|
|
||||||||
-Induced Class II MHC Expression by Suppressing Transcription of the Class II Transactivator Gene1



Departments of
*
Physiology and Biophysics and
Cell Biology, University of Alabama, Birmingham, AL 35294
| Abstract |
|---|
|
|
|---|
-inducible class II MHC expression. The
cytokine IL-1ß has been shown to inhibit IFN-
-induced class II MHC
expression in various cell types. We investigated the underlying
mechanism of this inhibitory effect of IL-1ß using human astroglioma
cell lines. Our findings demonstrate that IL-1ß prevents the
expression of class II MHC mRNA and protein upon treatment with
IFN-
. Furthermore, we demonstrate that IFN-
induction of
CIITA mRNA expression is inhibited by treatment of cells with IL-1ß.
IL-1ß suppressed IFN-
activation of the type IV CIITA promoter in
astroglioma cells, indicating that the inhibitory influence of IL-1ß
is mediated by inhibition of CIITA transcription. IL-1ß did not
interfere with IFN-
receptor signal transduction, since tyrosine
phosphorylation, nuclear translocation, and DNA binding of STAT-1
to
an IFN-
activation sequence of the type IV CIITA promoter were not
affected by IL-1ß. As well, IL-1ß treatment did not affect the
ability of IFN-
-induced interferon-regulatory factor-1
(IRF-1) to bind the IRF-1 element within the type IV CIITA
promoter. This study suggests that IL-1ß may play a role in
regulating immunoreactivity by inhibiting transcription of the CIITA
gene, thereby reducing subsequent class II MHC
expression. | Introduction |
|---|
|
|
|---|
on a wide variety of cell types, including astrocytes,
microglia, pancreatic ß-cells, keratinocytes, and endothelial cells
(for review, see 2 . Aberrant expression of class II MHC molecules
has been described in autoimmune disorders such as multiple sclerosis
and has been linked to the progression of neurologic disease
development (for review, see Refs. 3 and 4). In the central nervous
system (CNS),3 class II MHC
expression is absent under normal conditions, while in inflammatory
conditions, prominent class II MHC Ag immunoreactivity is detected on
microglia as well as astrocytes, brain endothelium, and infiltrating
leukocytes (5, 6, 7, 8, 9, 10).
Regulation of class II MHC gene expression occurs primarily at the
transcriptional level. Coordinated expression occurs through conserved
cis-acting regions, termed W (Z, S, or H), X (X1 and X2),
and Y elements, within the proximal promoter of most class II MHC genes
(for review, see Refs. 2 and 11). Optimal expression requires the
cooperative binding of several constitutively expressed
trans-acting factors to the W, X, and Y boxes of the class
II promoter (12, 13, 14). Although the presence of DNA binding proteins is
necessary, it is not sufficient for class II transcription.
Transcription of class II MHC genes (both constitutive and inducible)
occurs only in the presence of the recently described class II
transactivator (CIITA) (15, 16, 17, 18). CIITA acts through the conserved
elements within the proximal promoter of class II MHC genes, but does
not bind directly to DNA (19, 20). It has been postulated that the
mechanism by which CIITA activates transcription is by connecting the
constitutively present trans-acting factors to the basal
transcription machinery. In this context, it was recently shown that
CIITA can interact with both TFIIB and TAF proteins as well as with the
X box binding protein RFX5 through distinct domains within the CIITA
molecule (21, 22). Constitutive expression of CIITA is only found in
cells that also exhibit constitutive class II MHC expression (15).
CIITA is also involved in IFN-
-induced class II MHC expression;
CIITA is not constitutively expressed in class II MHC-negative cells,
but can be induced upon stimulation with IFN-
in a time frame that
precedes expression of class II MHC (15, 17, 18, 23, 24). Constitutive,
ectopic expression of CIITA cDNA from an expression construct
transfected into IFN-
-inducible cells bypasses the requirement of
IFN-
stimulation for class II MHC expression, indicating that CIITA
is the mediating factor of IFN-
induction of class II MHC (16, 18).
In CIITA-deficient mice, both constitutive and IFN-
-inducible class
II MHC expression is lacking, except for low expression in a subset of
thymic epithelial cells (25). Thus, CIITA appears to be the master
switch for class II MHC expression and may potentially serve as a
target for controlling aberrant class II MHC expression.
Numerous cytokines, including TNF-
, TGF-ß, IFN-
ß, IL-3, IL-4,
IL-1, IL-10, and granulocyte-macrophage CSF, have been shown to
modulate class II MHC expression in both a positive and a negative
manner depending on the cell type studied (for review, see 2 .
Immunosuppressive cytokines such as IFN-
/ß, TGF-ß, and IL-10
generally have an inhibitory effect on IFN-
-induced class II MHC
expression (24, 26, 27, 28, 29, 30, 31, 32, 33, 34). The CIITA gene is an attractive target for
cytokine-mediated inhibition of class II MHC expression. In this
regard, we and others have recently shown that TGF-ß suppresses
IFN-
-induced class II MHC expression by inhibiting the expression of
CIITA mRNA (24, 35). The inhibitory effect of TGF-ß on CIITA mRNA
expression was mediated at the transcriptional level (24, 36),
suggesting that the CIITA promoter may be targeted by TGF-ß.
We have been interested in the pathways by which cytokines modulate
class II MHC gene expression. IL-1, a cytokine with predominantly
proinflammatory properties, has been shown to inhibit IFN-
-induced
class II MHC expression in astrocytes, cerebral endothelial cells, and
synovial fibroblasts (37, 38, 39, 40). We have investigated the molecular
mechanisms underlying IL-1ß-mediated inhibition of class II MHC
expression in human astroglioma cells and have found that IL-1ß
exerts its inhibitory effect by suppressing IFN-
-induced CIITA mRNA
expression. IL-1ß inhibition of CIITA mRNA expression results from
the ability of this cytokine to inhibit IFN-
activation of the type
IV CIITA promoter. Thus, IL-1 may contribute to the regulation of
immunological events within the CNS by reducing class II MHC gene
expression.
| Materials and Methods |
|---|
|
|
|---|
The human CH235-MG and U373-MG astroglioma cell lines were maintained in a 50/50 mixture of DMEM and Hams F-12 medium (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS, 10 mM HEPES (pH 7.2), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (complete medium) as previously described (23, 41).
Reagents
Human rIFN-
was a gift from Biogen (Cambridge, MA), human
rIL-1ß was purchased from Genzyme (Cambridge, MA), and human rIL-1R
antagonist (IL-1RA) was purchased from R&D Systems (Minneapolis, MN).
Mouse IgG and affinity-purified goat anti-mouse IgG conjugated to
FITC were purchased from Southern Biotechnology Associates (Birmingham,
AL). mAb to HLA-DR (clone FMN 14) was purchased from Accurate Corp.
(Westbury, NY). Mouse anti-human ICAM-1 mAb (clone HA58) conjugated
to phycoerythrin was purchased from PharMingen (San Diego, CA).
Polyclonal antiserum to STAT-1
was a gift from Berlex Biosciences
(Richmond, CA), and monoclonal anti-phosphotyrosine Ab 4G10 and
polyclonal STAT-3 antisera were purchased from Upstate Biotechnology
(Lake Placid, NY). Polyclonal antisera against IRF-1 and
USF-1 were purchased from Santa Cruz Biotechnology (Santa Cruz,
CA).
Immunofluorescence flow cytometry
Cells were plated into 60-mm dishes (Costar, Cambridge, MA) at
1 x 106 cells/dish in complete medium and allowed to
adhere overnight. Before stimulation the culture medium was replaced
with fresh DMEM/Hams F-12 medium supplemented with 1% FBS. Cells
were either untreated or treated with IFN-
for 48 h in the
absence or the presence of IL-1ß. IL-1ß was added 24 h before
stimulation with IFN-
or concurrently with IFN-
. Cells were
trypsinized, washed in cold PBS, and stained for cell surface
expression of HLA-DR or ICAM-1 molecules as described previously (24, 42). Negative controls were incubated with irrelevant isotype-matched
mouse IgG. We have previously determined that trypsinization does not
affect the expression of either HLA-DR or ICAM-1 surface Ags (24, 42).
Ten thousand cells were analyzed for each sample using a FACScan flow
cytometer. HLA-DR expression is expressed as the percentage of positive
cells after subtraction of background staining with irrelevant IgG.
Total ICAM-1 expression is expressed in arbitrary units calculated from
the percentage of positive cells x mean fluorescence intensity.
The ICAM-1 data are expressed in this fashion as cytokine treatment
affects both the percentage of positive cells as well as the mean
fluorescence intensity (42).
RNA isolation and analysis by RNase protection assay (RPA)
Cells were plated into 100-mm dishes (Costar) at 3 x
106 cells/dish in complete medium and allowed to adhere
overnight, then incubated for the indicated time periods with IFN-
in the absence or the presence of IL-1ß. Total cellular RNA was
isolated as previously described (24). Preparation and in vitro
transcription of HLA-DR
, CIITA, and GAPDH riboprobes have been
described previously in detail (23, 24).
RPA was performed using a commercially available kit (Ambion, Austin,
TX) according to the manufacturers instructions as previously
described (23, 24). Ten to twenty micrograms of total RNA were
hybridized overnight with riboprobes at 42°C in 20 µl of 40 mM
PIPES (pH 6.4), 80% deionized formamide, 400 mM sodium acetate, and 1
mM EDTA. After hybridization, the mixture was treated with RNase A/T1
(1/200 dilution) at 37°C for 30 min. Protected fragments were
analyzed by 5% denaturing PAGE (8 M urea), and the gels were exposed
to x-ray film for visualization. Quantitation of protected fragments
was performed using a PhosphorImager (Molecular Dynamics,
Sunnyvale, CA). Values for HLA-DR
and CIITA mRNA were normalized to
GAPDH mRNA values, since GAPDH mRNA levels are not affected by cytokine
treatment. The sizes of the protected fragments of the HLA-DR
,
CIITA, and GAPDH riboprobes in the RPA are 413, 452, and 230
nucleotides in length, respectively.
Nuclear extracts and electrophoretic mobility shift assay (EMSA)
Nuclear extracts from astroglioma cells were prepared as
described by Pine et al. (43). Cells were grown in 100-mm dishes,
allowed to adhere overnight, and then treated with various combinations
of IL-1ß and/or IFN-
. After treatment, cells were washed with cold
PBS, harvested by scraping, and pelleted. Cells were resuspended in 5
packed cell volumes (pcv) of buffer A (10 mM KCl, 20 mM HEPES, 1 mM
MgCl2, 1 mM DTT, 0.4 mM PMSF, 1 mM NaF, and 1 mM
Na3VO4), incubated on ice for 10 min, and
pelleted at 1000 x g for 10 min. Pellets were
resuspended in 3 pcv of buffer A plus 0.1% Nonidet P-40, incubated on
ice for 10 min, and centrifuged at 3,000 x g for 10
min. The nuclear pellet was resuspended in 2 pcv of buffer B (10 mM
HEPES, 400 mM NaCl, 0.1 mM EDTA, 1 mM MgCl2, 1 mM DTT, 0.4
mM PMSF, 15% glycerol, 1 mM NaF, and 1 mM
Na3VO4) and incubated for 30 min at 4°C with
constant gentle mixing. Nuclei were then pelleted at 14,000 x
g for 15 min, and extracts were dialyzed for 2 h at
4°C against 1 liter of buffer C (20 mM HEPES, 200 mM KCl, 1 mM
MgCl2, 0.1 mM EDTA, 1 mM DTT, 0.4 mM PMSF, 15% glycerol, 1
mM NaF, and 1 mM Na3VO4). Extracts were cleared
by centrifugation at 14,000 x g for 15 min at 4°C.
Protein concentrations were determined using a Bio-Rad (Richmond, CA)
protein assay.
EMSA was performed using the following oligonucleotides. The 19-bp oligonucleotide ICAM-1-GAS has the sequence GAGGTTTCCGGGAAAGCAG and is derived from the human ICAM-1 promoter sequence -66 to -84 (44). The 30-bp oligonucleotide CIITA-GAS has the sequence TGCCACTTCTGATAAAGCACGTGGTGGCCA and corresponds to the type IV CIITA promoter sequence -119 to -148. The 30-bp CIITA-IRF-1 oligonucleotide has the sequence TGCAGAAAGAAAGTGAAAGGGAAAAAGAAC and corresponds to the type IV CIITA promoter sequence -45 to -74 (45). Two-tenths nanogram of 32P-labeled oligonucleotide (20,000 dpm) was incubated for 30 min at room temperature with 7.5 µg of nuclear extract in a volume of 25 µl containing 50 mM KCl, 2.5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 10 mM Tris-Cl (pH 7.5), 8% glycerol, 1 µg of salmon sperm DNA, and 1 µg of poly(dI-dC). For supershift analysis, 1 µl of Ab was incubated with the nuclear extracts for 30 min in binding buffer, followed by an additional incubation for 30 min at room temperature with labeled oligonucleotide. Bound and free DNAs were resolved by electrophoresis through a 6% polyacrylamide gel at 250 V in 1x TGE (50 mM Tris-Cl, 380 mM glycine, and 2 mM EDTA). Dried gels were exposed to Kodak XAR-5 film (Eastman Kodak, Rochester, NY) at -70°C with intensifying screens.
Human CIITA promoter constructs
The sequence for the primers used to PCR amplify a 1703-bp DNA
fragment of the type IV promoter of the human CIITA gene was derived
from that reported previously (45). The sense primer is located at the
3' end of the type III promoter and has the sequence
GCCTGGCTCCACGCCCTGCTG, and the antisense primer is located at the
3' end of the type IV promoter and has the sequence
CGCTGTTCCCCGGGCTCCCG. PCR was performed with the Taq PCR Core Kit
(Qiagen, Santa Clarita, CA) according to the manufacturers
instructions with 2.5 U of Taq DNA polymerase, 0.1 µM of each primer,
and 600 ng of genomic DNA. The PCR amplification protocol consisted of
an initial 1-min melting step at 94°C, followed by 30 cycles with
40-s melting at 92°C, 40-s annealing at 60°C, and 1-min 30-s
extension at 75°C, except for the last cycle which contained a 5-min
extension step. The resulting 1703-bp fragment was gel purified and
ligated into linearized pCRII vector (Invitrogen, Carlsbad, CA). The
complete sequence of the insert was obtained by automatic sequencing,
which was performed by the University of Alabama at Birmingham CFAR
Molecular Biology Core Facility. The 1703-bp insert was released from
pCRII by digestion with the restriction enzyme EcoRI and gel
purified, and the restriction ends were blunted with the Klenow
fragment of DNA polymerase I according to the manufacturer (Promega,
Madison, WI). The blunt-ended fragment was ligated into the
SmaI site of the pGL2-Basic vector, which contains the gene
for luciferase as reporter. The designated name for this construct is
hCIITAp1.7. Plasmid constructs containing deletions in the promoter
(D1, D2, and D4) were prepared as follows. Aliquots of the hCIITAp1.7
construct were subjected to digestion with the restriction enzyme
XhoI, giving rise to a 1020-bp XhoI fragment,
which was gel purified and subcloned into pGL2-Basic, generating the
deletion construct hCIITAp-D1. The hCIITAp1.7 was also digested with
SmaI, generating a 301-bp SmaI fragment, or
BstXI/KpnI, generating a 229-bp fragment, that
was subcloned into pGL2-Basic, creating the deletion constructs
hCIITAp-D2 and hCIITAp-D4, respectively. The deletion construct
hCIITAp-D3 was generated by religating the hCIITAp1.7
construct after deleting a 535-bp KpnI fragment, then
inserting a 99-bp fragment (-24 to +75) into the Mlu1 site
(see Fig. 5
). A 1281-bp human ICAM-1 promoter construct containing the
gene for luciferase as the reporter was also used as a control (46).
|
Twenty micrograms of the hCIITAp1.7 promoter construct, CIITA
deletion constructs, or human ICAM-1 promoter construct were
cotransfected with 4 µg of the pCMV-ß-galactosidase construct into
3 x 106 cells by electroporation with a Bio-Rad Gene
Pulser set at 250 V and 960 µF as previously described (42). After
transfection, cells were allowed to recover for 12 h before
treatment with IL-1ß and IFN-
for various time periods. Cells were
washed with PBS and lysed with 200 µl of lysis buffer containing 25
mM trisphosphate (pH 7.8), 2 mM DTT, 2 mM diaminocyclohexane
tetraacetic acid, 10% glycerol, and 1% Triton X-100. Extracts were
assayed in triplicate for luciferase activity in a volume of 140 µl
containing 40 µl of cell extract, 20 mM Tricine, 0.1 mM EDTA, 1 mM
magnesium carbonate, 2.67 mM MgSO4, 33.3 mM DTT,
0.27 mM coenzyme A, 0.47 mM luciferin, and 0.53 mM ATP, and light
intensity was measured using a luminometer (Promega, Madison, WI).
Luciferase activity was integrated over a 10-s period. Extracts were
also assayed in triplicate for ß-galactosidase enzyme activity as
previously described (42). The luciferase activity of each sample was
normalized to ß-galactosidase activity before calculating the fold
induction value.
Statistical analysis
Levels of significance for comparisons between samples were determined using Students t test distribution.
| Results |
|---|
|
|
|---|
induction of class II MHC expression in
human astroglioma cells
The effect of IL-1ß on the inducibility of class II MHC Ags by
IFN-
was examined in two human astroglioma cell lines, CH235-MG and
U373-MG. CH235-MG cells do not constitutively express class II MHC gene
products, but can be induced to do so by stimulation with IFN-
(23).
Levels of class II MHC expression at the cell surface reach a maximum
after 4872 h of stimulation with IFN-
(data not shown). IL-1ß
alone does not influence class II MHC expression in CH235-MG cells;
however, pretreatment of cells with IL-1ß for 24 h followed by
IFN-
stimulation for 48 h resulted in significant suppression
(
85%) of class II MHC expression (Table I
). Simultaneous treatment of CH235-MG
cells with IL-1ß plus IFN-
also resulted in inhibition of class II
MHC expression (
46%), although the extent of inhibition was
greatest with IL-1ß pretreatment. These findings indicate that
IL-1ß can inhibit IFN-
-induced class II MHC expression, and that
the inhibitory effect of IL-1ß occurs in a time-dependent manner.
Although IFN-
induction of class II MHC was less potent in U373-MG
cells than in CH235-MG cells, a 24-h pretreatment with IL-1ß resulted
in significant suppression (
54%) of class II expression (Table I
).
Interestingly, in U373-MG cells, simultaneous addition of IL-1ß and
IFN-
did not inhibit class II MHC expression. Dose-response
experiments were conducted with IL-1ß (10 pg/ml to 2 ng/ml) to
determine the optimal concentration for inhibition; the results
indicated that maximal inhibition was observed using 0.51 ng/ml of
IL-1ß (data not shown); thus, 1 ng/ml of IL-1ß was used for the
remainder of the study.
|
-induced class II
MHC expression. We examined the expression of other gene products that
are modulated by IFN-
and/or IL-1ß to determine whether the
inhibitory effect of IL-1ß was restricted to class II MHC expression.
IFN-
is a modest inducer of ICAM-1 on CH235-MG cells, while IL-1ß
induces expression to a greater extent (Fig. 2
for 48 h result in a
synergistic effect on ICAM-1 expression (Fig. 2
individually are weak inducers of RANTES
production by CH235-MG cells, yet synergize for strong induction of
RANTES gene expression (47). These results indicate that IL-1ß does
not globally inhibit IFN-
responses in CH235-MG cells.
|
|
-induced class II MHC mRNA expression
To study the mechanism by which IL-1ß inhibits class II MHC
surface expression, we sought to determine whether IL-1ß exerts its
effect at the level of class II MHC mRNA expression. CH235-MG cells
were incubated with IFN-
alone for 1248 h or were pretreated with
IL-1ß for 24 h, then incubated with IFN-
for 1248 h. RNA
was isolated and analyzed by RPA for class II MHC mRNA expression. Fig. 3
A shows the time course of
class II MHC mRNA induction after IFN-
treatment; optimal levels are
detected 48 h after stimulation with IFN-
(lane 10).
IL-1ß pretreatment inhibits IFN-
induction of class II MHC mRNA at
all time points tested, although the inhibition is more pronounced at
the later time points (
70% at 36 h and
80% at 48 h;
Fig. 3
B). Thus, the inhibitory influence of IL-1ß is
evident on class II MHC mRNA expression. The RPA shown in this figure
is overexposed for GAPDH because the signal for class II MHC is weaker.
However, quantitation of the original gels was performed on a
Phosphor Imager to arrive at accurate values. Comparable
results were obtained using U373-MG cells (data not shown).
|
-induced CIITA mRNA expression is inhibited by IL-1ß
The regulation of class II MHC gene expression occurs
predominantly at the transcriptional level, and the CIITA protein is a
potent activator of class II MHC transcription (for review, see 2 . To determine whether IL-1ß inhibits IFN-
-induced class II MHC
mRNA levels by preventing CIITA mRNA induction, we examined the effect
of IL-1ß pretreatment on IFN-
-induced CIITA mRNA expression.
Consistent with class II MHC expression, CH235-MG cells are
constitutively negative for CIITA (Fig. 4
A, lane 1), but
can be induced to express CIITA mRNA by IFN-
(lane
2). IL-1ß pretreatment, in a dose-dependent manner, inhibits
IFN-
-induced CIITA mRNA levels (lanes 37).
Strong inhibition is observed using 300 and 1000 pg/ml IL-1ß (Fig. 4
B), which are comparable to the IL-1ß concentrations
needed for inhibition of IFN-
-induced class II MHC mRNA and protein
expression. The RPAs for CIITA mRNA expression are overexposed for
GAPDH because the signal for CIITA is much weaker. Comparable findings
were observed in U373-MG cells (data not shown).
|
inducibility of the type IV CIITA
promoter
The CIITA gene is controlled by four independent CIITA promoters,
leading to CIITA transcripts with four distinct first exons (45). Two
promoters direct constitutive expression in dendritic cells and B
cells, respectively, while another mediates IFN-
-induced expression.
The type IV CIITA promoter, which is the IFN-
-responsive promoter,
contains a number of potential cis-acting elements. These
include an NF-GMa site, a GAS element, an E box, and an IRF-1 site in
both the mouse and human promoters. In addition, the type IV human
promoter contains an NF-
B site, and the mouse promoter has two AP-1
sites (45). We wished to determine whether IL-1ß could act directly
on the type IV CIITA promoter and interfere with IFN-
induction of
CIITA gene transcription. To accomplish this, the full-length
IFN-
-inducible type IV promoter of the human CIITA gene was cloned
(see details in Materials and Methods). The schematic
diagram shown in Fig. 5
depicts cytokine
response elements that have been identified through the Mat Inspector
program (48). Interestingly, three clusters of GAS and IRF elements are
found in the type IV CIITA promoter. The proximal cluster is located
-55 to -142 bp upstream of the transcription start site (pIRF,
pGAS), the medial cluster is located -591 to -683 bp (mIRF, mGAS),
and the distal cluster is located -769 to -854 bp upstream of the
transcription start site (dIRF, dGAS). To analyze CIITA promoter
activity in response to IFN-
, the 1703-bp fragment was subcloned
into the pGL2-Basic vector to drive expression of the luciferase
reporter gene. The resulting plasmid construct, hCIITAp1.7, was
transiently transfected into U373-MG astroglioma cells, and IFN-
induction of luciferase activity was determined (Fig. 6
). A very low basal transcriptional
activity of the hCIITAp1.7 construct was detected, and a 5.7-fold
induction of CIITA promoter activity was observed upon stimulation with
IFN-
. To determine whether all three GAS/IRF elements were required
to confer IFN-
inducibility on the CIITA promoter, deletion
constructs were generated from the 5' and 3' ends of the full-length
hCIITAp1.7 construct, and their inducibility by IFN-
was examined
(see Figs. 5
and 6
). The hCIITAp-D1 was tested to determine whether
deletion of 683 bp upstream of the distal GAS element had any influence
on IFN-
inducibility. Similar levels of IFN-
-induced luciferase
activity were observed with hCIITAp-D1 (4.9-fold induction)
compared with hCIITAp1.7. The hCIITAp-D2 is deleted of the distal and
medial GAS/IRF elements and contains the NF-
B, NF-GMa, proximal GAS,
E box, and proximal IRF-1 elements. Using this construct, IFN-
inducibility was maintained (6.2-fold induction), indicating that 237
bp of the type IV CIITA promoter is sufficient to confer IFN-
inducibility. Further deletion of the NF-
B element in hCIITAp-D4 did
not significantly influence IFN-
inducibility of the type IV CIITA
promoter (5.1-fold induction). The hCIITAp-D3 construct contains the
distal and medial GAS/IRF elements and lacks the downstream 437-bp
region of the type IV CIITA promoter. The hCIITAp-D3 was not inducible
by IFN-
treatment, indicating that the distal and medial GAS/IRF
elements cannot mediate CIITA transcription in response to IFN-
.
These results collectively indicate that the IFN-
inducibility of
the CIITA gene in astrocytes is dependent on elements
contained within a 154-bp fragment of the type IV CIITA promoter.
|
-induced
CIITA transcription. The hCIITAp1.7, hCIITAp-D1, hCIITAp-D2,
and hCIITAp-D4 constructs were transfected into U373-MG
cells, and IFN-
-inducible activity was tested after pretreating the
cells with IL-1ß. IL-1ß treatment inhibited IFN-
-induced
hCIITAp1.7 promoter activity by approximately 70% (Fig. 6
53% inhibition; Fig. 6
induction of
the hCIITAp-D2 construct was inhibited by about 60% in the
presence of IL-1ß (Fig. 6
B element. IL-1ß inhibited
IFN-
-induced activation of the hCIITAp-D4 construct by approximately
70%, indicating that the NF-
B element is not involved in IL-1ß
inhibition of CIITA promoter activity (Fig. 6
-induced transcription of the CIITA gene, and the element(s)
mediating the inhibitory response resides within the 154-bp region of
the type IV CIITA promoter. The CIITA promoter constructs were also
tested in CH235-MG cells; however, the cells did not survive the
transfection procedure well, and reproducible results could not be
obtained. To confirm that treatment with IL-1ß lead to selective
inhibition of IFN-
-induced CIITA promoter activity, we tested the
effect of IL-1ß on IFN-
-induced ICAM-1 promoter activity in
U373-MG cells. We have previously shown that a 1281-bp human ICAM-1
promoter is responsive to both IFN-
and IL-1ß stimulation (46).
U373-MG cells were transfected with the human ICAM-1 promoter
construct, then incubated with medium for 34 h, with IL-1ß (1
ng/ml) for 34 h, with medium for 24 h, then with IFN-
(100
U/ml) for 10 h, or with IL-1ß for 24 h, then with IFN-
for 10 h, which are the exact conditions used for IL-1ß
suppression of CIITA promoter activity (shown in Fig. 6
(2.5-fold induction) and IL-1ß (1.8-fold induction), and a
5.2-fold increase was observed when cells were pretreated with IL-1ß
for 24 h, then exposed to IFN-
for 10 h (data not shown).
These results indicate that IL-1ß pretreatment has a selective
inhibitory effect on type IV CIITA promoter activity.
Influence of IL-1ß on IFN-
activation of STAT-1
Macrophages from STAT-1
-deficient mice cannot be induced to
express CIITA or class II MHC in response to IFN-
stimulation (49),
and in cells depleted of STAT-1
by antisense oligonucleotides,
IFN-
induction of CIITA and class II MHC is impaired (23).
Furthermore, the proximal GAS element in the type IV CIITA
promoter has been shown to bind STAT-1
and is critical for
IFN-
-inducible activation of the CIITA promoter (50). To investigate
whether IL-1ß treatment interferes with IFN-
induction of
STAT-1
activation, we first tested whether IL-1ß influenced the
ability of IFN-
to induce tyrosine phosphorylation of STAT-1
.
