demonstrated
that short-lived peptide interactions (presumably lacking stable
anchor-pocket interactions) can stabilize empty class II molecules.
Non-CLIP interactions may stabilize
ßIi, maintaining binding-site
occupancy even in class II molecules whose pockets cannot optimally
accommodate the anchors available in the CLIP sequence.
It is evident that the CLIP sequence has been selected to play a special role as a promiscuous binder able to interact productively with all class II molecules despite extensive polymorphism in the peptide-binding site. The core sequence contains no side chains at anchor positions that prevent interaction with pockets differing in size, charge, and hydrophobicity through steric hindrance or charge repulsion. Thus charged and large aromatic residues are not present. Conversely, it is unlikely that CLIP can form highly stable complexes with any class II molecule because these amino acids are generally required to interact optimally with dominant pockets in the peptide-binding sites of different class II molecules. We suggest that CLIP has coevolved with class II molecules to be able to bind many class II molecules but none too well. The results of the present study indicate that there is no major detriment to having a CLIP sequence that interacts poorly with pockets in the peptide-binding site. By contrast, it would be extremely detrimental if CLIP bound very stably to a particular class II allele such that it was not efficiently removed in the DM-containing compartments of APC.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Peter E. Jensen, Department of Pathology and Laboratory Medicine, Room 7309 Woodruff Memorial Building, Emory University School of Medicine, Atlanta, GA 30322. E-mail address: ![]()
3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated invariant chain peptide(s); ER, endoplasmic reticulum; Fl, fluorescein; HPSEC, high-performance size exclusion chromatography; wt, wild type; m, murine; h, human. ![]()
Received for publication August 4, 1998. Accepted for publication October 15, 1998.
| References |
|---|
|
|
|---|
ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
Aß dimers from the endoplasmic reticulum/cis-Golgi compartment. Proc. Natl. Acad. Sci. USA 88:2346.
ß heterodimers in the absence of antigenic peptide. Cell 68:465.[Medline]
ß dimers. J. Biol. Chem. 271:24249.This article has been cited by other articles:
![]() |
H. Ye, F. Z. Xu, and W. Y. Yu The intracellular localization and oligomerization of chicken invariant chain with major histocompatibility complex class II subunits Poult. Sci., August 1, 2009; 88(8): 1594 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Honey, K. Forbush, P. E. Jensen, and A. Y. Rudensky Effect of Decreasing the Affinity of the Class II-Associated Invariant Chain Peptide on the MHC Class II Peptide Repertoire in the Presence or Absence of H-2M1 J. Immunol., April 1, 2004; 172(7): 4142 - 4150. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Koonce, G. Wutz, E. J. Robertson, A. B. Vogt, H. Kropshofer, and E. K. Bikoff DM Loss in k Haplotype Mice Reveals Isotype-Specific Chaperone Requirements J. Immunol., April 1, 2003; 170(7): 3751 - 3761. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ye, P. W. Finn, R. Sweeney, E. K. Bikoff, and R. J. Riese MHC Class II-Associated Invariant Chain Isoforms Regulate Pulmonary Immune Responses J. Immunol., February 1, 2003; 170(3): 1473 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes PNAS, September 26, 2001; (2001) 221220998. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Bikoff, G. Wutz, G. A. Kenty, C. H. Koonce, and E. J. Robertson Relaxed DM Requirements During Class II Peptide Loading and CD4+ T Cell Maturation in BALB/c Mice J. Immunol., April 15, 2001; 166(8): 5087 - 5098. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Arneson, M. Peterson, and A. J. Sant The MHC Class II Molecule I-Ag7 Exists in Alternate Conformations That Are Peptide Dependent J. Immunol., August 15, 2000; 165(4): 2059 - 2067. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Ashman and J. Miller A Role for the Transmembrane Domain in the Trimerization of the MHC Class II-Associated Invariant Chain J. Immunol., September 1, 1999; 163(5): 2704 - 2712. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes PNAS, October 9, 2001; 98(21): 12168 - 12173. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |