| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*
Pasteur Institute of Brussels, Department of Virology, Brussels, Belgium;
Gesellschaft für Biotechnologische Forschung, Braunschweig, Germany; and
Merck Research Laboratories, West Point, PA 19486
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
could be detected following vaccination with each of
the three genes. However, only mice vaccinated with PstS-3 DNA
demonstrated significant and sustained reduction in bacterial CFU
numbers in spleen and lungs for 3 mo after M.
tuberculosis challenge, as compared with CFU counts in mice
vaccinated with control DNA. Vaccination with PstS-2 DNA induced a
modest reduction in CFU counts in spleen only, whereas vaccination with
PstS-1 DNA was completely ineffective in reducing bacterial
multiplication. In conclusion, our results indicate that DNA
vaccination is a powerful and easy method for comparative screening of
potentially protective Ags from M. tuberculosis and that
the PstS-3 protein is a promising new subunit vaccine
candidate. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A major limitation for all these new approaches is the fact that the protective Ags for tuberculosis are still not precisely defined. As supported by observations in mice and guinea pigs, immune recognition of secreted or surface-exposed proteins of the bacillus, rather than of cytoplasmic Ags, may be an effective host strategy to control bacterial multiplication from the onset of infection. Thus, immunization with whole M. tuberculosis culture filtrate (CF) (rich in these exported proteins) can induce significant protection against subsequent challenge with the tubercle bacillus (5, 6). Using the technique of DNA immunization, we have recently shown that vaccination with plasmid DNA encoding a major protein component from M. tuberculosis CF, i.e., Ag85A (7), can indeed protect mice against low-dose aerosol challenge with M. tuberculosis (8). However, two-dimensional PAGE of M. tuberculosis CF has revealed more than 200 different protein spots (9), and thus it is very likely that protein components other than Ag85A also contribute to the protective efficacy of this CF (10).
Using CF-specific mAbs derived from BCG-vaccinated mice (11), we previously identified three genes in the M. tuberculosis genome encoding three putative phosphate binding proteins homologous to the periplasmic ATP-binding cassette (ABC) phosphate-binding receptor PstS from Escherichia coli (12, 13, 14). We have called these proteins PstS-1 (identical to the well-known 38-kDa protein also called protein Ag b (pab) (15, 16, 17) and recognized by mAb HBT-12), PstS-2 (a 37- to 38-kDa doublet protein recognized by mAb 2A1-2), and PstS-3 (a 40-kDa protein recognized by mAbs 2F8-3 and 2C1-5 and identified in crossed immunoelectrophoresis as Ag88 (18)). The three genes encoding these proteins are very similar (about 75% similarity between pstS-1 and pstS-2 or pstS-3 and 94% similarity between pstS-2 and pstS-3), and they are found on a continuous stretch of M. tuberculosis genome. At least pstS-1 and pstS-3 seem to be organized in two distinct operons encoding their proper transmembrane PstC and PstA transporter molecules (13). The three PstS proteins all have a lipoprotein consensus signal, and they are exposed on the cell surface of the bacillus, as demonstrated by flow cytometric analysis using PstS-specific mAbs (14). These lipoproteins are powerful B cell Ags, and the detection of Abs against PstS-1 has been reported to be a valuable tool in the serodiagnosis of tuberculosis (19). With respect to T cell immunity, previous studies have reported in detail on PstS-1 (20, 21, 22, 23), but nothing is known so far on T cell immunogenicity or protective efficacy of PstS-2 and PstS-3.
Using the technique of DNA vaccination, we now report on a comparative analysis of immunogenicity and protective efficacy in C57BL/6 (B6) mice of the three PstS proteins. We show that vaccination with all three genes induces strong and highly Ag-specific Abs and Th1-type T cell responses. Following i.v. M. tuberculosis challenge, the CFU number in spleen and lungs of mice vaccinated with plasmid DNA encoding PstS-3 was significantly lower than the number of CFU in spleen and lungs from mice vaccinated with empty-vector DNA. Vaccination with PstS-2 DNA induced a modest reduction in CFU counts in spleen only, whereas vaccination with PstS-1 DNA was completely ineffective in reducing bacterial multiplication.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ag85A-, PstS-1-, PstS-2-, and PstS-3-encoding genes of M. tuberculosis were amplified without their mycobacterial signal sequence from plasmid pBlueScript SK II+ (pBSK; Stratagene, La Jolla, CA) containing the Ag85A sequence (24), from AA71 EcoRI 2800-bp fragment (16), from R1 EcoRI 1100-bp fragment (14), and from plasmid pBSK.B2, respectively (13). PCR was performed with cycle conditions of 1 min 30 at 94°, 2 min at 50°, and 3 min at 72°. Ag85A, PstS-1, and PstS-2 were amplified with BglII containing primers (sense 85A, GGAAGATCTTTTCCCGGCCGGGCTTGCCG; anti-sense 85A, GGAAGATCTTGTCTGTTCGGAGCTAGGC; sense PstS-1, GGAAGATCTCGGGCTGTGGCTCGAAACCACCGAGCG; anti-sense PstS-1, GGAAGATCTCTGTCGCGTGGTGGTCAACGAGGCT; sense PstS-2, GGAAGATCTGCGGCGGTGGCACCAACAGCTCGTCGT; anti-sense PstS-2, GGAAGATCTACTAGGTCAAGAAATAGCATTCACC), whereas PstS-3, which contains an internal BglII site, was amplified with BamHI containing primers (sense PstS3, CGCGGATCCTCTGTGGTAACGACGACAATGTGACC; anti-sense PstS3, CGCGGATCCCGTCAACCTCAGATCAGG). Amplified DNA was digested with BglII or BamHI, isolated on a 1% agarose gel, and extracted on Prep-A-gene (Bio-Rad, Richmond, CA). Fragments were ligated to the BglII- or BamHI-digested and dephosphorylated V1Jns.tPA vector (25, 26), transformed into competent DH5 E. coli (BRL, Bethesda, MD) and plated on Luria–Bertani agar medium containing kanamycin (50 µg/ml) (Duchefa, Haarlem, The Netherlands). Recombinant plasmid DNA was amplified in E. coli strain DH5 and purified on two cesium chloride-ethidium bromide gradients, followed by 1-butanol, phenol/chloroform extractions and ethanol precipitation. Plasmid DNA was adjusted to a final concentration of 1 mg/ml in saline and stored at -20°C. In these plasmids, the genes are expressed under control of the promoter and intron A of the first immediate early Ag IE1 from CMV, linked to the leader signal of human tissue plasminogen activator (tPA) and followed by a polyadenylation site of the bovine growth hormone.
Mice
C57BL/6 (B6) (H-2b) mice were purchased from Bantin and Kingman (Hull, U.K.). Female mice, 6 to 8 wk old at the start of vaccination, were used.
Vaccination
Mice were anesthesized by i.p. injection of ketamine/xylazine (100 mg/kg and 10 mg/kg, respectively) and injected i.m. three times (at 3-wk intervals) in both quadriceps with PstS-1, PstS-2, PstS-3, or control DNA (empty V1Jns-tPA vector) in saline using a 0.3-ml insulin syringe (Becton Dickinson, San Jose, CA). Mice received 100 µg of DNA at each injection (50 µl of DNA at 1 mg/ml in each hind leg). As a first control group, mice were vaccinated with plasmid DNA encoding Ag85A, for which we have previously described a role in protection against tuberculosis (8). A second control group of mice was injected i.v. in a lateral tail vein with 106 CFU of freshly prepared BCG (strain GL2) grown as a surface pellicle on synthetic Sauton medium for 14 days (27) on the same day as the first DNA injection.
M. tuberculosis challenge
Mice were rested for 2 mo after the third DNA injection or
31/2 mo after BCG vaccination before being infected i.v. in a
lateral tail vein with 106 CFU of M.
tuberculosis H37Rv grown as a surface pellicle on synthetic Sauton
medium for 14 days and stored as a concentrated stock solution at
-70° in 20% glycerol. Mice were sacrificed at different time points
following challenge. Spleen and lungs from individual animals (three in
each group) were homogenized in PBS supplemented with penicilline and
amphotericin, and serial 10-fold dilutions were plated on 7H11
Middlebrook agar supplemented with albumin-oleic
acid-dextrose-catalase-enrichment broth (Difco, Detroit,
MI). Plates were incubated at 37°C in sealed plastic bags and the
number of CFU was counted visually after 4–5 wk. Results are presented
in mean log10 CFU/spleen or lungs ± SD. The 
log10
values were calculated as follows: log10 CFU in control DNA
vaccinated animals - log10 CFU in vaccinated animals.
For statistical analysis, Student’s t test was used.
Differences were considered as statistically significant at
p < 0.05.
Antigens
Native Ag85A protein was purified from BCG CF as described
previously by sequential chromatography on phenyl-Sepharose,
DEAE-Sephacel ion-exchange, and molecular sieving on Sephadex G75 (28).
Purified protein derivative, BCG CF, BCG cytoplasmic extract, and whole
BCG bacilli were prepared as described before (27). For the PstS
proteins, the same three "amplicons" described above under
Plasmid construction were inserted in frame with the
glutathione S-transferase (GST) coding region into the
BamHI site of pGex-5X-3 (Pharmacia Biotech, Piscataway,
NJ) to give the PstS-1, PstS-2, and PstS-3 fusion proteins and
were transformed into E. coli DH5
. Following induction
with isopropyl ß-D-thiogalactoside, the
recombinant fusion proteins were purified by chromatography on a
GST-purification module (Pharmacia Biotech) from 400-ml cultures as
described by the manufacturer. Purity of the purified recombinant
fusion proteins was examined by Coomassie staining of 15% SDS-PAGE.
Control GST material was prepared in the same manner from E.
coli transformed with pGex-5X-3 vector. Recombinant PstS-1 used
for cytokine analysis was a non-GST fusion protein prepared in E.
coli as described before (29). Whole CF from M.
tuberculosis H37Rv, Mycobacterium scrofulaceum,
Mycobacterium avium, Mycobacterium intracellulare, and
Mycobacterium kansasii were prepared by ammonium sulfate
precipitation from 14-day-old surface pellicle grown Sauton cultures
(30).
Ab analysis
Serum levels of PstS- and Ag85A-specific Abs were determined 3
wk after the last DNA injection, in individual mice, using an indirect
ELISA. Briefly, microtiter plates were coated overnight at 4°C with
purified PstS-1, PstS-2, PstS-3 (all in the form of recombinant GST
fusion proteins), or Ag85 (in its native form) at 5 µg/ml in borate
buffer. Plates were washed with PBS 0.1% Tween 20. The remaining
adsorption sites were saturated for 2 h at 37°C with proteins
from skim milk (5% in PBS). After washing, 100-µl volumes of serial
twofold dilutions of serum (starting at 1/50) in PBS 0.1% Tween 20
were applied for 2 h at 37°C. Plates were washed, and a
peroxidase-labeled rat anti-mouse 
light chain mAb (LO-MK-1,
Experimental Immunology Unit, Universite Catholique de Louvain,
Brussels, Belgium) was added for 2 h at 37°C. Finally, the
plates were washed and developed by the addition of 100 µl of
orthophenyldiamine (Sigma, St. Louis, MO), 0.4 mg/ml, diluted in
citrate/phosphate buffer, pH 5.6, and H2O2. The
reaction was stopped with 50 µl of 1 M H2SO4,
and OD were read at 492 nm with a automatic Multiskan MCC/340
(Titertek) reader.
Four individual mice were tested in each group. Data are expressed as OD values obtained for serum dilutions 1:1600. This dilution corresponded to the end of the plateau of sera showing high reactivity, which allows the comparison of the response with sera with lower reactivity.
Cytokine production
Vaccinated mice were sacrificed 3 wk after the last DNA
injection, and spleens were removed aseptically. Spleens from four mice
were pooled in each group. Spleen cells were adjusted at a
concentration of 4 x 106 cells/ml and grown in
round-bottom microwell plates (Nunc, Roskilde, Denmark) in RPMI
1640 medium (Life Technologies, Gaithersburg, MD) supplemented
with glutamine, HEPES, 50 µM 2-ME, antibiotics, and 10%
heat-inactived FCS (Life Technologies) (27). A volume of 180 µl of
cell suspension was added to a 20 µl of purified PstS-1, GST-PstS-2,
GST-PstS-3, GST, or Ag85A (5 µg/ml final) or the various CF (25
µg/ml final). Cells were incubated at 37°C in a humidified
CO2 incubator, and supernatants were harvested after
24 h (IL-2) and 72 h (IFN-). Supernatants from three
separate wells were pooled and stored frozen at -20°C until assayed.
The experiment was repeated 2 wk later with two mice in each group.
Finally, two mice vaccinated with PstS-3 DNA were sacrificed at week 8
after the third DNA vaccination for analysis of immune response against
nontuberculous mycobacterial (NTM) CF.
IL-2 assay
IL-2 activity was measured using a CTLL-2 proliferation
bio-assay. Briefly, a volume of 100 µl of 24-h culture supernatant
was added to 100 µl of CTLL-2 cells (105/ml) and
incubated for 48 h (27). [3H]Thymidine (8.3 Ci/ml;
Amersham, Arlington Heights, IL) was added (0.4 µCi/well)
during the last 6 h of culture. Cells were harvested on a Titertek
cell harvester (Skatron, Lier, Norway), and the radioactivity
recovered on the fibermats was counted in a betaplate scintillation
counter (Wallac, Turku, Finland). Each sample was tested in
duplicate. Error of the assay was <10%. IL-2 levels are expressed as
mean cpm. In this assay, 50,000 cpm corresponds to 
3.12 IU/ml or
600 pg/mls and the detection limit is 10 pg/ml (100–200 cpm)
(31).
IFN- assay
IFN- activity was quantified in duplicate on 72-h culture
supernatants using a mouse IFN- ELISA (Intertest-, catalogue
number 80-3842-03, Genzyme, Cambridge, MA). Error of the assay
was <10%. Concentrations are expressed as mean pg/ml. Detection limit
in this assay is 10 pg/ml.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As shown in Fig. 1
, vaccination with
all three plasmid DNAs encoding PstS-1, PstS-2, or PstS-3 induced
elevated Ab levels, which were highly Ag-specific, despite the fact
that the three genes demonstrate significant sequence similarity. Ab
response was highest in mice vaccinated with PstS-2 DNA. Abs generated
by vaccination with PstS-1 and PstS-2 DNA reacted only with the
corresponding proteins, one of the four mice vaccinated with PstS-3 DNA
cross-reacted to some extent with PstS-2, and the other three mice
reacted only to PstS-3. Confirming previous results, vaccination with
plasmid DNA encoding Ag85A also stimulated a strong humoral response
(8).
|
Vaccination with all three plasmid DNAs induced considerable IL-2
production in spleen cell cultures stimulated in vitro with the
corresponding specific Ag 3 wk after the last injection of DNA (Fig. 2). As a positive control, mice
vaccinated with Ag85A DNA were also analyzed. Elevated and comparable
IL-2 levels were detected in spleen cell cultures from mice vaccinated
with plasmid DNA encoding PstS-2, PstS-3, and Ag85A. IL-2 levels in
PstS-1 DNA-vaccinated animals were somewhat lower, whereas IL-2 levels
in spleen cell cultures from mice vaccinated with control DNA were
close to background levels. As for the Ab production, IL-2 production
was Ag-specific and no cross-reactivity could be observed. Mice
vaccinated with PstS-2 DNA demonstrated a certain degree of generalized
activation reflected by IL-2 production even in unstimulated cultures
or cultures stimulated with the GST control material. Significant IL-2
activity could also be measured in spleen cell cultures from PstS
DNA-vaccinated mice stimulated with purified protein derivative,
BCG CF, and BCG extract (data not shown). IL-2 production was also
examined in spleen cell cultures from mice (two spleens pooled in each
group) 5 wk after the third DNA injection. Again, vaccination with all
three plasmids was effective, PstS-2 and PstS-3 being superior to
PstS-1-encoding DNA (data not shown).
|
production in spleen from B6 mice vaccinated with plasmid
DNA encoding PstS-1, PstS-2, or PstS-3 from M.
tuberculosis
As for IL-2 production, all three PstS-encoding DNA constructs
induced significant Ag-specific IFN- levels, which were highest in
mice vaccinated with plasmid DNA encoding PstS-3 (Fig. 3). PstS-1 DNA also induced significant
IFN-, whereas PstS-2 DNA generated the lowest, albeit still
relatively high (about 600 pg/ml), IFN- response. As compared with
vaccination with Ag85A DNA, IFN- concentration induced with PstS-3
were about two times higher. IFN- production was also analyzed in
spleen cell cultures from mice (two spleens pooled in each group) 5 wk
after the third shot of DNA, and results were similar to the ones
obtained after 3 wk (data not shown).
|
As immune responses following vaccination with the three PstS
homologues appeared to be highly Ag-specific, cross-reactivity against
NTM species that can be pathogenic for man was analyzed. Spleen cells
from mice vaccinated with PstS-3 DNA from M. tuberculosis
were stimulated with crude CF (as a potential source for PstS-3
protein) from four atypical mycobacterial species and were analyzed for
Th1-type cytokine secretion. As shown in Fig. 4, very strong cross-reactive IL-2 and
IFN- responses were found against CF from M. kansasii and
particularly M. scrofulaceum in spleen cell cultures from B6
mice 8 wk after the third injection with PstS-3 DNA. CF from M.
intracellulare stimulated a cross-reactive IFN- (but not IL-2)
response, whereas CF from M. avium was not recognized at all
by spleen cells from B6 mice vaccinated with PstS-3 DNA. These data
suggest that immunodominant T cell epitopes on PstS-3 are highly
conserved between M. tuberculosis, M. kansasii,
and M. scrofulaceum, albeit different from the dominant T
cell epitopes on PstS-1 and PstS-2. The recognition of M.
intracellulare CF by IFN--producing T cells only could suggest
that this species only shares cross-reactive CD8+
epitope(s?) with M. tuberculosis, but no IL-2 inducing
CD4+ epitopes. In BALB/c mice vaccinated with 85A DNA, we
have indeed found that some CD8+ epitopes on the Ag85A
protein can induce IFN- secretion in the absence of IL-2 (32).