CH235-MG or U373-MG cells were incubated with IFN-
in the absence or
the presence of IL-1ß, then tyrosine phosphorylation of STAT-1
was
assessed. A 30-min incubation with IFN-
induces tyrosine
phosphorylation of STAT-1
, and neither a 24-h pretreatment with
IL-1ß nor simultaneous addition of IL-1ß with IFN-
affected
IFN-
-induced tyrosine phosphorylation of STAT-1
(data not shown).
Thus, IL-1ß does not interfere with the ability of IFN-
to induce
tyrosine phosphorylation of STAT-1
in the astroglioma cells.
It is possible that IL-1ß may affect the ability of
tyrosine-phosphorylated STAT-1
to translocate into the nucleus and
bind to the GAS element. To test this, nuclear extracts were prepared
from CH235-MG cells stimulated with various combinations of IFN-
and
IL-1ß, and binding to an oligonucleotide containing the proximal GAS
element from the type IV CIITA promoter was assessed. It should be
noted that in addition to the GAS element, this oligonucleotide
contains an E box sequence that binds the constitutively expressed
transcription factor USF-1, which is also critical for IFN-
induction of the CIITA promoter (50). As shown in Fig. 7
A, nuclear extracts from
unstimulated cells formed a DNA-protein complex (lane
1, complex B), and IFN-
induced the formation of a slower
migrating complex (lane 4, complex A). The
specificity of complex formation was examined by competition
experiments using a 100-fold molar excess of CIITA-GAS oligonucleotide
as well as an oligonucleotide containing the GAS element from the human
ICAM-1 promoter. Complex B was competed away by the CIITA-GAS
oligonucleotide (Fig. 7
A, lane 2), but not by the
ICAM-1-GAS oligonucleotide (lane 3). Competition of
IFN-
-stimulated extracts revealed that the CIITA-GAS oligonucleotide
competed away both complex A and complex B (lane 5),
while the ICAM-1-GAS oligonucleotide competed for only complex A
(lane 6). As determined by supershift analysis,
complex B is composed of USF-1 (data not shown), while complex A is
STAT-1
(see Fig. 7
B, lanes 5 and
6). We interpret the competition results as follows. Complex
B binds to the E box contained within the CIITA-GAS oligonucleotide and
thus is competed away by excess CIITA-GAS oligonucleotide. The
ICAM-1-GAS oligonucleotide, which does not contain an E box element,
does not compete for complex B. In the IFN-
-stimulated extracts,
both complexes A and B are effectively competed away by CIITA-GAS
oligonucleotide, while the ICAM-1-GAS oligonucleotide competes away
only complex A (STAT-1
).
|
and USF-1 binding was next
examined. IL-1ß treatment alone for 24 h did not affect USF-1
(complex B), nor were any other complexes formed over the CIITA-GAS
oligonucleotide (Fig. 7
from
the cytoplasm to nucleus and subsequent binding to the CIITA-GAS
element were not influenced by IL-1ß (Fig. 7
Ab. Taken together, these data
indicate that IL-1ß does not alter the constitutive expression of
USF-1 (complex B), nor does IL-1ß treatment affect IFN-
-mediated
signal transduction pathways that culminate in the activation of
STAT-1
(complex A). Influence of IL-1ß on IRF-1 binding to the CIITA promoter
The transcription factor IRF-1 has been shown to be critical for
IFN-
inducibility of CIITA and class II MHC gene expression (50, 51). Since the IL-1ß inhibitory response localized to the 154-bp
region of the type IV CIITA promoter that contains the proximal IRF-1
binding site, we assessed whether IL-1ß influenced IRF-1 expression.
IFN-
stimulation induced the formation of two DNA-protein complexes
(Fig. 8
, compare lanes 1 and
2), and complex 1 was supershifted upon the addition of Ab
against IRF-1 (lane 3). Pretreatment of cells with
IL-1ß for 24 h, then exposure to IFN-
for 2 h, did not
affect complex 1 formation (lane 4). IL-1ß
treatment alone did not induce complex formation over the CIITA
proximal IRF-1 element (data not shown). These results indicate that
IL-1ß does not interfere with the ability of IFN-
-induced IRF-1 to
bind to the proximal IRF-1 element in the type IV CIITA promoter.
|
| Discussion |
|---|
|
|
|---|
. In contrast to the widely
appreciated proinflammatory effects of this cytokine (for review, see
52 , we found that IL-1ß inhibited IFN-
induction of class II
MHC expression on human astroglioma cell lines. Transcription of class
II MHC genes by IFN-
depends on the induction of CIITA (16). IL-1ß
treatment was found to diminish CIITA mRNA induction after IFN-
treatment. Furthermore, using a variety of human type IV CIITA promoter
constructs, we demonstrated that IL-1ß inhibited the IFN-
inducibility of this promoter. These results collectively indicate that
IL-1ß inhibits IFN-
induction of class II MHC expression by
inhibiting CIITA gene transcription.
Muhlethaler-Mottet et al. (50) have recently demonstrated that three
cis-acting elements within the type IV CIITA promoter are
essential for activation by IFN-
. They are the proximal GAS site,
which binds STAT-1
; the E box (adjacent to the proximal GAS site),
which binds USF-1; and the proximal IRF element, which binds IRF-1.
