The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Selby, M.
Right arrow Articles by Walker, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Selby, M.
Right arrow Articles by Walker, C. M.
The Journal of Immunology, 1999, 162: 669-676.
Copyright © 1999 by The American Association of Immunologists

Hepatitis C Virus Envelope Glycoprotein E1 Originates in the Endoplasmic Reticulum and Requires Cytoplasmic Processing for Presentation by Class I MHC Molecules1

Mark Selby*, Ann Erickson*, Christine Dong*, Stewart Cooper{dagger}, Peter Parham{dagger}, Michael Houghton* and Christopher M. Walker2,*

* Chiron Corp., Emeryville, CA 94608; and {dagger} Department of Structural Biology, Stanford University, Stanford, CA 94305


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated whether hepatitis C virus envelope glycoprotein E1 is transported from the endoplasmic reticulum (ER) to the cytoplasm of infected cells for class I MHC processing. Target cells expressing E1 were killed by CTL lines from a hepatitis C virus-infected chimpanzee, and synthetic peptides were used to define an epitope (amino acids 233-GNASRCWVA-241) presented by the Patr-B*1601 class I MHC molecule. An unusually high concentration (>100 nM) of this nonameric peptide was required for target cell lysis, but this could be reduced at least 1000-fold by replacing the asparagine at amino acid position 234 (Asn234) with aspartic acid (Asp), the anticipated anchor residue for NH2-terminal peptide binding to Patr-B*1601. Conspicuously, position 234 is part of an N-glycosylation motif (Asn-Xaa-Ser/Thr), suggesting that the Asn234 to Asp substitution might occur naturally within the cell due to deglycosylation/deamidation of this amino acid by the cytosolic enzyme peptide N-glycanase. In support of this model, we demonstrate that presentation of the epitope depended on 1) cotranslational synthesis of E1 in the ER, 2) glycosylation of the E1 molecule, and 3) a functional TAP transporter to shuttle peptide from the cytosolic to ER compartment. These results indicate for the first time that during infection of the host, viral envelope glycoproteins originating in the ER are processed in the cytoplasm for class I MHC presentation. That a posttranslational change in amino acid sequence from Asn to Asp alters the repertoire of peptides presented to CD8+ CTL has implications for the design of antiviral vaccines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epitopes presented by class I MHC molecules are generated in a multistep process that begins with attachment of ubiquitin (Ub)3 to cytoplasmic or nuclear proteins that are then targeted to the 26S proteasome for degradation into peptides. Translocation of peptides from the cytoplasm into the endoplasmic reticulum (ER) is mediated by TAP, a heterodimer encoded by TAP-1 and TAP-2 genes located in the MHC (1). Class I MHC molecules in the ER are closely associated with TAP and various chaperones that facilitate loading of antigenic peptides (2). A stable complex consisting of a class I molecule, ß2m, and a peptide of about 8–10 amino acids, is transported to the cell surface via the exocytic pathway for surveillance by CD8+ CTL (3). This classical processing pathway might not, however, generate all class I MHC-associated peptides displayed by a cell. CD8+ CTL also recognize transmembrane glycoproteins, including viral envelope proteins, tumor Ags, and certain alloantigens, that are cotranslationally synthesized in the ER on membrane-bound ribosomes (4).

Processing pathways for transmembrane glycoproteins that are not normally present in the cytoplasm remain undefined. Under some circumstances processing can occur in the ER rather than the cytoplasm. For instance, signal peptidase (5, 6, 7, 8) or other unidentified proteases (6, 9) can generate peptides that bind directly to class I MHC molecules in the ER, thus bypassing the cytoplasmic Ub/proteasome/TAP pathway. Most epitopes from transmembrane glycoproteins are TAP dependent, however, suggesting that at least some processing events occur in the cytoplasm.

At least two different mechanisms could account for cytoplasmic processing of proteins that normally localize to the ER. In the first mechanism, transmembrane glycoproteins may occasionally be synthesized on free cytoplasmic rather than membrane-bound ribosomes, and thus targeted for ubiquitination and destruction by the proteasome. Studies of an HLA-B35-restricted epitope from the HIV-1 gp120 envelope indicate that this pathway is functional in virus-infected cells (9, 10). The gp120 envelope contains a number of signal motifs for Asn-linked glycosylation (Asn-Xaa-Ser/Thr, where Xaa is any amino acid except Pro), and all are known to be modified by glycans during synthesis of the polyprotein in the ER (11). One of these Asn residues is contained in the epitope, but surprisingly was not glycosylated before presentation by the HLA-B35 molecules (10). This result suggests that gp120 polyprotein produced in the cytoplasm because of an error in translation (12, 13, 14) or possibly signal peptide-mediated targeting to the ER (9, 10) was the substrate for class I MHC processing.

A second mechanism appears to involve export of defective transmembrane glycoproteins from the ER to the cytoplasm for proteasome-mediated destruction (15, 16, 17, 18, 19, 20). This pathway is supported by recent studies of class I MHC-restricted epitopes in the influenza virus nucleoprotein (21) and the cellular glycoprotein tyrosinase that is expressed in melanocytes (22, 23). In the case of tyrosinase, it was demonstrated that efficient presentation of one TAP-dependent epitope by HLA-A2 required posttranslational conversion of an encoded Asn residue to Asp (22). This required cotranslational glycosylation of tyrosinase in the ER and subsequent translocation of the Ag to the cytoplasm where it was deglycosylated (23), probably by peptide:N-glycanase (PNGase) (24, 25). Removal of glycans by this cytoplasmic enzyme causes a coding change from Asn to Asp by a process of deamidation, and it is this modified form of tyrosinase that is processed by the Ub/proteasome/Tap pathway. Whether this processing pathway applies generally to other glycoproteins is not yet known.

In this study we demonstrate for the first time that the ER to cytosol processing pathway is not restricted to cellular glycoproteins such as tyrosinase, but is also operative for viral glycoproteins produced in infected cells. Class I MHC-restricted CTL specific for envelope glycoproteins E1 and E2 of hepatitis C virus (HCV) are present in the liver and peripheral blood of infected humans (26, 27, 28, 29, 30, 31) and chimpanzees (32, 33, 34). For at least one TAP-dependent E1 epitope, cotranslational glycosylation was strictly required for Ag presentation, presumably because an associated Asn to Asp substitution facilitated peptide binding to class I MHC molecules. This posttranslational modification also appeared to influence the repertoire of HCV-specific CD8+ CTL in an infected chimpanzee, and therefore has implications for vaccine design.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CTL lines

Chimpanzee Ross (CH-503) developed a persistent infection after experimental challenge with 100 chimpanzee infectious doses of the HCV-1/910 (genotype 1a) virus stock. Plasma viremia has been consistently detected through 5 yr of follow-up study (32). The class I MHC genotype of this chimpanzee is Patr-A*0401, -A*1401, -B*1601, -B*1701, -C*0501, -C*0601 (33). HCV-specific CTL lines were generated from the liver of this animal as described previously (32). CTL line 503/11.3 is specific for a Patr-A*0401-restricted epitope spanning amino acids 588–596 (KHPDATYSR) of the HCV E2 glycoprotein (32, 33). CTL lines 503/13.4 and 503/10D recognize Patr-B*1601-restricted epitopes in E1 and nonstructural 3 (NS3) proteins of HCV-1, respectively (32, 33). CTL lines specific for the Patr-B*1601-restricted E1 epitope were also generated by incubation of 4 x 106 Ficoll-Hypaque-separated PBMC in RPMI 1640 culture medium containing rIL-2 (20 U/ml), 10% FCS, tetanus toxoid (1 µg/ml), and synthetic HCV E1 peptides at 10 µg/ml as previously described (30). After 7 days, lymphocytes were washed once and restimulated with 1 x 106 autologous irradiated (3000 rad) PBMC in culture medium supplemented with IL-2 and synthetic HCV peptide. After a further 7 days, CD8+ T cells were enriched from the cultures using immunoaffinity beads (32) and were tested for HCV-specific lytic activity as described below.

Recombinant vaccinia viruses

Vaccinia viruses Vwt, VC/E1, and VE1/2 were described previously (32, 33). Vwt is a control virus that does not contain HCV genes. VC/E1 expresses amino acids 1–384 of HCV-1 spanning the core and E1 proteins. VE1/2 encodes amino acids 134–966 encompassing the NH2-terminus of core, E1, E2, p7, and most of NS2. Recombinant vaccinia viruses expressing full-length (VE1s+) or modified (VE1s- and VE1s-D234) E1 Ags were constructed as follows. Briefly, E1 with and without its natural leader were generated by PCR amplification of a genomic HCV-1 template and cloned into the pTM1 vector at the NcoI/BamHI sites. Two different 5' primers, E15 and E1-192 (GCAGTCATGATTTGCTCTTTCTCTATCTTCC and AACTCATGATCTACCAAGTGCGCAACTCCACG), were used to specify an initiator MET codon preceding an isoleucine followed by residue 172 or 192, respectively. Both primers encode BspHI sites, which, after digestion of the PCR product, are compatible with the vector NcoI site. A single 3' primer, E1383 (TGGTAGATCTTACGCGTCGACGCCGGCAAA), was used to specify a TAA termination codon after amino acid 383, followed by a BglII site, which, after digestion of the PCR product, is compatible with the vector BamHI site. Two PCR products were generated to create the N to D amino acid substitution at residue 234. The first corresponded to amino acids 192–236 in which amino acid 234 was altered to encode D rather than N; a unique XbaI site was created distally to facilitate ligation with the second PCR product, XbaI to BglII encoding the remainder of E1 to amino acid 383. The internal primers were designated E1-M5 and E1-M3 (CGCGAGGGCGACGCCTCTAGATGTTGG and CGCCACCCAACATCTAGAGGCGTCGCC). The identity of the resulting clones was confirmed by sequencing. Subsequently, the E1-coding sequences were transferred into pSC11 for generation of recombinant vaccinia viruses. An 80% confluent monolayer of African green monkey BSC-40 cells on a 60-mm dish was infected with 0.05 plaque-forming units of wild-type vaccinia virus (WR strain)/cell. After 2 h of infection at 37°C, the cells were transfected with 12.5 mg of pSC11+ E1s+, pSC11+ E1s-, and pSC11+ E1s-D234 DNA using lipofectin reagent (Life Technologies, Grand Island, NY). Virions were harvested 2 days later, and serial dilutions (from 10-1 to 10-4) of each were used to infect 80% confluent monolayers of thymidine kinase-deficient human osteosarcoma 143 B cells on 60-mm dishes. After 2 h at 37°C the inoculum was aspirated off the cells. An overlay that included 1% sea plaque agarose and 50 mg/ml 5-bromodeoxyuridine was added to infected monolayers, and 3 days later the dishes were overlaid with 1% sea plaque agarose containing 0.03% 5-bromo-4-chloro-3-indolyl-ß-D-galactoside. Each blue recombinant plaque was picked from a dish as an agarose plug and transferred into DMEM. The virus recovered from the plaque plug was used to infect monolayers of BSC-40 cells to generate a virus stock.

Recombinant vaccinia virus VV-ICP47 expressing the ICP47 protein of herpes simplex virus type 1 (35) was kindly provided by Dr. Barry Rouse, University of Tennessee (Knoxville, TN).

Synthetic peptides

HCV-1 peptides were synthesized by Chiron Mimotopes (Clayton, Australia) or Research Genetics (Huntsville, AL) using F-moc solid phase methods. All peptides had free amino and carboxyl termini.

Cytotoxicity assays

A B lymphoblastoid target cell line was established from the peripheral blood of chimpanzee CH-503 by transformation with supernatant from the marmoset cell line B95-8 as previously described (32). Target cells were infected for 1 h with recombinant vaccinia viruses expressing HCV-1 Ags at a multiplicity of infection (moi) of 10. In experiments involving VV-ICP47, targets were first infected for 1 h with this virus or Vwt at an moi of 15 and then superinfected with recombinant viruses expressing the HCV E1 glycoprotein for an additional 2 h at a moi of 5. All vaccinia virus-infected targets were washed and cultured overnight before labeling with 51Cr. In some experiments target cells were sensitized with synthetic HCV-1 peptides during 51Cr labeling. After three washes, 5 x 103 target cells were added to duplicate wells of a 96-well plate with varying numbers of CD8+ effector cells. Target cells cultured alone in medium or detergent (1% Nonidet P-40) provided the minimum and maximum release values, respectively. Plates were incubated for 4 h at 37°C, then 50 µl of culture supernatant was harvested onto 96-well Lumaplates (Packard, Downers Grove, IL), dried overnight, and counted in a Wallac 1450 Microbeta liquid scintillation counter (Wallac, Gaithersburg, MD). The percent specific 51Cr release was calculated using the formula: [(test release - minimum release)/(maximum release - minimum release)] x 100.