Production of IL-2 in response to purified PstS-3 was lower in this
experiment than in the previous one, possibly because spleens were
taken at a later time point (8 wk vs 3 wk) after the third DNA
vaccination. IFN- levels induced with PstS-3 were comparable in both
experiments. Spleen cells from mice vaccinated with PstS-1 DNA showed
very little cross-reactivity, whereas cells from PstS-2-vaccinated mice
also reacted to some extent to CF from M. scrofulaceum (data
not shown).
|
B6 mice vaccinated with PstS-3 (Fig. 5C) and Ag85A (Fig. 5D) DNA demonstrated significantly reduced numbers of
M. tuberculosis CFU in their spleens as compared with mice
vaccinated with control DNA. For PstS-3 DNA vaccination, the highest
reductions (comparable to the ones obtained with BCG) were observed at
the later time points, whereas reduction with Ag85A DNA was strongest
at early time points but started to wane at 12 wk after challenge.
Vaccination with PstS-1 DNA was completely ineffective (Fig. 5A), whereas PstS-2 DNA vaccine (monitored until week 10
after challenge only) conferred a moderate but significant protection
in spleen at weeks 4 and 10 (log10 0.69 and 0.99,
respectively). Comparing CFU values for the first time point, i.e., 2
wk after challenge, with those for the second time point, i.e., 4 wk,
control and PstS-1 DNA-vaccinated mice demonstrated maximal CFU counts
in the spleen already after 2 wk. These levels were comparable to CFU
counts at week 4. CFU counts in spleen from BCG and Ag85A
DNA-vaccinated mice were low at week 2 and increased about 1.5
log10 during the next 2 wk. Finally, in PstS-2- and
PstS-3-vaccinated mice, CFU counts in spleen were of intermediate value
(between control/PstS-1 and BCG/Ag85A) at week 2 and increased 1.0 and
0.5 log10, respectively, toward weeks 4.
|
B6 mice vaccinated with PstS-3 DNA also demonstrated significant
protection against M. tuberculosis replication in the lungs
(Fig. 6C). The levels of
protection were lower than those observed for BCG at week 4 and week 6
(log10 = 0.89 for PstS-3 vs 1.36 for BCG and 0.68 vs
1.62, respectively), but were not significantly different at the later
time points of 8, 10, and 12 wk of infection (1.31 vs 1.37, 0.94 vs
1.21 and 1.64 vs 1.93). Vaccination with DNA encoding PstS-1 was
completely ineffective (Fig. 6A), whereas vaccination with
PstS-2 DNA demonstrated a slight but significant protection at week 10
only (log10 = 0.62, p < 0.025; Fig. 6B). Vaccination with plasmid DNA encoding Ag85A was also
capable of reducing M. tuberculosis CFU values in the lungs
(Fig. 6D). In contrast to the results observed for PstS-3,
reductions in CFU counts in Ag85A DNA-vaccinated mice were observed
during the first 8 wk of challenge but at week 10 and 12 protection CFU
counts were not different from those in mice vaccinated with control
DNA. As for the spleen, mice vaccinated with control or PstS-1 DNA
demonstrated plateau CFU counts in the lung from week 2 on, whereas
mice vaccinated with BCG or Ag85A DNA demonstrated about a 1
log10 increase between week 2 and week 4. CFU counts in
PstS-2- and PstS-3-vaccinated mice were intermediate between control
and BCG values at week 2 and increased to control values for PstS-2 at
week 4 but only about 0.5 log10 in PstS-3-vaccinated mice.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and TNF-, is thought to be essential for
an effective tuberculosis vaccine (36, 37). Hence, DNA vaccination
using plasmid DNA encoding M. tuberculosis proteins may
offer a number of advantages over the classical live-attenuated or
second-generation protein-subunit vaccines (38). In recent years, it has become clear that the protective Ags for tuberculosis reside predominantly within the secreted or exported proteins of the bacillus, and early CF represent the main source of these extracellular Ags. Previously, we have shown that genes from the MHC exert a profound influence on the Ab repertoire and on the magnitude of Th1-type spleen cell cytokine secretion against these mycobacterial CF Ags (39, 40). Our studies enabled us to define two new Ags in BCG CF, a 37- to 38-kDa doublet protein and a 40-kDa protein, which were extremely immunogenic for B cells from mice with H-2b haplotype such as B6 and MHC congenic BALB.B10 mice (40). Monoclonal Abs against these two proteins were derived from BCG-vaccinated H-2b mice (11) and enabled the identification of two new genes in M. tuberculosis very similar to the previously described 38-kDa protein (also called pab, Ag78, or Ag5) (17). As all three genes code for proteins homologous to the periplasmic ABC phosphate-binding receptor PstS from E. coli, we have proposed to rename them as PstS-1 (38 kDa), PstS-2 (37–38 kDa doublet), and PstS-3 (40 kDa), respectively (14). In view of the essential role of phosphate in numerous biochemical processes, the strong surface expression (14), and the immunodominance of these phosphate-binding proteins for "resistant" H-2b haplotype mice (11), we decided to compare the protective potential of these three PstS homologues using the technique of DNA vaccination.