STAT-1
and IRF-1 binding occur following IFN-
stimulation, while
USF-1 is constitutively expressed. Furthermore, STAT-1
binds to the
proximal GAS element only in the presence of USF-1, and both factors
bind cooperatively to the GAS/E box motif in the type IV CIITA
promoter. Our results in the human astroglioma cell lines indicate that
a 154-bp fragment of the type IV CIITA promoter contains all of the
elements necessary for responsiveness to IFN-
(proximal GAS element,
E box, and proximal IRF element). Interestingly, the distal and medial
GAS/IRF elements do not contribute to IFN-
activation of the type IV
CIITA promoter, since deletion of these elements had no
effect on CIITA gene expression by IFN-
(Fig. 6
). As well, the
distal and medial GAS/IRF elements are not sufficient to mediate
IFN-
activation of the CIITA promoter, since construct hCIITAp-D3 is
not activated in response to IFN-
(Fig. 6
). It should be noted that
neither distal nor medial GAS elements have an adjacent E box motif,
which may explain the lack of function of the hCIITAp-D3 construct. As
well, using probes containing either distal or medial GAS sequences,
only very weak binding of STAT-1
could be detected by EMSA (data not
shown). Again, the absence of the E box sequence probably explains the
lack of STAT-1
binding to those sites and reinforces the contention
that it is the cooperative interaction between STAT-1
and USF-1 that
controls the specific activation of the type IV CIITA promoter by
IFN-
(50).
IL-1ß inhibition of IFN-
-induced CIITA gene transcription was
observed using the hCIITAp-D2 construct, which contains 237 bp of the
CIITA promoter including the NF-
B, NF-GMa, proximal GAS, E box, and
proximal IRF-1 elements (see Fig. 5
). To determine whether the NF-
B
element was involved in mediating the inhibitory effect of IL-1ß, we
tested the hCIITA-D4 construct, which lacks the NF-
B element. As
shown in Fig. 6
, this construct was still inhibited in the presence of
IL-1ß (70% inhibition). These results suggest that the inhibitory
influence of IL-1ß is mediated independently of the NF-
B element
in the type IV CIITA promoter. As the hCIITAp-D4 construct contains the
proximal GAS element, E box, and proximal IRF-1 element, we wished to
determine whether IL-1ß treatment impaired expression/binding of
STAT-1
, USF-1, and/or IRF-1. As shown in this study, IL-1ß did not
interfere with IFN-
-induced signal transduction events (i.e.,
tyrosine phosphorylation of STAT-1
), nor were translocation of
STAT-1
to the nucleus and binding to the proximal CIITA GAS element
impaired (Fig. 7
). As well, IL-1ß did not affect the ability of USF-1
to bind to the E box or interact with STAT-1
(Fig. 7
). In addition,
we found no effect of IL-1ß on the induction of the IFN-
-activated
transcription factor, IRF-1, as assessed by EMSA using an
oligonucleotide containing the proximal IRF sequence (Fig. 8
). To date,
our results demonstrate that IL-1ß does not affect the expression of
the three transcription factors known to be essential for IFN-
inducibility of the type IV CIITA promoter (STAT-1
, USF-1, and
IRF-1), nor does IL-1ß inhibition require the NF-
B element of the
CIITA promoter. Other possibilities for the mechanism of IL-1ß
inhibition include utilization of the NF-GMa element (which is intact
in the hCIITA-D4 construct) or influencing other as yet unknown
transcription factors involved in CIITA gene expression. Future studies
will be directed toward the elucidation of the cis- and
trans-acting factors involved in IL-1ß-mediated inhibition
of CIITA transcription.
A number of cytokines have been shown to inhibit class II MHC
expression, including TGF-ß, IFN-ß, and IL-10 (24, 27, 29, 33, 34, 36). However, the mechanisms employed by each of these factors in
regulating class II MHC expression differ. IL-10 inhibits class II MHC
expression on the cell surface of human monocytes by preventing class
II MHC molecules from reaching the plasma membrane as well as by
causing an accumulation of internalized class II MHC complexes in
intracellular vesicles (34). Thus, the inhibitory effect of IL-10
occurs on post-translational events, both the exocytosis and the
recycling of class II MHC molecules. IFN-ß was shown to inhibit
IFN-
-induced class II MHC transcription without affecting CIITA mRNA
induction (33). Since the inhibitory effect of IFN-ß on HLA-DRA
expression required the presence of interferon-stimulated gene factor
3
, it was suggested that IFN-ß induces a gene product that
interferes with CIITA trans-activation of the HLA-DRA
promoter, or that the CIITA protein is not fully functional in
IFN-ß-treated cells. In contrast, the inhibitory effect of TGF-ß on
IFN-
-induced class II MHC expression is mediated via transcriptional
inhibition of the promoter of class II MHC genes (27, 29), which is
caused by TGF-ß suppression of IFN-
-induced CIITA mRNA expression
(24). TGF-ß does not destabilize CIITA mRNA, suggesting an effect at
the level of CIITA mRNA transcription. Indeed, a recent report has
demonstrated that TGF-ß inhibits IFN-
-mediated induction of CIITA
promoter activity in fibroblasts (36). The results obtained with
IL-1ß in this study demonstrate similarities with those of TGF-ß;
i.e., both cytokines inhibit IFN-
induction of CIITA promoter
activity, thereby inhibiting CIITA mRNA expression. IL-1 and TGF-ß
use distinct receptors and downstream adaptor proteins to mediate their
pleiotropic effects (for review, see Refs. 53 and 54). It will be of
interest to determine whether IL-1ß and TGF-ß signaling events
converge at the CIITA promoter to inhibit IFN-
-induced expression of
this gene.
