| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Chiron Corp., Emeryville, CA 94608; and
Department of Structural Biology, Stanford University, Stanford, CA 94305
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Processing pathways for transmembrane glycoproteins that are not normally present in the cytoplasm remain undefined. Under some circumstances processing can occur in the ER rather than the cytoplasm. For instance, signal peptidase (5, 6, 7, 8) or other unidentified proteases (6, 9) can generate peptides that bind directly to class I MHC molecules in the ER, thus bypassing the cytoplasmic Ub/proteasome/TAP pathway. Most epitopes from transmembrane glycoproteins are TAP dependent, however, suggesting that at least some processing events occur in the cytoplasm.
At least two different mechanisms could account for cytoplasmic processing of proteins that normally localize to the ER. In the first mechanism, transmembrane glycoproteins may occasionally be synthesized on free cytoplasmic rather than membrane-bound ribosomes, and thus targeted for ubiquitination and destruction by the proteasome. Studies of an HLA-B35-restricted epitope from the HIV-1 gp120 envelope indicate that this pathway is functional in virus-infected cells (9, 10). The gp120 envelope contains a number of signal motifs for Asn-linked glycosylation (Asn-Xaa-Ser/Thr, where Xaa is any amino acid except Pro), and all are known to be modified by glycans during synthesis of the polyprotein in the ER (11). One of these Asn residues is contained in the epitope, but surprisingly was not glycosylated before presentation by the HLA-B35 molecules (10). This result suggests that gp120 polyprotein produced in the cytoplasm because of an error in translation (12, 13, 14) or possibly signal peptide-mediated targeting to the ER (9, 10) was the substrate for class I MHC processing.
A second mechanism appears to involve export of defective transmembrane glycoproteins from the ER to the cytoplasm for proteasome-mediated destruction (15, 16, 17, 18, 19, 20). This pathway is supported by recent studies of class I MHC-restricted epitopes in the influenza virus nucleoprotein (21) and the cellular glycoprotein tyrosinase that is expressed in melanocytes (22, 23). In the case of tyrosinase, it was demonstrated that efficient presentation of one TAP-dependent epitope by HLA-A2 required posttranslational conversion of an encoded Asn residue to Asp (22). This required cotranslational glycosylation of tyrosinase in the ER and subsequent translocation of the Ag to the cytoplasm where it was deglycosylated (23), probably by peptide:N-glycanase (PNGase) (24, 25). Removal of glycans by this cytoplasmic enzyme causes a coding change from Asn to Asp by a process of deamidation, and it is this modified form of tyrosinase that is processed by the Ub/proteasome/Tap pathway. Whether this processing pathway applies generally to other glycoproteins is not yet known.
In this study we demonstrate for the first time that the ER to cytosol processing pathway is not restricted to cellular glycoproteins such as tyrosinase, but is also operative for viral glycoproteins produced in infected cells. Class I MHC-restricted CTL specific for envelope glycoproteins E1 and E2 of hepatitis C virus (HCV) are present in the liver and peripheral blood of infected humans (26, 27, 28, 29, 30, 31) and chimpanzees (32, 33, 34). For at least one TAP-dependent E1 epitope, cotranslational glycosylation was strictly required for Ag presentation, presumably because an associated Asn to Asp substitution facilitated peptide binding to class I MHC molecules. This posttranslational modification also appeared to influence the repertoire of HCV-specific CD8+ CTL in an infected chimpanzee, and therefore has implications for vaccine design.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Chimpanzee Ross (CH-503) developed a persistent infection after experimental challenge with 100 chimpanzee infectious doses of the HCV-1/910 (genotype 1a) virus stock. Plasma viremia has been consistently detected through 5 yr of follow-up study (32). The class I MHC genotype of this chimpanzee is Patr-A*0401, -A*1401, -B*1601, -B*1701, -C*0501, -C*0601 (33). HCV-specific CTL lines were generated from the liver of this animal as described previously (32). CTL line 503/11.3 is specific for a Patr-A*0401-restricted epitope spanning amino acids 588–596 (KHPDATYSR) of the HCV E2 glycoprotein (32, 33). CTL lines 503/13.4 and 503/10D recognize Patr-B*1601-restricted epitopes in E1 and nonstructural 3 (NS3) proteins of HCV-1, respectively (32, 33). CTL lines specific for the Patr-B*1601-restricted E1 epitope were also generated by incubation of 4 x 106 Ficoll-Hypaque-separated PBMC in RPMI 1640 culture medium containing rIL-2 (20 U/ml), 10% FCS, tetanus toxoid (1 µg/ml), and synthetic HCV E1 peptides at 10 µg/ml as previously described (30). After 7 days, lymphocytes were washed once and restimulated with 1 x 106 autologous irradiated (3000 rad) PBMC in culture medium supplemented with IL-2 and synthetic HCV peptide. After a further 7 days, CD8+ T cells were enriched from the cultures using immunoaffinity beads (32) and were tested for HCV-specific lytic activity as described below.
Recombinant vaccinia viruses
Vaccinia viruses Vwt, VC/E1, and VE1/2 were described previously (32, 33). Vwt is a control virus that does not contain HCV genes. VC/E1 expresses amino acids 1–384 of HCV-1 spanning the core and E1 proteins. VE1/2 encodes amino acids 134–966 encompassing the NH2-terminus of core, E1, E2, p7, and most of NS2. Recombinant vaccinia viruses expressing full-length (VE1s+) or modified (VE1s- and VE1s-D234) E1 Ags were constructed as follows. Briefly, E1 with and without its natural leader were generated by PCR amplification of a genomic HCV-1 template and cloned into the pTM1 vector at the NcoI/BamHI sites. Two different 5' primers, E15 and E1-192 (GCAGTCATGATTTGCTCTTTCTCTATCTTCC and AACTCATGATCTACCAAGTGCGCAACTCCACG), were used to specify an initiator MET codon preceding an isoleucine followed by residue 172 or 192, respectively. Both primers encode BspHI sites, which, after digestion of the PCR product, are compatible with the vector NcoI site. A single 3' primer, E1383 (TGGTAGATCTTACGCGTCGACGCCGGCAAA), was used to specify a TAA termination codon after amino acid 383, followed by a BglII site, which, after digestion of the PCR product, is compatible with the vector BamHI site. Two PCR products were generated to create the N to D amino acid substitution at residue 234. The first corresponded to amino acids 192–236 in which amino acid 234 was altered to encode D rather than N; a unique XbaI site was created distally to facilitate ligation with the second PCR product, XbaI to BglII encoding the remainder of E1 to amino acid 383. The internal primers were designated E1-M5 and E1-M3 (CGCGAGGGCGACGCCTCTAGATGTTGG and CGCCACCCAACATCTAGAGGCGTCGCC). The identity of the resulting clones was confirmed by sequencing. Subsequently, the E1-coding sequences were transferred into pSC11 for generation of recombinant vaccinia viruses. An 80% confluent monolayer of African green monkey BSC-40 cells on a 60-mm dish was infected with 0.05 plaque-forming units of wild-type vaccinia virus (WR strain)/cell. After 2 h of infection at 37°C, the cells were transfected with 12.5 mg of pSC11+ E1s+, pSC11+ E1s-, and pSC11+ E1s-D234 DNA using lipofectin reagent (Life Technologies, Grand Island, NY). Virions were harvested 2 days later, and serial dilutions (from 10-1 to 10-4) of each were used to infect 80% confluent monolayers of thymidine kinase-deficient human osteosarcoma 143 B cells on 60-mm dishes. After 2 h at 37°C the inoculum was aspirated off the cells. An overlay that included 1% sea plaque agarose and 50 mg/ml 5-bromodeoxyuridine was added to infected monolayers, and 3 days later the dishes were overlaid with 1% sea plaque agarose containing 0.03% 5-bromo-4-chloro-3-indolyl-ß-D-galactoside. Each blue recombinant plaque was picked from a dish as an agarose plug and transferred into DMEM. The virus recovered from the plaque plug was used to infect monolayers of BSC-40 cells to generate a virus stock.
Recombinant vaccinia virus VV-ICP47 expressing the ICP47 protein of herpes simplex virus type 1 (35) was kindly provided by Dr. Barry Rouse, University of Tennessee (Knoxville, TN).
Synthetic peptides
HCV-1 peptides were synthesized by Chiron Mimotopes (Clayton, Australia) or Research Genetics (Huntsville, AL) using F-moc solid phase methods. All peptides had free amino and carboxyl termini.
Cytotoxicity assays
A B lymphoblastoid target cell line was established from the peripheral blood of chimpanzee CH-503 by transformation with supernatant from the marmoset cell line B95-8 as previously described (32). Target cells were infected for 1 h with recombinant vaccinia viruses expressing HCV-1 Ags at a multiplicity of infection (moi) of 10. In experiments involving VV-ICP47, targets were first infected for 1 h with this virus or Vwt at an moi of 15 and then superinfected with recombinant viruses expressing the HCV E1 glycoprotein for an additional 2 h at a moi of 5. All vaccinia virus-infected targets were washed and cultured overnight before labeling with 51Cr. In some experiments target cells were sensitized with synthetic HCV-1 peptides during 51Cr labeling. After three washes, 5 x 103 target cells were added to duplicate wells of a 96-well plate with varying numbers of CD8+ effector cells. Target cells cultured alone in medium or detergent (1% Nonidet P-40) provided the minimum and maximum release values, respectively. Plates were incubated for 4 h at 37°C, then 50 µl of culture supernatant was harvested onto 96-well Lumaplates (Packard, Downers Grove, IL), dried overnight, and counted in a Wallac 1450 Microbeta liquid scintillation counter (Wallac, Gaithersburg, MD). The percent specific 51Cr release was calculated using the formula: [(test release - minimum release)/(maximum release - minimum release)] x 100.
Tunicamycin treatment of target cells
Tunicamycin was added at a concentration of 10 µg/ml of culture medium 1 h before infection with recombinant vaccinia viruses, and targets were maintained in the presence of drug during assays for Ag expression or susceptibility to CTL lysis. The m.w. of HCV E1 and E2 Ags in drug-treated and untreated cells were assessed by Western blot analysis. Briefly, cells were pelleted and resuspended in Laemmli sample buffer. The lysates were sheared with an insulin hypodermic syringe, and the debris was pelleted. Supernatants were loaded onto 14% SDS gels for electrophoresis and then transferred to nitrocellulose in 20% methanol/electrophoresis buffer. Blots were blocked and then incubated with the appropriate mAb diluted 1/1000 (anti-E1:3D5/C3; anti-E2:3E5–1) for 1 h at room temperature in 0.2% reconstituted dried nonfat milk and 0.1% Tween-20 in PBS. Blots were washed, and a 1/20,000 dilution of goat anti-mouse peroxidase (Boehringer Mannheim, Indianapolis, IN) was added for 1 h at room temperature. After washing, enhanced chemiluminescence reagents (Amersham, Arlington Heights, IL) were added, and the blots were exposed to film.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A). The epitope recognized by
CTL line 503/13.4 was identified by pulsing target cells with a series
of overlapping decameric peptides that spanned the HCV-1 E1-coding
sequence. Only one peptide (amino acids 232-EGNASRCWVA-241) sensitized
the target cells (data not shown), and further truncation of
NH2- and COOH-terminal amino acids revealed that a
nine-amino acid peptide (amino acid 233-GNASRCWVA-241) is the minimum
optimal epitope (Fig. 1B). This peptide was designated
58N, where the superscript indicates the amino acid residue
at position 234 in single letter code.
|
A) (36). Comparison of the E1
and NS3 epitopes revealed a difference at amino acid position 2 that is
probably the dominant NH2-terminal anchor residue for
peptide binding to Patr-B*1601 (Fig. 2A). We hypothesized
that the Asp at position 2 of the NS3 epitope facilitated efficient
presentation by Patr-B*1601, and that the E1 epitope would be better
presented if Asn234 was replaced by Asp. As shown in Fig. 2B, the substituted peptide (designated 58D;
GDASRCWVA) sensitized target cells for lysis over a wide range of
concentrations. Half-maximal lysis of targets occurred at a peptide
concentration of about 0.1 nM, an amount comparable to that required
for the NS3 epitope restricted by Patr-B*1601 (36). By contrast,
peptide 58N failed to sensitize targets at any of the
concentrations tested in this experiment.
|
A). In contrast, high levels
of 58D-specific lytic activity were detected in all six
cultures stimulated with this Asp-substituted peptide (Fig. 3B). One representative cell line (B58D.3)
efficiently killed targets infected with VE1/2 (Fig. 3C).