Tunicamycin treatment of target cells

Tunicamycin was added at a concentration of 10 µg/ml of culture medium 1 h before infection with recombinant vaccinia viruses, and targets were maintained in the presence of drug during assays for Ag expression or susceptibility to CTL lysis. The m.w. of HCV E1 and E2 Ags in drug-treated and untreated cells were assessed by Western blot analysis. Briefly, cells were pelleted and resuspended in Laemmli sample buffer. The lysates were sheared with an insulin hypodermic syringe, and the debris was pelleted. Supernatants were loaded onto 14% SDS gels for electrophoresis and then transferred to nitrocellulose in 20% methanol/electrophoresis buffer. Blots were blocked and then incubated with the appropriate mAb diluted 1/1000 (anti-E1:3D5/C3; anti-E2:3E5–1) for 1 h at room temperature in 0.2% reconstituted dried nonfat milk and 0.1% Tween-20 in PBS. Blots were washed, and a 1/20,000 dilution of goat anti-mouse peroxidase (Boehringer Mannheim, Indianapolis, IN) was added for 1 h at room temperature. After washing, enhanced chemiluminescence reagents (Amersham, Arlington Heights, IL) were added, and the blots were exposed to film.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A CD8+ CTL line designated 503/13.4 was established from liver tissue biopsied 28 wk after infection of chimpanzee Ross with the genotype 1a HCV-1 isolate (32). Autologous target cells infected with recombinant vaccinia viruses expressing the HCV-1 E1 envelope glycoprotein were lysed by this CTL line (Fig. 1GoA). The epitope recognized by CTL line 503/13.4 was identified by pulsing target cells with a series of overlapping decameric peptides that spanned the HCV-1 E1-coding sequence. Only one peptide (amino acids 232-EGNASRCWVA-241) sensitized the target cells (data not shown), and further truncation of NH2- and COOH-terminal amino acids revealed that a nine-amino acid peptide (amino acid 233-GNASRCWVA-241) is the minimum optimal epitope (Fig. 1GoB). This peptide was designated 58N, where the superscript indicates the amino acid residue at position 234 in single letter code.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. A, Recognition of HCV E1 by a liver-derived CD8+ CTL line. CTL line 13.4 was tested for lytic activity against autologous LCL that were uninfected (X) or infected with vaccinia viruses expressing no HCV Ag (VVwt; {blacksquare}), E1 and E2 (VE1/2; {blacktriangleup}), and core and E1 (VC/E1; •). The percent specific 51Cr release was assessed after coincubation of effector and target cells for 4 h. B, Fine mapping of an HCV E1 epitope. Autologous LCL were pulsed with 51Cr and a 200-nM concentration of the indicated peptide for 1 h, washed three times, and incubated with CTL line 13.4 at an E:T cell ratio of 20:1 for 4 h.

 
A striking feature to emerge from these studies was the high concentration of peptide 58N required to sensitize target cells for lysis; a peptide concentration exceeding 200 nM was needed to match the levels of killing detected against targets infected with VE1/2. Epitope 58N was previously shown to be presented by the class I MHC allotype Patr-B*1601 (33). Notably, a second Patr-B*1601-restricted CTL line, designated 503/10D, was derived from the liver of the same chimpanzee. It recognized a nonameric epitope in the NS3 protein of HCV-1, and efficient lysis of target cells was achieved with peptide concentrations as low as 0.1 nM (Fig. 2GoA) (36). Comparison of the E1 and NS3 epitopes revealed a difference at amino acid position 2 that is probably the dominant NH2-terminal anchor residue for peptide binding to Patr-B*1601 (Fig. 2GoA). We hypothesized that the Asp at position 2 of the NS3 epitope facilitated efficient presentation by Patr-B*1601, and that the E1 epitope would be better presented if Asn234 was replaced by Asp. As shown in Fig. 2GoB, the substituted peptide (designated 58D; GDASRCWVA) sensitized target cells for lysis over a wide range of concentrations. Half-maximal lysis of targets occurred at a peptide concentration of about 0.1 nM, an amount comparable to that required for the NS3 epitope restricted by Patr-B*1601 (36). By contrast, peptide 58N failed to sensitize targets at any of the concentrations tested in this experiment.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. A, Comparison of Patr-B*1601- restricted epitopes from the HCV NS3 and E1 proteins. B, Titration of 58D and 58N peptides on LCL. Target cells were incubated with 51Cr and varying concentrations of peptides 58N (•) and 58D ({blacktriangleup}) for 1 h, washed three times, and cocultured with CTL line 13.4 at an E:T cell ratio of 20:1 for 4 h.

 
To assess whether CTL populations against either 58N or 58D sequences dominated in vivo, PBMC obtained from CH-503 at 263 wk postinfection were stimulated twice at weekly intervals with each individual peptide. CTL activity was assessed after an additional week of culture. CD8+ T cells enriched from all six replicate PBMC cultures stimulated with peptide 58N had low or no detectable lytic activity against targets sensitized with the homologous peptide compared with that against control targets (Fig. 3GoA). In contrast, high levels of 58D-specific lytic activity were detected in all six cultures stimulated with this Asp-substituted peptide (Fig. 3GoB). One representative cell line (B58D.3) efficiently killed targets infected with VE1/2 (Fig. 3GoC). Moreover, when target cells were treated with peptides 58N and 58D, only the latter was recognized over a concentration range from 10–0.001 nM (Fig. 3GoD). Thus, CTL against the E1 epitope were still present in chimpanzee Ross after 5 yr of persistent infection and showed the same preference for the Asp-substituted peptide as the intrahepatic CTL line 503/13.4 established during the acute phase of hepatitis C. This result strongly suggests that the dominant form of this epitope eliciting CD8+ CTL in the infected host contains an Asp rather than an Asn residue at amino acid position 234.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. Characterization of 58D- and 58N-specific CTL lines derived from peripheral blood. PBMC were stimulated twice with peptide 58N (A) or peptide 58D (B) and enriched CD8+ T cells were tested for lysis of autologous, 51Cr-labeled LCL that were untreated or sensitized with a 10-nM concentration of homologous (i.e., 58N or 58D) peptide or irrelevant control peptide 162A. C, Autologous target cells were uninfected ({blacksquare}) or were infected with vaccinia viruses expressing no HCV Ag (Vwt; x), E1 and E2 (VE1/2; {blacktriangleup}), and core and E1 (VC/E1; •). The percent specific lysis by CTL line B58D.3 was assessed in a 4-h assay. D, Target cells were sensitized with the indicated concentration of peptide 58N (•) or 58D ({blacktriangleup}) and cocultured with CTL line B58D.3 at an E:T cell ratio of 20:1 for 4 h.

 
Notably, Asn234 is part of an Asn-Xaa-Ser/Thr consensus glycosylation motif in the E1 protein (Fig. 2GoA). Modification of this residue by glycosylation during cotranslational synthesis of E1 might therefore influence presentation of the epitope. To address this question, target cells infected with VE1/2 were treated with tunicamycin, an inhibitor of N-linked glycosylation, and then examined for the ability to present the E1 epitope. E1 expressed in untreated cells had an apparent molecular mass of 33 kDa (Fig. 4Go). After treatment with tunicamycin the size of E1 was reduced to 18 kDa, consistent with the value predicted for the unglycosylated E1 polyprotein. Untreated target cells expressing fully glycosylated E1 were efficiently killed by the liver-derived CTL line 503/13.4, but recognition was abrogated when tunicamycin was used to block addition of Asn-linked glycans (Fig. 5GoA). To control for other possible effects of tunicamycin on the Ag-processing apparatus including class I MHC synthesis, treated target cells infected with VE1/2 were tested for lysis by CTL line 503/11.3 that recognizes a Patr-A*0401-restricted E2 epitope (amino acid 588-KHPDATYSR-596; Fig. 5GoB). Tunicamycin-treated targets were lysed at levels 50–75% of those of untreated targets, indicating that the drug did not substantially interfere with the ability of the cell to process or present epitopes derived from HCV envelope proteins.



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 4. Western blot of tunicamycin-treated, VVE1/E2-infected cells. Lysates of LCL infected with a control VV (Vwt; lanes 1 and 2) or VE1/2 (lanes 3 and 4) at an moi of 10 were loaded onto a 14% gel for electrophoresis. After transfer to nitrocellulose, blots were reacted with an HCV E1-specific mAb. Cells in lanes 2 and 4 were infected in the presence of tunicamycin at a concentration of 10 µg/ml of culture medium.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. Lysis of tunicamycin-treated target cells by HCV-envelope specific CTL lines. Autologous LCL were untreated ({blacksquare}) or were infected with control Vwt ({blacklozenge}) or VE1/2 in the presence ({blacktriangleup}) or the absence ({blacktriangledown}) of tunicamycin at a concentration of 10 µg/ml of culture medium. Targets were then assessed for lysis by E1-specific CTL line 13.4 (A) or E2-specific line 11.3 (B) at the indicated E:T cell ratios in a 4-h assay.

 
If cotranslational glycosylation of the Asn234 residue is important for presentation of the E1 epitope by Patr-B*1601, then limiting Ag expression to the cytoplasm of target cells by removal of the signal peptide sequence should prevent target cell recognition by CD8+ CTL. Studies with a panel of recombinant vaccinia viruses expressing modified E1 Ags (Fig. 6GoA) support this contention. Virus VE1s+ expressed full-length E1, which consists of an initiation codon followed by the natural signal peptide (amino acids 171–191) and mature envelope glycoprotein (amino acids 192–383; Fig. 6GoA). Target cells infected with this virus or pulsed with peptide 58D were killed at equivalent levels, confirming that the normal synthetic pathway for E1 in the infected cell, which involves cotranslational glycosylation in the ER, leads to efficient presentation of the Patr-B*1601-restricted epitope (Fig. 6GoB). As predicted, presentation of this epitope was prevented if glycosylation of the Asn234 residue was blocked by restricting E1 expression to the cytoplasm. Target cells infected with VE1s-, which expresses E1 without its natural leader peptide (Fig. 6GoA), were not susceptible to CTL lysis (Fig. 6GoB). We reasoned that cytoplasmic expression of E1 would be sufficient for class I MHC presentation of this epitope if an Asn to Asp mutation was introduced at position 234, bypassing any normal requirement for glycosylation/deglycosylation of this residue to create an optimal anchor for Patr-B*1601 binding. A virus designated VE1s-D234 that carries this mutation in E1 (Fig. 6GoA) sensitized target cells (Fig. 6GoB). Indeed, equivalent levels of killing against target cells infected with VE1s+ and VE1s-D234 were observed at all three E:T cell ratios, indicating that an N234 to D substitution completely replaced the requirement for a functional signal peptide in presentation of this epitope.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. A, Recombinant vaccinia viruses expressing HCV E1 envelope proteins. The amino acid at position 234 is shown in brackets in single letter code. B, Cytolysis of target cells expressing HCV E1 Ags. Autologous LCL were untreated ({blacktriangleup}), sensitized with peptide 58D (•), or infected with vaccinia viruses expressing no HCV Ag (Vwt; ), E1 and E2 (VE1/2; {blacksquare}), full-length E1 with signal peptide sequence (VE1s+; {diamondsuit}), E1 lacking signal sequence (VE1s-; ), and E1 lacking signal sequence with an N234->D substitution (VE1s-D234; {blacktriangledown}).

 
Processing of the E1 glycoprotein in the cytoplasm after retrograde transport from the ER should require a functioning TAP apparatus to reintroduce the deglycosylated epitope into the ER for class I MHC presentation. To investigate this issue, target cells were infected with a recombinant vaccinia virus expressing the HSV-1 ICP47 protein (35), which is known to inhibit TAP function (37), and then superinfected with VE1/2 or VE1s-D234. As shown in Fig. 7GoA, CD8+ T cells lysed targets pulsed with peptide 58D, but not those infected with Vwt and/or VV-ICP47. Class I MHC presentation of epitopes from cytoplasmic E1 should be strictly dependent on TAP, and thus we evaluated whether ICP47 would prevent recognition of targets infected with VE1s-D234. The data presented in Fig. 7GoB clearly demonstrate that cytoplasmic synthesis of E1 encoding the optimal Asp234 residue resulted in efficient lysis of target cells, and this was prevented by prior infection with VV-ICP47 but not Vwt. Significantly, infection of the targets with VV-ICP47 before superinfection with VE1/2, which expresses full-length E1 with signal peptide, also prevented presentation of the epitope (Fig. 7GoC). These results demonstrate that TAP is needed for Patr-B*1601-restricted recognition of this epitope regardless of whether E1 is synthesized in the cytoplasm (VE1s-D234; Fig. 7GoB) or the ER (VE1/2; Fig. 7GoC).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 7. HCV E1 epitope is TAP dependent. A, Target cells were untreated ({blacktriangleup}), sensitized with peptide 58D(•), or infected sequentially with Vwt/Vwt ({blacksquare}) or VV-ICP47/Vwt ({blacklozenge}) as described in Materials and Methods. Targets were also infected with VE1s-D234 (B, {blacksquare}) or VE1/2 (C, {blacksquare}) alone or after infection with Vwt (•) or VV-ICP-47 ({blacktriangleup}). The percent specific lysis was assessed after a 4-h coculture with CTL line B58D.3

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates for the first time that viral envelope glycoproteins originating in the ER are translocated to the cytoplasm for class I MHC processing, and thus appear to follow the same pathway recently described for cellular glycoproteins such as tyrosinase (22, 23). Our results indicate that the classical class I MHC pathway, which is known for efficient presentation of cytoplasmic or nuclear Ags, also processes membrane glycoproteins of intracellular pathogens or tumors that might otherwise avoid immune recognition by cotranslational synthesis and/or modification by Asn-linked glycans.

Presentation of the HCV E1 epitope by Patr-B*1601 was at least 1000-fold more efficient when the Asn234 residue encoded by HCV-1 was replaced by Asp. Modeling studies indicate that this amino acid switch is required for peptide binding to the B pocket of Patr-B*1601, and the presence of an Asp residue at position 2 of the HCV NS3 epitope (Fig. 2GoA) is consistent with this view. Given the poor presentation of synthetic peptide 58N by Patr-B*1601, it seemed improbable that an epitope containing Asn234 could elicit CTL in the infected host. Indeed, expansion of CD8+ CTL from the PBMC of this infected chimpanzee with peptide 58D, but not 58N, supports the view that an Asn234 to Asp substitution occurs naturally in HCV-1-infected cells. Remarkably, an overlapping E1 epitope (233-GNASRCWVAM-242) is also recognized by CD8+ CTL from an HCV-infected human subject (26) even though peptide binding to the HLA-B35 restriction element was reportedly several orders of magnitude less efficient than that of other synthetic peptides considered immunogenic (27). An Asn234 to Asp substitution could also explain presentation of this epitope in humans, because peptide binding to HLA-B*3501 is sometimes mediated by a position 2 Asp instead of the usually dominant Pro anchor residue (38). Posttranslational changes in primary amino acid sequence from Asn to Asp within class I MHC-restricted epitopes of HCV E1, tyrosinase (22, 23), and HIV-1 gp120 (R. Ferris and R. Siliciano, unpublished observations) suggest that this processing pathway, involving deglycosylation/deamidation, is not uncommon and could have implications for vaccine design. Synthetic peptide or protein immunogens are usually based on the genetically encoded amino acid sequence of an Ag. Moreover, priming of CD8+ CTL with plasmid DNA or recombinant viral vaccine vectors might be enhanced by removal of signal peptide from the encoded envelope Ag (39). Our results suggest that the specificity of CTL primed by these vaccines would be overlapping, but not necessarily identical, with those primed by viral infection. A difference in the repertoire of epitopes presented by vaccination vs infection is a potentially important issue for viruses such as HCV and HIV-1 that have multiple Asn residues in envelope proteins that are targeted for glycosylation.

Presentation of the Patr-B*1601 E1 epitope begins with translation of the positive strand HCV genome into a single polyprotein that is cleaved into structural and nonstructural subunits by host cell and viral proteases (40). E1 contains an NH2-terminal signal peptide for cotranslational synthesis and a COOH-terminal type I membrane anchor for insertion into the lumenal face of the ER membrane (41, 42). Glycosylation of E1 was a prerequisite for presentation of the Patr-B*1601 epitope because target cell recognition was prevented by tunicamycin treatment or removal of the signal peptide that directs ER synthesis. Strict dependence on a functional TAP apparatus nevertheless suggests that the E1 glycoprotein is not processed in the ER, but instead is translocated to the cytoplasm, where it enters the Ub/proteasome/TAP pathway. Retrograde transport of Ags in mammalian and yeast cells is probably mediated by Sec61 (16, 43), a heterotrimeric complex composed of {alpha}, ß, and {gamma} subunits that form a protein-conducting channel in the ER membrane (44, 45). The pore is normally used for extrusion of glycoproteins into the ER during cotranslational synthesis on membrane-bound ribosomes, but may also provide a route for feeding defective glycoproteins back to the cytoplasm where they are deglycosylated by PNGase (24, 25) and degraded by the proteasome (15). Proteasome inhibition should therefore result in accumulation of deglycosylated protein in the cytoplasm, which has been demonstrated for tyrosinase (23) and class I MHC heavy chains (15). Preliminary results indicate that proteasome inhibitors also prevent presentation of the E1 epitope (C. M. Walker, unpublished observations). We postulate that deglycosylation of E1 is particularly important for immune recognition of HCV-infected cells. The most plausible mechanism is enzymatic hydrolysis of the ß-aspartylglucosaminyl bond by PNGase; deamidation of the Asn234 residue appears to be an absolute requirement for peptide presentation by Patr-B*1601. It is conceivable that for other epitopes, Asn to Asp substitutions cause more subtle alterations in immune recognition, particularly if these residues are important for TCR recognition instead of anchoring to class I MHC molecules.

Morrison and colleagues (46) originally demonstrated that the hemagglutinin protein of influenza virus must be synthesized in an infected cell for effective recognition by CD8+ CTL. Hemagglutinin synthesized in cells without a leader peptide for ER localization is efficiently presented for CD8+ T cell recognition (47). These studies raised questions about whether glycoproteins processed for class I MHC presentation originate in the cytoplasm or the ER. Although the present study indicates that this can involve retrograde transport of membrane glycoproteins from the ER to the cytosol, it is probably not the only pathway in infected cells leading to class I MHC presentation of TAP-dependent epitopes. For instance, some epitopes of gp120 contain Asn-Xaa-Ser/Thr motifs but are neither glycosylated nor deglycosylated before class I MHC presentation (10). This suggests that a small fraction of envelope proteins are aberrantly synthesized on free cytoplasmic ribosomes because of a transient shortage of signal recognition particles that chaperone nascent polypeptides and attached ribosomes to the ER membrane (10) or because of errors in translation (13). Taken together, studies of tyrosinase and transmembrane envelopes of HCV and HIV-1 suggest that glycoproteins synthesized in the cytoplasm and ER feed into a final common Ub/proteasome/TAP processing pathway. Indeed, recent studies involving a panel of epitopes from gp120 indicate that both sources of Ag are used in the same infected cell (R. Siliciano, unpublished observations).

Finally, it is noteworthy that Patr-B*1601-restricted CTL with the same fine specificity for peptide 58D were derived from the liver during the acute phase of infection and from peripheral blood drawn 5 yr later when plasma viremia was still detectable. These data provide confirmation in the chimpanzee model that HCV-specific CTL circulate in the peripheral blood as previously described for chronically infected humans (28, 29, 30, 31). Comparison of TCR sequences expressed by CD8+ T cell lines established from liver at week 28 or peripheral blood at week 263 postinfection is required to determine whether they belong to the same clonotype. Although data for this single Patr-B*1601-restricted T cell population must be considered preliminary, they might suggest that clonal deletion caused by Ag-driven exhaustion or interaction with infected hepatocytes that do not express costimulatory molecules is not the exclusive mechanism of immune evasion by HCV.


    Acknowledgments
 
We thank Drs. Bob Siliciano and R. Ferris (Johns Hopkins University, Baltimore, MD) for helpful discussions, Dr. Barry Rouse (University of Tennessee, Knoxville, TN) for providing a recombinant vaccinia virus expressing the herpes simplex virus type 1 ICP47 protein, and Dr. Xavier Paliard for critical review of the manuscript. Nelle Cronen and Peter Anderson provided expert assistance with the preparation of this manuscript.


    Footnotes
 
1 This work was supported by Chiron Corp., National Institutes of Health Grant AI31168 (to P.P.), and a postdoctoral fellowship from the Arthritis Foundation (to S.C.). Back

2 Address correspondence and reprint requests to Dr. Christopher Walker, Department of Pediatrics, Children’s Hospital, Room W503, 700 Children’s Dr., Columbus, OH 43205. E-mail address: Back

3 Abbreviations used in this paper: Ub, ubiquitin; ER, endoplasmic reticulum; PNGase, peptide:N-glycanase; E1, envelope glycoprotein 1 of hepatitis C virus; HCV, hepatitis C virus; NS3, nonstructural 3; moi, multiplicity of infection; LCL, lymphoblastoid cell line. Back

Received for publication August 10, 1998. Accepted for publication September 24, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Heemels, M.-T., H. Ploegh. 1995. Generation, translocation, and presentation of MHC class-I restricted peptides. Annu. Rev. Biochem. 64:463.[Medline]
  2. Elliott, T.. 1997. Transporter associated with antigen processing. Adv. Immunol. 65:47.[Medline]
  3. York, I., K. L. Rock. 1996. Antigen processing and presentation by the class I major histocompatibility complex. Annu. Rev. Immunol. 14:369.[Medline]
  4. Siliciano, R. F., M. J. Soloski. 1995. MHC class I-restricted processing of transmembrane proteins. J. Immunol. 95:2.
  5. Wei, M. L., P. Cresswell. 1992. HLA-A2 molecules in an antigen-processing mutant cell contain signal sequence-derived peptides. Nature 356:443.[Medline]
  6. Hammond, S. A., R. C. Bollinger, T. W. Tobery, R. F. Siliciano. 1993. Transporter-independent processing of HIV-1 envelope protein for recognition by CD8+ T cells. Nature 364:158.[Medline]
  7. Lee, S. P., W. A. Thomas, N. W. Blake, A. B. Rickinson. 1996. Transporter (TAP)-independent processing of a multiple membrane-spanning protein, the Epstein-Barr virus latent membrane protein 2. Eur. J. Immunol. 26:1875.[Medline]
  8. Henderson, R. A., A. L. Coss, K. Sakaguchi, E. Appellia, J. Shabanowitz, D. H. Hunt, V. H. Engelhard. 1993. Direct identification of an endogenous peptide recognized by multiple HLA-A2.1 specific cytotoxic T cells. Proc. Natl. Acad. Sci. USA 90:10275.[Abstract/Free Full Text]
  9. Hammond, S. A., R. P. Johnson, S. A. Kalams, B. D. Walker, M. Takiguchi, J. T. Safrit, R. A. Koup, R. F. Siliciano. 1995. An epitope-selective, transporter associated with antigen presentation (TAP)-1/2-independent pathway and a more general TAP-1/2-dependent antigen-processing pathway allow recognition of the HIV-1 envelope glycoprotein by CD8+ CTL. J. Immunol. 154:6140.[Abstract]
  10. Ferris, R. L., C. Buck, S. A. Hammond, A. S. Woods, R. J. Cotter, M. Takiguchi, Y. Igarashi, Y. Ichikawa, R. F. Siliciano. 1995. Class I-restricted presentation of an HIV-1 gp41 epitope containing an N-linked glycosylation site. J. Immunol. 156:834.[Abstract]
  11. Leonard, C. K., M. W. Spellman, L. Riddle, R. J. Harris, J. N. Thomas, T. J. Gregory. 1990. Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expression Chinese hamster. J. Biol. Chem. 265:10373.[Abstract/Free Full Text]
  12. Boon, T., A. Van Pel. 1989. T cell-recognized antigenic peptides derived from the cellular genome are not protein degradation products but can be generated directly by transcription and translation of short subgenic regions: a hypothesis. Immunogenetics 29:75.[Medline]
  13. Yewdell, J. W., J. C. Antón, J. R. Bennink. 1996. Defective ribosomal products (DRiPs): a major source of antigenic peptides for MHC class I molecules?. J. Immunol. 157:1823.[Abstract]
  14. Yewdell, J. W., J. R. Bennink. 1992. Cell biology of antigen processing and presentation to major histocompatibility complex class I molecule-restricted T lymphocytes. Adv. Immunol. 52:1.[Medline]
  15. Wiertz, E. J. H., T. R. Jones, L. Sun, M. Bogyo, H. J. Geuze, H. L. Ploegh. 1996. The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum of the cytosol. Cell 84:769.[Medline]
  16. Wiertz, E. J. H., D. Tortorella, M. Bogyo, J. Yu, W. Mothes, T.R. Jones, T. A. Rapoport, H. L. Ploegh. 1996. Sec61-mediated transfer of a membrane protein from the endoplasmic reticulum to the proteasome for destruction. Nature 384:432.[Medline]
  17. Hiller, M. M., A. Finger, M. Schweiger, D. H. Wolf. 1996. ER degradation of a misfolded luminal protein by the cytosolic ubiquitin-proteasome pathway. Science 273:1725.[Abstract/Free Full Text]
  18. Werner, E. D., J. L. Brodsky, A. A. McCracken. 1996. Proteasome-dependent endoplasmic reticulum-associated protein degradation: an unconventional route to a familiar fate. Proc. Natl. Acad. Sci. USA 93:13797.[Abstract/Free Full Text]
  19. Hughes, E. A., C. Hammond, P. Cresswell. 1997. Misfolded major histocompatibility complex class I heavy chains are translocated into the cytoplasm and degraded by the proteasome. Proc. Natl. Acad. Sci. USA 94:1896.[Abstract/Free Full Text]
  20. Yu, H., G. Kahung, S. Kobayashi, R. R. Kopito. 1997. Cytosolic degradation of T-cell receptor {alpha} chains by the proteasome. J. Biol. Chem. 272:20800.[Abstract/Free Full Text]
  21. Bacik, I., H. L. Snyder, L. C. Anton, G. Russ, W. Chen, J. R. Bennink, L. Urge, L. Otvos, B. Dudkowska, L. Eisenlohr, et al 1997. Introduction of a glycosylation site into a secreted protein provides evidence for an alternative antigen processing pathway: transport of precursors of major histocompatibility complex class I-restricted peptides from the endoplasmic reticulum to the cytosol. J. Exp. Med. 186:479.[Abstract/Free Full Text]
  22. Skipper, J. C. A., R. C. Hendrickson, P. H. Gulden, V. Brichard, A. Van Pel, Y. Chen, J. Shabanowitz, T. Wolfel, C. L. Slingluff, T. Bonn, et al 1996. An HLA-A2-restricted tyrosinase antigen on melanoma cells results from post-translational modification and suggests a novel pathway for processing of membrane proteins. J. Exp. Med. 183:527.[Abstract/Free Full Text]
  23. Mosse, C. A., L. Meadows, C. J. Luckey, D. Kittlesen, E. L. Huczko, Jr C. L. Slingluff, J. Shabanowitz, D. F. Hunt, V. H. Engelhard. 1998. The class I antigen-processing pathway for the membrane protein tyrosinase involves translation in the endoplasmic reticulum and processing in the cytosol. J. Exp. Med. 187:37.[Abstract/Free Full Text]
  24. Suzuki, T., A. Seko, K. Kitajima, Y. Inoue, S. Inoue.. 1993. Identification of peptide:N-glycanase activity in mammalian-derived culture cells. Biochem. Biophys. Res. Commun. 194:1124.[Medline]
  25. Suzuki, T., A. Seko, K. Kitajima, Y. Knoue, S. Inoue. 1994. Purification and enzymatic properties of peptide:N-glycanase from C3H mouse-derived L-929 fibroblast cells. J. Biol. Chem. 269:17611.[Abstract/Free Full Text]
  26. Koziel, M. J., D. Dudley, J. T. Wong, J. Dienstag, M. Houghton, R. Ralston, B. D. Walker. 1992. Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis. J. Immunol. 149:3339.[Abstract]
  27. Koziel, M. J., B. D. Walker. 1997. Characteristics of the intrahepatic cytotoxic T lymphocyte response in chronic hepatitis C virus infection. Springer Semin. Immunopathol. 19:69.[Medline]
  28. Kita, H., T. Moriyama, T. Kaneko, I. Harase, M. Normura, H. Miura, I. Nakamura, Y. Yazaki, M. Imawari. 1993. HLA B44-restricted cytotoxic T lymphocytes recognizing an epitope on hepatitis C virus nucleocapsid protein. Hepatology 18:1039.[Medline]
  29. Shirai, M., H. Okada, M. Nishioka, T. Akatsuka, C. Wychowski, R. Houghten, C. D. Pendleton, S. Feinstone, J. A. Berzofsky. 1994. An epitope in hepatitis C core region recognized by cytotoxic T cells in mice and humans. J. Virol. 68:3334.[Abstract/Free Full Text]
  30. Cerny, A., J. G. McHutchinson, C. Pasquinelli, M. E. Brown, M. A. Brothers, B. Grabscheid, P. Fowler, M. Houghton, F. V. Chisari. 1995. Cytotoxic T lymphocyte response to hepatitis C virus-derived peptides containing the HLA A2.1 binding motif. J. Clin. Invest. 95:521.
  31. Battegay, M., J. Fikes, A. M. Di Bisceglie, P. A. Wentworth, A. Sette, E. Celis, W. Ching, A. Grakoui, C. M. Rice, K. Kurokohchi. 1995. Patient with chronic hepatitis C virus-encoded peptides binding to HLA-A2.1 molecules. J. Virol. 69:2462.[Abstract]
  32. Erickson, A. L., M. Houghton, Q.-L. Choo, A. J. Weiner, R. Ralston, E. Muchmore, C. M. Walker. 1993. Hepatitis C virus-specific CTL responses in the liver of chimpanzees with acute and chronic hepatitis C. J. Immunol. 151:4189.[Abstract]
  33. Kowalski, H., A. L. Erickson, S. Cooper, J. D. Domena, P. Parham, C. M. Walker. 1996. Patr-A and B, the orthologues of HLA-A and B, present hepatitis C virus epitopes to CD8+ cytotoxic T cells from two chronically infected chimpanzees. J. Exp. Med. 183:1761.[Abstract/Free Full Text]
  34. Walker, C. M.. 1996. Cytotoxic T-lymphocyte responses to the hepatitis C virus in humans and chimpanzees. Semin. Virol. 7:13.
  35. Banks, T. A., F. J. Jenkins, S. Kanangat, S. Nair, S. Dasgupta, C. M. Foster, B. T. Rouse. 1994. Vaccination with the immediate-early protein ICP47 of herpes simplex virus-type 1 (HSV-1) induces virus-specific lymphoproliferation, but fails to protect against lethal challenge. Virology 200:236.[Medline]
  36. Weiner, A., A. L. Erickson, J. Kansopon, K. Crawford, E. Muchmore, A. L. Hughes, M. Houghton, C. M. Walker. 1995. Persistent hepatitis C virus infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant. Proc. Natl. Acad. Sci. USA 92:2755.[Abstract/Free Full Text]
  37. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, D. Johnson. 1995. Herpes simplex virus turns off the TAP to evade host immunity. Nature 375:411.[Medline]
  38. Rammensee, H.-G., T. Friede, S. Stevanovic. 1995. MHC ligands and peptide motifs: first listing. Immunogenetics 41:178.[Medline]
  39. Tobery, T. W., R. F. Siliciano. 1997. Targeting of HIV-1 antigens for rapid intracellular degradation enhances cytotoxic T lymphocyte (CTL) recognition and the induction of de novo CTL responses in vivo after immunization. J. Exp. Med. 185:909.[Abstract/Free Full Text]
  40. Choo, Q.-L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, A. Medina-Selby, P. J. Barr, et al 1991. Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA 88:2451.[Abstract/Free Full Text]
  41. Ralston, R., K. Thudium, K. Berger, C. Kuo, B. Gervase, J. Hall, M. Selby, G. Kuo, M. Houghton, Q.-L. Choo. 1993. Characterization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia viruses. J. Virol. 67:6753.[Abstract/Free Full Text]
  42. Spaete, R. R., D. Alexander, M. E. Rugroden, Q.-L. Choo, K. Berger, K. Crawford, C. Kuo, S. Leng, C. Lee, R. Ralston, et al 1992. Characterization of the hepatitis C virus E2/NS1 gene product expressed in mammalian cells. Virology 188:819.[Medline]
  43. Matlack, K. E., W. Mothes, T. A. Rapoport. 1998. Protein translocation: tunnel vision. Cell 92:381.[Medline]
  44. Rapoport, T. A., B. Jungnickel, U. Kutay. 1996. Protein transport across the eukaryotic endoplasmic reticulum and bacterial inner membranes. Annu. Rev. Biochem. 65:271.[Medline]
  45. Hanein, D., K. E. S. Matlack, B. Jungnickel, K. Plath, K.-U. Kalies, K. R. Miller, T. A. Rapoport, C. W. Akey. 1996. Oligomeric rings of the Sec61p complex induced by ligands. Cell 87:721.[Medline]
  46. Morrison, L. A., A. E. Lukacher, V. L. Braciale, D. P. Fan, T. J. Braciale. 1986. Differences in antigen presentation to MHC class I- and class II-restricted influenza virus-specific cytolytic T lymphocyte clones. J. Immunol. 163:903.
  47. Townsend, A. R., J. Bastin, K. Gould, G. G. Brownlee. 1986. Cytotoxic T lymphocytes recognize influenza hemagglutinin that lacks a signal sequence. Nature 324:575.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
N. Tiwari, N. Garbi, T. Reinheckel, G. Moldenhauer, G. J. Hammerling, and F. Momburg
A Transporter Associated with Antigen-Processing Independent Vacuolar Pathway for the MHC Class I-Mediated Presentation of Endogenous Transmembrane Proteins
J. Immunol., June 15, 2007; 178(12): 7932 - 7942.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. L. Altrich-VanLith, M. Ostankovitch, J. M. Polefrone, C. A. Mosse, J. Shabanowitz, D. F. Hunt, and V. H. Engelhard
Processing of a Class I-Restricted Epitope from Tyrosinase Requires Peptide N-Glycanase and the Cooperative Action of Endoplasmic Reticulum Aminopeptidase 1 and Cytosolic Proteases
J. Immunol., October 15, 2006; 177(8): 5440 - 5450.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. F. Wieland and F. V. Chisari
Stealth and Cunning: Hepatitis B and Hepatitis C Viruses
J. Virol., August 1, 2005; 79(15): 9369 - 9380.
[Full Text] [PDF]


Home page
J. Virol.Home page
Y. V. Svitkin, A. Pause, M. Lopez-Lastra, S. Perreault, and N. Sonenberg
Complete Translation of the Hepatitis C Virus Genome In Vitro: Membranes Play a Critical Role in the Maturation of All Virus Proteins except for NS3
J. Virol., June 1, 2005; 79(11): 6868 - 6881.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M. Zhang, B. Gaschen, W. Blay, B. Foley, N. Haigwood, C. Kuiken, and B. Korber
Tracking global patterns of N-linked glycosylation site variation in highly variable viral glycoproteins: HIV, SIV, and HCV envelopes and influenza hemagglutinin
Glycobiology, December 1, 2004; 14(12): 1229 - 1246.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sidney, S. Southwood, V. Pasquetto, and A. Sette
Simultaneous Prediction of Binding Capacity for Multiple Molecules of the HLA B44 Supertype
J. Immunol., December 1, 2003; 171(11): 5964 - 5974.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Meyer-Olson, K. W. Brady, J. T. Blackard, T. M. Allen, S. Islam, N. H. Shoukry, K. Hartman, C. M. Walker, and S. A. Kalams
Analysis of the TCR {beta} Variable Gene Repertoire in Chimpanzees: Identification of Functional Homologs to Human Pseudogenes
J. Immunol., April 15, 2003; 170(8): 4161 - 4169.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. N. Golovina, E. J. Wherry, T. N. J. Bullock, and L. C. Eisenlohr
Efficient and Qualitatively Distinct MHC Class I-Restricted Presentation of Antigen Targeted to the Endoplasmic Reticulum
J. Immunol., March 15, 2002; 168(6): 2667 - 2675.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
G. Lautscham, S. Mayrhofer, G. Taylor, T. Haigh, A. Leese, A. Rickinson, and N. Blake
Processing of a Multiple Membrane Spanning Epstein-Barr Virus Protein for CD8+ T Cell Recognition Reveals a Proteasome-dependent, Transporter Associated with Antigen Processing-independent Pathway
J. Exp. Med., October 8, 2001; 194(8): 1053 - 1068.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
S. Tangri, G. Y. Ishioka, X. Huang, J. Sidney, S. Southwood, J. Fikes, and A. Sette
Structural Features of Peptide Analogs of Human Histocompatibility Leukocyte Antigen Class I Epitopes that Are More Potent and Immunogenic than Wild-Type Peptide
J. Exp. Med., September 17, 2001; 194(6): 833 - 846.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Bai, C. J. Aldrich, and J. Forman
Factors Controlling the Trafficking and Processing of a Leader-Derived Peptide Presented by Qa-1
J. Immunol., December 15, 2000; 165(12): 7025 - 7034.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Lopez, B. C. Gil-Torregrosa, C. Bergmann, and M. Del Val
Sequential Cleavage by Metallopeptidases and Proteasomes Is Involved in Processing HIV-1 ENV Epitope for Endogenous MHC Class I Antigen Presentation
J. Immunol., May 15, 2000; 164(10): 5070 - 5077.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Hudrisier, J. Riond, H. Mazarguil, M. B. A. Oldstone, and J. E. Gairin
Genetically Encoded and Post-translationally Modified Forms of a Major Histocompatibility Complex Class I-restricted Antigen Bearing a Glycosylation Motif Are Independently Processed and Co-presented to Cytotoxic T Lymphocytes
J. Biol. Chem., December 17, 1999; 274(51): 36274 - 36280.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. L. Ferris, C. Hall, N. V. Sipsas, J. T. Safrit, A. Trocha, R. A. Koup, R. P. Johnson, and R. F. Siliciano
Processing of HIV-1 Envelope Glycoprotein for Class I-Restricted Recognition: Dependence on TAP1/2 and Mechanisms for Cytosolic Localization
J. Immunol., February 1, 1999; 162(3): 1324 - 1332.
[Abstract] [Full Text] [PDF]