B6 mice were vaccinated with control plasmid or with plasmid DNA
encoding PstS-1, PstS-2, or PstS-3. As a positive control, mice were
also vaccinated with plasmid DNA encoding the Ag85A component of the
Ag85 complex, which, as previously reported, protects B6 mice against
low-dose aerosol challenge given 10 wk after vaccination (8). All three
PstS-encoding DNA constructs were found to be immunogenic, as measured
by Ab production or Th1-type cytokine secretion. Plasmid DNA encoding
PstS-1 was the weakest of the three constructs. IL-2 and Ab titers were
comparable following vaccination with DNA encoding PstS-2 and PstS-3.
IFN- production was strongest in mice vaccinated with DNA encoding
PstS-3. Despite the overall similarity between the three proteins,
immune responses were Ag-specific, and very little cross-reactivity
could be observed either at the B cell or at the T cell level.
Protection against i.v. challenge with M. tuberculosis H37Rv
was monitored by CFU counting over a period of 3 mo. Only vaccination
with plasmid DNA encoding PstS-3 and Ag85A was found to consistently
reduce the CFU counts in both spleen and lungs as compared with CFU
counts in mice vaccinated with empty vector. The number of CFU was 10-
to 30-fold lower in vaccinated than in control mice. Protection with
Ag85A DNA was most pronounced during the first 8 wk of challenge but
gradually disappeared at later time points. It may be hypothesized that
expression of relevant Ag85A epitopes on the surface of the infected
macrophages was down-regulated at these late time points, which may
have impaired recognition by Ag85A-specific T cells, or, alternatively,
that Ag85-specific T cells became exhausted through apoptotic
interactions (41). In contrast, protection with PstS-3 DNA was only
modest at early time points but became more pronounced later and was
sustained until week 12 after challenge. To what extent relevant
PstS-3-specific epitopes become more abundantly expressed at later time
points on the infected macrophage is obviously a question that requires
more detailed analysis.
Spleen cells from PstS-3 DNA-vaccinated mice also secreted IL-2 and
IFN- when stimulated in vitro with whole CF from the NTM M.
scrofulaceum, M. kansasii, and to a lesser extent
M. intracellulare, suggesting that PstS-3-specific
H-2b epitopes were conserved in these three species. In
1966, Palmer and Long demonstrated that infection of guinea pigs with
M. kansasii and M. scrofulaceum (Gause) could
induce a BCG-like effect against virulent M. tuberculosis,
and their results suggested that all the relevant protective Ags
present in these NTM were shared with BCG (42). More recently, we have
confirmed that in an experimental mouse model, BCG vaccination, and
M. scrofulaceum infection can indeed interfere with each
other, and particularly so in mice with H-2b haplotype
(30). In this context, it can be speculated that the presence of
M. scrofulaceum in the environment could induce
cross-reactive immune responses to protective Ags of M.
tuberculosis/BCG, such as the phosphate-binding PstS-3 protein,
and that these cross-reactive immune responses may partly explain
the variable protection observed with BCG, particularly in tropical and
subtropical regions with high incidence of environmental mycobacteria
(43).
So far, protective efficacy against tuberculosis has been reported for DNA vaccines encoding hsp65 (44), the 38-kDa Ag (45), and the Ag85A component from the Ag85 complex (8). The relative potency of these DNA vaccines with respect to one another is not known. Unfortunately, it is impossible to draw conclusions from the published literature, as three different plasmid vectors, with different inherent adjuvanticity (linked to their number of unmethylated CpG-dinucleotides and "Krieg" motifs (46)), different mouse strains, different challenge models (aerosol vs i.p.), and different resting times before challenge (ranging from 2 to 10 wk) have been used. Furthermore, previous studies mostly reported on protection at one particular time point (4 wk after challenge), whereas we have monitored for the first time a challenge experiment over a 3-mo period. Variations in methodology may well explain why Zhu et al. observed protection against i.p. challenge with M. tuberculosis administered 2 wk after the last vaccination with plasmid DNA encoding PstS-1 (45), whereas we were unable to find any protection following vaccination with the same pstS-1 gene against an i.v. M. tuberculosis challenge after resting the mice for 2 mo. Our results clearly show that a reliable, comparative screening can only be performed when genes are compared on the same plasmid vector backbone and using the same experimental protocol.
In conclusion, vaccination with plasmid DNA encoding PstS-3 was found to be an efficient method for generating strong and sustained protective immunity in spleen and lungs following i.v. challenge with M. tuberculosis H37Rv in B6 mice. Preliminary results indicate that PstS-3 DNA vaccination is also effective in other mouse strains (data not shown). Obviously, these promising results in mice have to be confirmed in other animal models, such as guinea pigs and more importantly nonhuman primates, before human trials can be envisaged.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kris Huygen, Pasteur Institute of Brussels, Mycobacterial Immunology, 642 Engelandstraat, 1180 Brussels, Belgium. E-mail address:
3 Abbreviations used in this paper: BCG, Mycobacterium bovis Bacille Calmette-Guérin strain; B6, C57BL/6; PstS, phosphate-specific transport S; GST, glutathione S-transferase; ABC, ATP-binding cassette; CF, culture filtrate; NTM, nontuberculous mycobacteria; tPA, tissue plasminogen activator.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249. is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2:561.[Medline]
interferon production in response to a 32-kilodalton antigen (P32) of Mycobacterium bovis bacillus Calmette-Guerin. Infect. Immun. 56:3196.. Proc. Natl. Acad. Sci. USA 93:2879.This article has been cited by other articles:
|
|
 |
|
  D. N. Harland, K. Chu, A. Haque, M. Nelson, N. J. Walker, M. Sarkar-Tyson, T. P. Atkins, B. Moore, K. A. Brown, G. Bancroft, et al. Identification of a LolC Homologue in Burkholderia pseudomallei, a Novel Protective Antigen for Melioidosis Infect. Immun., August 1, 2007; 75(8): 4173 - 4180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Semret, D. Bakker, N. Smart, I. Olsen, K. Haslov, and M. A. Behr Genetic Analysis of Mycobacterium avium Complex Strains Used for Producing Purified Protein Derivatives. Clin. Vaccine Immunol., September 1, 2006; 13(9): 991 - 996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D'Souza, M. Romano, J. Korf, X.-M. Wang, P.-Y. Adnet, and K. Huygen Partial Reconstitution of the CD4+-T-Cell Compartment in CD4 Gene Knockout Mice Restores Responses to Tuberculosis DNA Vaccines. Infect. Immun., May 1, 2006; 74(5): 2751 - 2759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Beninati, A. Midiri, G. Mancuso, C. Biondo, M. Arigo, E. Gerace, S. Papasergi, M. Gambuzza, M. Boretti, W. Magliani, et al. Antiidiotypic DNA vaccination induces serum bactericidal activity and protection against group B meningococci J. Exp. Med., January 23, 2006; 203(1): 111 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Ko, S.-Y. Ko, Y.-J. Kim, E.-G. Lee, S.-N. Cho, and C.-Y. Kang Optimization of Codon Usage Enhances the Immunogenicity of a DNA Vaccine Encoding Mycobacterial Antigen Ag85B Infect. Immun., September 1, 2005; 73(9): 5666 - 5674. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Shin, C.-F. Chang, C.-D. Chang, S. P. McDonough, B. Thompson, H. S. Yoo, and Y.-F. Chang In Vitro Cellular Immune Responses to Recombinant Antigens of Mycobacterium avium subsp. paratuberculosis Infect. Immun., August 1, 2005; 73(8): 5074 - 5085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Garmory and R. W. Titball ATP-Binding Cassette Transporters Are Targets for the Development of Antibacterial Vaccines and Therapies Infect. Immun., December 1, 2004; 72(12): 6757 - 6763. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Romano, O. Denis, S. D'Souza, X.-M. Wang, T. H. M. Ottenhoff, J.-M. Brulet, and K. Huygen Induction of In Vivo Functional Db-Restricted Cytolytic T Cell Activity against a Putative Phosphate Transport Receptor of Mycobacterium tuberculosis J. Immunol., June 1, 2004; 172(11): 6913 - 6921. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stratmann, B. Strommenger, R. Goethe, K. Dohmann, G.-F. Gerlach, K. Stevenson, L.-l. Li, Q. Zhang, V. Kapur, and T. J. Bull A 38-Kilobase Pathogenicity Island Specific for Mycobacterium avium subsp. paratuberculosis Encodes Cell Surface Proteins Expressed in the Host Infect. Immun., March 1, 2004; 72(3): 1265 - 1274. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Huygen On the Use of DNA Vaccines for the Prophylaxis of Mycobacterial Diseases Infect. Immun., April 1, 2003; 71(4): 1613 - 1621. [Full Text]
|
|
|
|
|
|
S. D'Souza, V. Rosseels, M. Romano, A. Tanghe, O. Denis, F. Jurion, N. Castiglione, A. Vanonckelen, K. Palfliet, and K. Huygen Mapping of Murine Th1 Helper T-Cell Epitopes of Mycolyl Transferases Ag85A, Ag85B, and Ag85C from Mycobacterium tuberculosis Infect. Immun., January 1, 2003; 71(1): 483 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D'Souza, V. Rosseels, O. Denis, A. Tanghe, N. De Smet, F. Jurion, K. Palfliet, N. Castiglioni, A. Vanonckelen, C. Wheeler, et al. Improved Tuberculosis DNA Vaccines by Formulation in Cationic Lipids Infect. Immun., July 1, 2002; 70(7): 3681 - 3688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Chambers, A. Williams, G. Hatch, D. Gavier-Widen, G. Hall, K. Huygen, D. Lowrie, P. D. Marsh, and R. G. Hewinson Vaccination of Guinea Pigs with DNA Encoding the Mycobacterial Antigen MPB83 Influences Pulmonary Pathology but Not Hematogenous Spread following Aerogenic Infection with Mycobacterium bovis Infect. Immun., April 1, 2002; 70(4): 2159 - 2165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Orihuela, J. Mills, C. W. Robb, C. J. Wilson, D. A. Watson, and D. W. Niesel Streptococcus pneumoniae PstS Production Is Phosphate Responsive and Enhanced during Growth in the Murine Peritoneal Cavity Infect. Immun., December 1, 2001; 69(12): 7565 - 7571. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Al-Mariri, A. Tibor, P. Mertens, X. De Bolle, P. Michel, J. Godfroid, K. Walravens, and J.-J. Letesson Induction of Immune Response in BALB/c Mice with a DNA Vaccine Encoding Bacterioferritin or P39 of Brucella spp. Infect. Immun., October 1, 2001; 69(10): 6264 - 6270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. A. J. Fonseca, B. Benaissa-Trouw, M. van Engelen, C. A. Kraaijeveld, H. Snippe, and A. F. M. Verheul Induction of Cell-Mediated Immunity against Mycobacterium tuberculosis Using DNA Vaccines Encoding Cytotoxic and Helper T-Cell Epitopes of the 38-Kilodalton Protein Infect. Immun., August 1, 2001; 69(8): 4839 - 4845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Orme The search for new vaccines against tuberculosis J. Leukoc. Biol., July 1, 2001; 70(1): 1 - 10. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tanghe, S. D'Souza, V. Rosseels, O. Denis, T. H. M. Ottenhoff, W. Dalemans, C. Wheeler, and K. Huygen Improved Immunogenicity and Protective Efficacy of a Tuberculosis DNA Vaccine Encoding Ag85 by Protein Boosting Infect. Immun., May 1, 2001; 69(5): 3041 - 3047. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tanghe, O. Denis, B. Lambrecht, V. Motte, T. van den Berg, and K. Huygen Tuberculosis DNA Vaccine Encoding Ag85A Is Immunogenic and Protective When Administered by Intramuscular Needle Injection but Not by Epidermal Gene Gun Bombardment Infect. Immun., July 1, 2000; 68(7): 3854 - 3860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Martin, A. T. Kamath, J. A. Triccas, and W. J. Britton Protection against Virulent Mycobacterium avium Infection following DNA Vaccination with the 35-Kilodalton Antigen Is Accompanied by Induction of Gamma Interferon-Secreting CD4+ T Cells Infect. Immun., June 1, 2000; 68(6): 3090 - 3096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. C. Turner, A. D. Roberts, A. A. Frank, S. W. Phalen, D. M. McMurray, J. Content, O. Denis, S. D'Souza, A. Tanghe, K. Huygen, et al. Lack of Protection in Mice and Necrotizing Bronchointerstitial Pneumonia with Bronchiolitis in Guinea Pigs Immunized with Vaccines Directed against the hsp60 Molecule of Mycobacterium tuberculosis Infect. Immun., June 1, 2000; 68(6): 3674 - 3679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Lefevre, O. Denis, L. De Wit, A. Tanghe, P. Vandenbussche, J. Content, and K. Huygen Cloning of the Gene Encoding a 22-Kilodalton Cell Surface Antigen of Mycobacterium bovis BCG and Analysis of Its Potential for DNA Vaccination against Tuberculosis Infect. Immun., March 1, 2000; 68(3): 1040 - 1047. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Arichi, T. Saito, M. E. Major, I. M. Belyakov, M. Shirai, V. H. Engelhard, S. M. Feinstone, and J. A. Berzofsky Prophylactic DNA vaccine for hepatitis C virus (HCV) infection: HCV-specific cytotoxic T lymphocyte induction and protection from HCV-recombinant vaccinia infection in an HLA-A2.1 transgenic mouse model PNAS, January 4, 2000; 97(1): 297 - 302. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