Moreover, when target cells were treated with peptides 58N
and 58D, only the latter was recognized over a
concentration range from 10–0.001 nM (Fig. 3D). Thus, CTL
against the E1 epitope were still present in chimpanzee Ross after 5 yr
of persistent infection and showed the same preference for the
Asp-substituted peptide as the intrahepatic CTL line 503/13.4
established during the acute phase of hepatitis C. This result strongly
suggests that the dominant form of this epitope eliciting
CD8+ CTL in the infected host contains an Asp rather than
an Asn residue at amino acid position 234.
|
A).
Modification of this residue by glycosylation during cotranslational
synthesis of E1 might therefore influence presentation of the epitope.
To address this question, target cells infected with VE1/2 were treated
with tunicamycin, an inhibitor of N-linked glycosylation,
and then examined for the ability to present the E1 epitope. E1
expressed in untreated cells had an apparent molecular mass of 33 kDa
(Fig. 4). After treatment with
tunicamycin the size of E1 was reduced to 18 kDa, consistent with the
value predicted for the unglycosylated E1 polyprotein. Untreated target
cells expressing fully glycosylated E1 were efficiently killed by the
liver-derived CTL line 503/13.4, but recognition was abrogated when
tunicamycin was used to block addition of Asn-linked glycans (Fig. 5A). To control for
other possible effects of tunicamycin on the Ag-processing
apparatus including class I MHC synthesis, treated target cells
infected with VE1/2 were tested for lysis by CTL line 503/11.3 that
recognizes a Patr-A*0401-restricted E2 epitope (amino acid
588-KHPDATYSR-596; Fig. 5B). Tunicamycin-treated targets
were lysed at levels 50–75% of those of untreated targets, indicating
that the drug did not substantially interfere with the ability of
the cell to process or present epitopes derived from HCV envelope
proteins.
|
|
A) support this contention.
Virus VE1s+ expressed full-length E1, which consists of an
initiation codon followed by the natural signal peptide (amino acids
171–191) and mature envelope glycoprotein (amino acids 192–383; Fig. 6A). Target cells infected with this virus or pulsed with
peptide 58D were killed at equivalent levels, confirming
that the normal synthetic pathway for E1 in the infected cell, which
involves cotranslational glycosylation in the ER, leads to efficient
presentation of the Patr-B*1601-restricted epitope (Fig. 6B). As predicted, presentation of this epitope was
prevented if glycosylation of the Asn234 residue was
blocked by restricting E1 expression to the cytoplasm. Target cells
infected with VE1s-, which expresses E1 without its
natural leader peptide (Fig. 6A), were not susceptible to
CTL lysis (Fig. 6B). We reasoned that cytoplasmic expression
of E1 would be sufficient for class I MHC presentation of this epitope
if an Asn to Asp mutation was introduced at position 234, bypassing any
normal requirement for glycosylation/deglycosylation of this residue to
create an optimal anchor for Patr-B*1601 binding. A virus designated
VE1s-D234 that carries this mutation in E1 (Fig. 6A) sensitized target cells (Fig. 6B). Indeed,
equivalent levels of killing against target cells infected with
VE1s+ and VE1s-D234 were observed at all three
E:T cell ratios, indicating that an N234 to D substitution completely
replaced the requirement for a functional signal peptide in
presentation of this epitope.
|
A, CD8+ T cells lysed
targets pulsed with peptide 58D, but not those infected
with Vwt and/or VV-ICP47. Class I MHC presentation of epitopes from
cytoplasmic E1 should be strictly dependent on TAP, and thus we
evaluated whether ICP47 would prevent recognition of targets infected
with VE1s-D234. The data presented in Fig. 7B
clearly demonstrate that cytoplasmic synthesis of E1 encoding the
optimal Asp234 residue resulted in efficient lysis of
target cells, and this was prevented by prior infection with VV-ICP47
but not Vwt. Significantly, infection of the targets with VV-ICP47
before superinfection with VE1/2, which expresses full-length E1 with
signal peptide, also prevented presentation of the epitope (Fig. 7C). These results demonstrate that TAP is needed for
Patr-B*1601-restricted recognition of this epitope regardless of
whether E1 is synthesized in the cytoplasm (VE1s-D234;
Fig. 7B) or the ER (VE1/2; Fig. 7C).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Presentation of the HCV E1 epitope by Patr-B*1601 was at least
1000-fold more efficient when the Asn234 residue encoded by
HCV-1 was replaced by Asp. Modeling studies indicate that this amino
acid switch is required for peptide binding to the B pocket of
Patr-B*1601, and the presence of an Asp residue at position 2 of the
HCV NS3 epitope (Fig. 2A) is consistent with this view.
Given the poor presentation of synthetic peptide 58N by
Patr-B*1601, it seemed improbable that an epitope containing
Asn234 could elicit CTL in the infected host. Indeed,
expansion of CD8+ CTL from the PBMC of this infected
chimpanzee with peptide 58D, but not 58N,
supports the view that an Asn234 to Asp substitution occurs
naturally in HCV-1-infected cells. Remarkably, an overlapping E1
epitope (233-GNASRCWVAM-242) is also recognized by CD8+ CTL
from an HCV-infected human subject (26) even though peptide binding to
the HLA-B35 restriction element was reportedly several orders of
magnitude less efficient than that of other synthetic peptides
considered immunogenic (27). An Asn234 to Asp substitution
could also explain presentation of this epitope in humans, because
peptide binding to HLA-B*3501 is sometimes mediated by a position 2 Asp
instead of the usually dominant Pro anchor residue (38).
Posttranslational changes in primary amino acid sequence from Asn to
Asp within class I MHC-restricted epitopes of HCV E1, tyrosinase (22, 23), and HIV-1 gp120 (R. Ferris and R. Siliciano, unpublished
observations) suggest that this processing pathway, involving
deglycosylation/deamidation, is not uncommon and could have
implications for vaccine design. Synthetic peptide or protein
immunogens are usually based on the genetically encoded amino acid
sequence of an Ag. Moreover, priming of CD8+ CTL with
plasmid DNA or recombinant viral vaccine vectors might be enhanced by
removal of signal peptide from the encoded envelope Ag (39). Our
results suggest that the specificity of CTL primed by these vaccines
would be overlapping, but not necessarily identical, with those primed
by viral infection. A difference in the repertoire of epitopes
presented by vaccination vs infection is a potentially important issue
for viruses such as HCV and HIV-1 that have multiple Asn residues in
envelope proteins that are targeted for glycosylation.
Presentation of the Patr-B*1601 E1 epitope begins with translation of
the positive strand HCV genome into a single polyprotein that is
cleaved into structural and nonstructural subunits by host cell and
viral proteases (40). E1 contains an NH2-terminal signal
peptide for cotranslational synthesis and a COOH-terminal type I
membrane anchor for insertion into the lumenal face of the ER membrane
(41, 42). Glycosylation of E1 was a prerequisite for presentation of
the Patr-B*1601 epitope because target cell recognition was prevented
by tunicamycin treatment or removal of the signal peptide that directs
ER synthesis. Strict dependence on a functional TAP apparatus
nevertheless suggests that the E1 glycoprotein is not processed in the
ER, but instead is translocated to the cytoplasm, where it enters the
Ub/proteasome/TAP pathway. Retrograde transport of Ags in mammalian and
yeast cells is probably mediated by Sec61 (16, 43), a heterotrimeric
complex composed of 
, ß, and 
subunits that form a
protein-conducting channel in the ER membrane (44, 45). The pore is
normally used for extrusion of glycoproteins into the ER during
cotranslational synthesis on membrane-bound ribosomes, but may also
provide a route for feeding defective glycoproteins back to the
cytoplasm where they are deglycosylated by PNGase (24, 25) and degraded
by the proteasome (15). Proteasome inhibition should therefore result
in accumulation of deglycosylated protein in the cytoplasm, which has
been demonstrated for tyrosinase (23) and class I MHC heavy chains
(15). Preliminary results indicate that proteasome inhibitors also
prevent presentation of the E1 epitope (C. M. Walker, unpublished
observations). We postulate that deglycosylation of E1 is particularly
important for immune recognition of HCV-infected cells. The most
plausible mechanism is enzymatic hydrolysis of the
ß-aspartylglucosaminyl bond by PNGase; deamidation of the
Asn234 residue appears to be an absolute requirement for
peptide presentation by Patr-B*1601. It is conceivable that for other
epitopes, Asn to Asp substitutions cause more subtle alterations in
immune recognition, particularly if these residues are important for
TCR recognition instead of anchoring to class I MHC molecules.
Morrison and colleagues (46) originally demonstrated that the hemagglutinin protein of influenza virus must be synthesized in an infected cell for effective recognition by CD8+ CTL. Hemagglutinin synthesized in cells without a leader peptide for ER localization is efficiently presented for CD8+ T cell recognition (47). These studies raised questions about whether glycoproteins processed for class I MHC presentation originate in the cytoplasm or the ER. Although the present study indicates that this can involve retrograde transport of membrane glycoproteins from the ER to the cytosol, it is probably not the only pathway in infected cells leading to class I MHC presentation of TAP-dependent epitopes. For instance, some epitopes of gp120 contain Asn-Xaa-Ser/Thr motifs but are neither glycosylated nor deglycosylated before class I MHC presentation (10). This suggests that a small fraction of envelope proteins are aberrantly synthesized on free cytoplasmic ribosomes because of a transient shortage of signal recognition particles that chaperone nascent polypeptides and attached ribosomes to the ER membrane (10) or because of errors in translation (13). Taken together, studies of tyrosinase and transmembrane envelopes of HCV and HIV-1 suggest that glycoproteins synthesized in the cytoplasm and ER feed into a final common Ub/proteasome/TAP processing pathway. Indeed, recent studies involving a panel of epitopes from gp120 indicate that both sources of Ag are used in the same infected cell (R. Siliciano, unpublished observations).
Finally, it is noteworthy that Patr-B*1601-restricted CTL with the same fine specificity for peptide 58D were derived from the liver during the acute phase of infection and from peripheral blood drawn 5 yr later when plasma viremia was still detectable. These data provide confirmation in the chimpanzee model that HCV-specific CTL circulate in the peripheral blood as previously described for chronically infected humans (28, 29, 30, 31). Comparison of TCR sequences expressed by CD8+ T cell lines established from liver at week 28 or peripheral blood at week 263 postinfection is required to determine whether they belong to the same clonotype. Although data for this single Patr-B*1601-restricted T cell population must be considered preliminary, they might suggest that clonal deletion caused by Ag-driven exhaustion or interaction with infected hepatocytes that do not express costimulatory molecules is not the exclusive mechanism of immune evasion by HCV.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Christopher Walker, Department of Pediatrics, Children’s Hospital, Room W503, 700 Children’s Dr., Columbus, OH 43205. E-mail address:
3 Abbreviations used in this paper: Ub, ubiquitin; ER, endoplasmic reticulum; PNGase, peptide:N-glycanase; E1, envelope glycoprotein 1 of hepatitis C virus; HCV, hepatitis C virus; NS3, nonstructural 3; moi, multiplicity of infection; LCL, lymphoblastoid cell line.
Received for publication August 10, 1998. Accepted for publication September 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chains by the proteasome. J. Biol. Chem. 272:20800.This article has been cited by other articles:
|
|
 |
|
  N. Tiwari, N. Garbi, T. Reinheckel, G. Moldenhauer, G. J. Hammerling, and F. Momburg A Transporter Associated with Antigen-Processing Independent Vacuolar Pathway for the MHC Class I-Mediated Presentation of Endogenous Transmembrane Proteins J. Immunol., June 15, 2007; 178(12): 7932 - 7942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Altrich-VanLith, M. Ostankovitch, J. M. Polefrone, C. A. Mosse, J. Shabanowitz, D. F. Hunt, and V. H. Engelhard Processing of a Class I-Restricted Epitope from Tyrosinase Requires Peptide N-Glycanase and the Cooperative Action of Endoplasmic Reticulum Aminopeptidase 1 and Cytosolic Proteases J. Immunol., October 15, 2006; 177(8): 5440 - 5450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Wieland and F. V. Chisari Stealth and Cunning: Hepatitis B and Hepatitis C Viruses J. Virol., August 1, 2005; 79(15): 9369 - 9380. [Full Text] [PDF]
|
|
|
|
|
|
Y. V. Svitkin, A. Pause, M. Lopez-Lastra, S. Perreault, and N. Sonenberg Complete Translation of the Hepatitis C Virus Genome In Vitro: Membranes Play a Critical Role in the Maturation of All Virus Proteins except for NS3 J. Virol., June 1, 2005; 79(11): 6868 - 6881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, B. Gaschen, W. Blay, B. Foley, N. Haigwood, C. Kuiken, and B. Korber Tracking global patterns of N-linked glycosylation site variation in highly variable viral glycoproteins: HIV, SIV, and HCV envelopes and influenza hemagglutinin Glycobiology, December 1, 2004; 14(12): 1229 - 1246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sidney, S. Southwood, V. Pasquetto, and A. Sette Simultaneous Prediction of Binding Capacity for Multiple Molecules of the HLA B44 Supertype J. Immunol., December 1, 2003; 171(11): 5964 - 5974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Meyer-Olson, K. W. Brady, J. T. Blackard, T. M. Allen, S. Islam, N. H. Shoukry, K. Hartman, C. M. Walker, and S. A. Kalams Analysis of the TCR {beta} Variable Gene Repertoire in Chimpanzees: Identification of Functional Homologs to Human Pseudogenes J. Immunol., April 15, 2003; 170(8): 4161 - 4169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. N. Golovina, E. J. Wherry, T. N. J. Bullock, and L. C. Eisenlohr Efficient and Qualitatively Distinct MHC Class I-Restricted Presentation of Antigen Targeted to the Endoplasmic Reticulum J. Immunol., March 15, 2002; 168(6): 2667 - 2675. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lautscham, S. Mayrhofer, G. Taylor, T. Haigh, A. Leese, A. Rickinson, and N. Blake Processing of a Multiple Membrane Spanning Epstein-Barr Virus Protein for CD8+ T Cell Recognition Reveals a Proteasome-dependent, Transporter Associated with Antigen Processing-independent Pathway J. Exp. Med., October 8, 2001; 194(8): 1053 - 1068. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tangri, G. Y. Ishioka, X. Huang, J. Sidney, S. Southwood, J. Fikes, and A. Sette Structural Features of Peptide Analogs of Human Histocompatibility Leukocyte Antigen Class I Epitopes that Are More Potent and Immunogenic than Wild-Type Peptide J. Exp. Med., September 17, 2001; 194(6): 833 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bai, C. J. Aldrich, and J. Forman Factors Controlling the Trafficking and Processing of a Leader-Derived Peptide Presented by Qa-1 J. Immunol., December 15, 2000; 165(12): 7025 - 7034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lopez, B. C. Gil-Torregrosa, C. Bergmann, and M. Del Val Sequential Cleavage by Metallopeptidases and Proteasomes Is Involved in Processing HIV-1 ENV Epitope for Endogenous MHC Class I Antigen Presentation J. Immunol., May 15, 2000; 164(10): 5070 - 5077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Hudrisier, J. Riond, H. Mazarguil, M. B. A. Oldstone, and J. E. Gairin Genetically Encoded and Post-translationally Modified Forms of a Major Histocompatibility Complex Class I-restricted Antigen Bearing a Glycosylation Motif Are Independently Processed and Co-presented to Cytotoxic T Lymphocytes J. Biol. Chem., December 17, 1999; 274(51): 36274 - 36280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Ferris, C. Hall, N. V. Sipsas, J. T. Safrit, A. Trocha, R. A. Koup, R. P. Johnson, and R. F. Siliciano Processing of HIV-1 Envelope Glycoprotein for Class I-Restricted Recognition: Dependence on TAP1/2 and Mechanisms for Cytosolic Localization J. Immunol., February 1, 1999; 162(3): 1324 - 1332. [Abstract] [Full Text] [PDF]
|
|
), E1 and E2 (VE1/2;
), and core and E1 (VC/E1; •). The percent specific
51Cr release was assessed after coincubation of effector
and target cells for 4 h. B, Fine mapping of an HCV
E1 epitope. Autologous LCL were pulsed with 51Cr and a
200-nM concentration of the indicated peptide for 1 h, washed
three times, and incubated with CTL line 13.4 at an E:T cell ratio of
20:1 for 4 h.
) or VE1/2 in the presence (
)
of tunicamycin at a concentration of 10 µg/ml of culture medium.
Targets were then assessed for lysis by E1-specific CTL line 13.4
(A) or E2-specific line 11.3 (B) at the
indicated E:T cell ratios in a 4-h assay.
), E1 and E2 (VE1/2; 
), E1 lacking
signal sequence (VE1s-; ), and E1 lacking signal
sequence with an N234
D substitution (VE1s-D234;