During inflammatory responses in the CNS, IL-1ß is one of the first
cytokines to be produced at sites of inflammation (for review, see 55 . In general, IL-1 is considered to be a proinflammatory cytokine
due to its pronounced stimulatory effect on the expression of a variety
of proinflammatory molecules, such as the adhesion molecules ICAM-1 and
VCAM-1, chemokines, TNF-
, and nitric oxide synthase (for review, see
52 . The ultimate in vivo outcome of the suppressive effect of
IL-1ß on class II MHC expression in astrocytes is unclear at this
time due to the controversy regarding the role of the astrocyte as an
APC within the CNS. Class II MHC-positive astrocytes have been shown by
some to function as APCs in vitro (56, 57, 58, 59), while other groups report
that class II MHC-positive astrocytes are unable to induce T cell
proliferation (60, 61). There are also reports that class II
MHC-positive astrocytes transmit a suppressive and/or apoptotic signal
to CD4+ T cells (60, 62), possibly due to the lack of B7
expression. However, a recent study demonstrated that class II
MHC-positive astrocytes are effective APCs for Th2 cell activation
(57). If class II MHC-positive astrocytes do, in fact, transmit an
apoptotic signal to autoreactive T cells, then inhibition of class II
MHC expression by IL-1ß could be viewed as perpetuating immune
responsiveness within the CNS. As well, if the function of class II
MHC-positive astrocytes is to promote activation of Th2 cells and
secretion of IL-4 and IL-10 (57), then inhibition of this response by
IL-1ß may also be detrimental within the CNS. However, if class II
MHC-positive astrocytes do promote the activation of naive autoreactive
Th1 cells (58), then IL-1ß down-regulation of class II MHC expression
on these cells could inhibit aberrant immune responses within the CNS.
Understanding the mechanism by which IL-1ß affects CIITA expression,
class II MHC expression, and the subsequent APC function of the
astrocyte may aid in the control of inflammatory processes in the CNS.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Etty N. Benveniste, Department of Cell Biology, Room 350 MCLM, University of Alabama at Birmingham, Birmingham, AL 35294-0005. E-mail address: ![]()
3 Abbreviations used in this paper: CNS, central nervous system; CIITA, class II transactivator; IL-1RA, interleukin-1 receptor antagonist; IRF-1, interferon-regulatory factor-1; USF-1, upstream stimulatory factor-1; RPA, ribonuclease protection assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay; pcv, packed cell volume; GAS, IFN-
activation sequence. ![]()
Received for publication June 12, 1998. Accepted for publication September 28, 1998.
| References |
|---|
|
|
|---|
mediated by the transactivator gene CIITA. Science 265:106.
mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
expression is involved in IFN-
induction of the class II transactivator and class II MHC genes. J. Immunol. 157:1559.[Abstract]
induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J. Immunol. 158:2065.[Abstract]
gene is mediated by conserved proximal promoter elements. J. Immunol. 151:4173.[Abstract]
, TNF-
and TGF-ß. J. Immunol. 154:2846.[Abstract]
induced class II MHC gene expression does not involve inhibition of phosphorylation of JAK1, JAK2 or STAT1
or modification of IFNEX expression. J. Immunol. 154:610.[Abstract]
-induced expression of Ia antigen in murine macrophages. J. Immunol. 135:1857.[Abstract]
-induced class II transactivator messenger RNA accumulation to block major histocompatibility complex class II gene expression and requires the 48-kD DNA-binding protein, ISGF3-
. J. Exp. Med. 182:1517.
ß peptide complexes at the plasma membrane of monocytes by affecting arrival and recycling. Immunity 7:861.[Medline]
action. J. Immunol. 158:1095.[Abstract]
, STAT1, and TGF-ß-regulated expression of the class II transactivator gene. J. Immunol. 160:233.
-induced Ia antigen expression on synovial fibroblasts by IL-1. J. Immunol. 143:1614.[Abstract]
on endothelial cells from murine central nervous system microvessels. J. Neuroimmunol. 27:209.[Medline]
requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
-activated primary murine astrocytes express B7 costimulatory molecules and prime naive antigen-specific T cells. J. Immunol. 158:614.[Abstract]
-activated SJL/J astrocytes. J. Immunol. 160:4271.This article has been cited by other articles:
![]() |
R. Romieu-Mourez, M. Francois, M.-N. Boivin, J. Stagg, and J. Galipeau Regulation of MHC Class II Expression and Antigen Processing in Murine and Human Mesenchymal Stromal Cells by IFN-{gamma}, TGF-beta, and Cell Density J. Immunol., August 1, 2007; 179(3): 1549 - 1558. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. van den Elsen, N. van der Stoep, and T. Yazawa Class II Transactivator (CIITA) Deficiency in Tumor Cells: Complicated Mechanisms or Not? Am. J. Pathol., July 1, 2003; 163(1): 373 - 376. [Full Text] [PDF] |
||||
![]() |
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator J. Immunol., August 1, 2002; 169(3): 1326 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Holling, N. van der Stoep, E. Quinten, and P. J. van den Elsen Activated Human T Cells Accomplish MHC Class II Expression Through T Cell-Specific Occupation of Class II Transactivator Promoter III J. Immunol., January 15, 2002; 168(2): 763 - 770. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Deffrennes, J. Vedrenne, M.-C. Stolzenberg, J. Piskurich, G. Barbieri, J. P. Ting, D. Charron, and C. Alcaide-Loridan Constitutive Expression of MHC Class II Genes in Melanoma Cell Lines Results from the Transcription of Class II Transactivator Abnormally Initiated from Its B Cell-Specific Promoter J. Immunol., July 1, 2001; 167(1): 98 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Harton and J. P.-Y. Ting Class II Transactivator: Mastering the Art of Major Histocompatibility Complex Expression Mol. Cell. Biol., September 1, 2000; 20(17): 6185 - 6194. [Full Text] |
||||
![]() |
Y. Dong, W. M. Rohn, and E. N. Benveniste IFN-{gamma} Regulation of the Type IV Class II Transactivator Promoter in Astrocytes J. Immunol., April 15, 1999; 162(8): 4731 - 4739. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |