The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weidanz, W. P.
Right arrow Articles by Heyde, H. C. v. d.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weidanz, W. P.
Right arrow Articles by Heyde, H. C. v. d.
Right arrowPubmed/NCBI databases
*Gene
Medline Plus Health Information
*Malaria
The Journal of Immunology, 1999, 162: 7383-7388.
Copyright © 1999 by The American Association of Immunologists

Plasticity of Immune Responses Suppressing Parasitemia During Acute Plasmodium chabaudi Malaria1

William P. Weidanz2,*, Justin R. Kemp*, Joan M. Batchelder*, Francine K. Cigel*, Matyas Sandor{dagger} and Henri C. van der Heyde{ddagger}

Departments of * Medical Microbiology and Immunology and {dagger} Pathology, University of Wisconsin Medical School, Madison, WI 53706; and {ddagger} Department of Microbiology and Immunology, Louisiana State University Medical Center, Shreveport, LA 71103


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{gamma}{delta} T cells have a crucial role in cell-mediated immunity (CMI) against P. chabaudi malaria, but {delta}-chain knockout (KO) ({delta}o/o) mice and mice depleted of {gamma}{delta} T cells with mAb cure this infection. To address the question of why mice deficient in {gamma}{delta} T cells resolve P. chabaudi infections, we immunized {delta}o/o mice by infection with viable blood-stage parasites. Sera from infection-immunized mice were tested for their ability to protect JHo/o, {delta}o/o double KO mice passively against P. chabaudi challenge infection. The onset of parasitemia was significantly delayed in mice receiving immune sera, compared with saline or uninfected serum controls. Immune sera were then fractionated into Ig-rich and Ig-depleted fractions by HPLC on a protein G column. Double KO mice were passively immunized with either fraction and challenged with P. chabaudi. The onset of parasitemia was significantly delayed in recipients of the Ig-rich fraction compared with recipients of the Ig-poor fraction of immune sera. We conclude that {delta}o/o mice, which are unable to activate CMI against the parasite, suppress P. chabaudi infection by a redundant Ab-mediated process.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased numbers of {gamma}{delta} T cells are found in the blood and spleens of human subjects and experimental animals with acute malaria (reviewed in 1). After cure, these cell counts remain elevated for prolonged periods of time. In human malaria, the expansion of the {gamma}{delta} T cell subset is polyclonal, involving the V{gamma}9+, V{delta}2+, and V{delta}1+ subsets (2, 3). Recent findings indicate that subjects living in areas of endemic malaria transmission either lack {gamma}{delta} T cells or have subnormal numbers of {gamma}{delta} T cells in their peripheral blood (4, 5). Whether parasitemic or not, these individuals, who are infected repeatedly or continuously with malarial parasites, may have down-regulated their {gamma}{delta} T cell response after developing more efficient mechanisms of immunity to control the low-grade parasitemia of chronic malaria.

Human {gamma}{delta} T cells proliferate in response to falciparum Ags in vitro (reviewed in 6). Their response is dependent upon CD4+ T cells that supply help through the production of cytokines; the CD4+ T cell requirement is replaced by cytokines that stimulate through components of the IL-2R (7). Similarly, the expansion of the splenic {gamma}{delta} T cell subset during murine malaria induced with Plasmodium chabaudi is also dependent upon CD4+ T cells; treatment with anti-CD4 mAb prevents the expansion of the {gamma}{delta} T cell subset in infected mice (8). Human {gamma}{delta} T cells appear to recognize malarial Ags complexed to MHC class I, but not to MHC class II, molecules (9). In contrast, murine {gamma}{delta} T cells recognize malarial Ags independent of MHC class I molecules (10). Although the nature of the {gamma}{delta} T cell-stimulating Ags remains uncertain, human {gamma}{delta} T cells having the V{gamma}9, V{delta}2 phenotype respond to nonpeptide pyrophosphate Ags similar to those extracted from mycobacterial species (11). When activated by malarial Ags, {gamma}{delta} T cells produce an array of cytokines, including IFN-{gamma} and TNF-{alpha}, and less frequently, IL-4 (12). Thus, it has been suggested that these cells may function to activate other cells of both the innate and adaptive immune systems or function as a "first line of defense" (13).

Accumulating evidence suggests that {gamma}{delta} T cells function in protective immunity against malaria and are responsible for certain of the pathological changes associated with this disease (14, 15, 16). In addition to the characteristics described above, we have reported that cloned human {gamma}{delta} T cells are cytotoxic for blood-stage P. falciparum parasites (17). Moreover, we have observed that murine {gamma}{delta} T cells are a crucial component of cell-mediated immunity (CMI)3 against P. chabaudi malaria (18); mAb depletion of {gamma}{delta} T cells from JHo/o mice prevents the suppression of acute malaria that normally occurs in JHo/o mice. In contrast, when {delta}o/o mice deficient in {gamma}{delta} T cells, but otherwise intact, were infected with P. chabaudi, the course of infection was slightly prolonged and the recrudescent parasitemia was higher when compared with control {delta}+/+ mice (19). These authors suggest "... that {gamma}{delta} T cells can contribute, albeit in a minor way, to the clearance of the acute stage parasitemia of P. chabaudi." Preliminary studies in our laboratory confirmed this observation, i.e., P. chabaudi infections in {delta}o/o mice were resolved in nearly the same time frame as control mice. Accordingly, the current study was undertaken to determine the mechanism by which acute P. chabaudi malaria is suppressed in mice deficient in {gamma}{delta} T cells. The results of passive immunization experiments with sera obtained from infection-immunized {delta}o/o mice indicate that these mice suppress P. chabaudi malaria by mechanisms of Ab-mediated immunity (AMI). Moreover, they suggest a plasticity of immune responses that the host may activate to resolve infections caused by a single species of malarial parasite. Thus, in addition to suppressing the parasitemia of acute P. chabaudi malaria by CMI, mice can suppress acute P. chabaudi infection by AMI in approximately the same time frame.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Female C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and used at 6–10 wks of age. {delta}o/o and JHo/o mice homozygous for targeted deletions of TCR{delta} genes (20) and JH Ig genes (21), originally purchased from The Jackson Laboratory or kindly provided by Dr. D. Huszar (GenPharm International, Mountain View, CA), respectively, were maintained and bred at the University of Wisconsin Animal Care Unit (Madison, WI). Double knockout (KO) mice lacking both JH and {delta}-chain genes were produced by crossing single KO mice to produce F1 progeny heterozygous for both genes and then mating these back to the JHo/o parent. KO mice homozygous for the mutated JH gene but heterozygous for the {delta}-chain gene were then crossed to produce double KO (JHo/o, {delta}o/o) mice lacking B cells and {gamma}{delta} T cells. Mice homozygous for mutated JH genes and lacking serum Igs were identified by gel diffusion analysis. Mice homozygous or heterozygous for mutated {delta}-chain genes were identified by standard PCR-based analysis. Briefly, The Wizard Genomic DNA purification system (Promega, Fitchburg, WI) was used to extract DNA from ~100 µl of heparinized blood. Subsequently, 10 µl of the DNA sample was amplified in a 35-cycle PCR reaction with the GeneAmp PCR System 9600 (Perkin-Elmer, Norwalk, CT) and the following cycling conditions: 50 s at 94°C, 50 s at 60°C, and 1 min at 72°C. The primers used were as follows: CTATCTGCCCATTGATGAGA (D/Neo), CCATTTGTCACGTCCTGCACG (pgk -286), CAAATGTTGCTTGTCTGGTG (TCR CD1), and GTCAGTCGAGTGCACAGTTT (TCR CD2). Amplicons were analyzed on a 1.8% ethidium bromide-stained agarose gel. Heterozygote mice yielded a 280-bp band (KO primers, D/Neo and pgk -286) and a 200-bp band (wild-type primers, TCR CD1 and TCR CD2). Mice homozygous for the {delta}-chain deficiency produced only the 280-bp KO band. Age- and sex-matched mice of both sexes were used between 8 and 12 wk of age.

Parasites and infection of mice

P. chabaudi adami 556KA, hereafter referred to as P. chabaudi, was maintained as frozen stabilate material and used as described previously (22). Briefly, malarial infections were initiated in mice that were not treated with Abs or sera by the i.p. injection of 1 x 106 parasitized erythrocytes obtained from a donor mouse. Mice treated i.p. with Abs or sera were injected i.v. with 1 x 105 parasitized erythrocytes. Comparison of parasitemia curves (23) suggests a similarity in the course of infection initiated by the injections of 105 parasites given by the i.v. route vs 106 parasites injected i.p. We have found that the injection of both parasites and serum i.p. can kill the parasites, thereby preventing infection. Therefore, we routinely use 105 parasites i.v. to give a course of infection comparable to 106 parasites i.p.

Parasitemia was assessed by enumerating 200-1000 erythrocytes in Giemsa-stained films of tail blood. ANOVA was performed with the Minitab (State College, PA) program and with SAS (Cary, NC) statistical software. With the exception of the passive immunization experiment with fractionated immune serum, all experiments were replicated at least once and gave essentially identical results. Because of the similarity of the data from passive immunization with immune sera presented in Fig. 4Go and the results of the passive immunization experiment with fractionated immune sera (Fig. 5Go), we did not believe it necessary to repeat the experiment with fractionated immune sera.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Time course of P. chabaudi infection in JHo/o, {delta}o/o mice passively immunized with serum obtained from infection-immunized {delta}o/o mice, serum from noninfected {delta}o/o mice, or saline (four mice per group). The results are expressed as the parasitemia for individual mice injected with immune serum and the mean (±SD) for the groups of control mice.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. Time course of P. chabaudi parasitemia in groups of JHo/o, {delta}o/o mice passively immunized with fractionated Ab-enriched or Ab-depleted serum or saline (three mice per group). The results are expressed as the parasitemia for individual mice injected with immune serum and the mean (±SD) for the control groups of mice

 
Ab depletion

HPLC-purified anti-TCR{gamma}{delta} (GL3) was kindly provided by Dr. C. Czu-prynski (University of Wisconsin, Madison, WI). Purified hamster IgG was obtained commercially (Accurate Chemicals, Westbury, NY). Anti-TCR{gamma}{delta} mAb and hamster Ig were injected (i.p.) into mice (four mice per treatment group) with 0.5 mg/mouse on days -1, 0, and 1. Mice were infected with 1 x 105 P. chabaudi-parasitized erythrocytes i.v. on day 0, and parasitemia was estimated subsequently, as above.

Immune sera

Immune sera were obtained from {delta}o/o mice following the suppression of parasitemia in mice inoculated i.p. 4 wk previously with 1 x 106 P. chabaudi-parasitized erythrocytes. Infection-immunized and uninfected control {delta}o/o mice were bled by cardiac puncture under metofane anesthesia; the sera were pooled as immune or control sera, respectively, and stored at -80°C. P. chabaudi immune sera were fractionated into Ig-rich and Ig-poor components as follows: immune sera were diluted 1:5 in running buffer (25 mM Tris, 0.1 M NaCl (pH 8)) and subjected to HPLC on a Poros protein G column (Perceptive Biosystems, Framingham, MA). The Ig-poor pass-through eluate was collected and pooled. Bound Ig was subsequently eluted stepwise with 0.3 M MgCl2 in 3% acetic acid. The pH was immediately adjusted to ~7.2, and the Ig-rich fractions were pooled. Both fractions were dialyzed against PBS (pH 7.2) and concentrated to the original serum volume by means of ultrafiltration through an ULTRAFREE-20 filter (Millipore, Bedford, MA) having a 10-kDa cutoff. Before injection into mice, the fractions were sterilized by passage through a 0.22-µM filter (Costar, Cambridge, MA).

Passive immunization

The immune sera obtained above were injected in a dose of 0.45 ml i.p. on days -1, 0, and +1, relative to i.v. inoculation with 1 x 105 P. chabaudi-parasitized erythrocytes. Control mice were injected identically with sterile saline or control sera from uninfected {delta}o/o mice and challenged with 1 x 105 P. chabaudi-parasitized erythrocytes. Passive immunization with fractionated immune sera was conducted in the same manner, except that the recipients were injected with 0.5 ml of Ig-rich or Ig-poor fractions of immune sera.

Flow cytometry

Two-color flow cytometry was performed on single cell suspensions of spleen cells as described previously (24). The biotinylated Abs were anti-CD3-{epsilon} (Boehringer Mannheim, Indianapolis, IN), anti-TCR-{alpha}ß, anti-TCR-{gamma}{delta}, anti-V{gamma}3, and hamster IgG isotype control (PharMingen, San Diego, CA). The streptavidin-PE was obtained from Southern Biotechnology Associates (Birmingham, AL). FITC-conjugated Abs were: anti-CD3, anti-CD4, anti-CD8 (Boehringer Mannheim), and rat IgG isotype control (PharMingen). Hybridomas producing anti-V{gamma}1.1 (25), anti-V{gamma}2 (26), and anti-V{gamma}5 (27) were kindly provided by Dr. Jeffrey Bluestone (Ben May Institute for Cancer Research, University of Chicago, Chicago, IL). The hybridomas were grown in serum-free medium, and the resulting mAbs were conjugated with FITC using standard procedures. Propidium iodide was added 5 min before data acquisition to allow exclusion of dead cells. Data acquisition and analysis were performed on a FACScan (Becton Dickinson, Mountain View, CA) with the use of Cellquest and Attractors (Becton Dickinson) programs, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Time course of acute P. chabaudi malaria in {delta}0/0 mice

Previously, we reported that P. chabaudi infections are prolonged and display higher parasitemia in C57BL/6 mice depleted of {gamma}{delta} T cells by treatment with anti-TCR{gamma}{delta} mAb in comparison with TCR{gamma}{delta}-intact controls (18). To determine whether the time course of P. chabaudi infection is prolonged similarly in gene KO mice lacking {gamma}{delta} T cells, we infected {delta}0/0mice and {gamma}{delta} T cell-intact C57BL/6 control mice with 1 x 106 parasitized erythrocytes i.p.; the resulting parasitemia was monitored as described above. The results (Fig. 1Go) reveal that the parasitemia in {delta}0/0 mice was significantly greater during the latter part of the acute infection and the course of infection prolonged by several days compared with control mice. However, for the most part, the time course was similar in both groups of mice.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. Time course of parasitemia during P. chabaudi infection in {delta}o/o and C57BL/6 mice. The parasitemia (mean ± SD) was determined in groups of five {delta}o/o and C57BL/6 mice. *, Statistical differences (p < 0.05) in parasitemia between KO and control groups of mice.

 
Effects of treating {delta}o/o mice with anti-TCR{gamma}{delta} mAb on the course of P. chabaudi malaria

To make a functional check for the depletion of minor subpopulations of cells, due to the possible toxicity of the mAb, we treated {delta}o/o and JHo/o mice with the same regimen of anti-TCR{gamma}{delta} mAb injected i.p., as described above. Control {delta}o/o and JHo/o mice were injected with hamster Ig. All mice were infected i.v. with 1 x 105 P. chabaudi-parasitized erythrocytes. Parasitemia was subsequently monitored as described above. Whereas treatment with the depleting mAb had little, if any, effect on the course of P. chabaudi malaria in {delta}o/o mice (Fig. 2GoA), it prevented the suppression of parasitemia in JHo/o mice (Fig. 2GoB), as reported previously (18).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. Time course of P. chabaudi infection in {delta}o/o mice treated with anti-TCR{gamma}{delta} mAb or hamster IgG (A) and JHo/o mice treated with anti-TCR{gamma}{delta} or hamster IgG (B). The parasitemia (mean ± SD) was determined in groups of four (A) or three (B) mAb or hamster IgG-treated mice on the days shown. *, Statistical differences (p < 0.05) in parasitemia between group test and control mice.

 
Flow cytometric analysis of spleen cells obtained from P. chabaudi-infected {delta}o/o mice

To determine whether {delta}o/o mice harbored aberrant CD3+ T cells (e.g., bearing TCR{gamma}ß (28)) that would not be depleted by treatment with mAb GL-3, nor detected by flow cytometric analysis of spleen cells stained with mAb GL-3, we analyzed single cell suspensions from spleens of uninfected and P. chabaudi-infected {delta}o/o and {delta}-chain-intact control mice. Spleens were harvested from infected mice 3 wks postinoculation i.p. with 1 x 106 P. chabaudi, and cells suspensions were stained with mAb specific for V{gamma}1.1, V{gamma}2, V{gamma}3, and V{gamma}5. Approximately 90% of the CD3+ TCR{gamma}{delta} splenocytes from infected or uninfected {delta}-chain-intact mice belonged to the V{gamma}1.1+ and V{gamma}2+ subsets (data not shown.) None of the cells were stained with anti-V{gamma}3 or anti-V{gamma}5. Moreover, V{gamma}-expressing CD3+ cells were not detected in splenocyte preparations from {delta}o/o mice, regardless of their infection status.

The course of P. chabaudi parasitemia in JHo/o, {delta}o/o mice

We previously reported that acute P. chabaudi infections failed to clear in JHo/o treated with anti-{delta}-chain mAb (18). To confirm this observation, we produced JHo/o, {delta}o/o as described above. JHo/o, {delta}o/o and JHo/o, {delta}o/+ control mice were infected i.p. with 1 x 106 P. chabaudi-parasitized erythrocytes. Whereas control mice deficient in B cells suppressed their acute infections as described previously, double KO mice deficient in both B cells and {gamma}{delta} T cells were unable to do so and instead developed progressive infection with relatively high levels of parasitemia (Fig. 3Go).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. Time course of P. chabaudi parasitemia (mean ± SD) in double KO (JHo/o, {delta}o/o) and control (JHo/o, {delta}o/+) mice (four mice per group) on the days shown. *, Statistical differences (p < 0.05) in parasitemia between groups of double KO and control mice.

 
Passive immunization against P. chabaudi infection with immune sera

To determine whether the sera of infection-immunized mice was capable of protecting JHo/o, {delta}o/o mice against challenge infection with 1 x 105 P. chabaudi-parasitized erythrocytes injected i.v. on day 0, JHo/o mice were injected i.p. as described above with 0.45 ml of immune sera obtained from infection-immunized {delta}o/o mice on days -1, 0, and +1. Control double KO mice were injected identically with pooled serum from uninfected {delta}o/o mice or saline and challenged identically. The results (Fig. 4Go) indicate that the onset of parasitemia in the mice given immune sera was not detected until the 11th day following the inoculation of parasites. In contrast, all the control mice injected with nonimmune sera were parasitemic by day 5 following the initiation of infection. A comparison of the two groups of mice revealed significant differences in mean parasitemia (p < 0.05) on days 11, 13, 15, and 17. One of three mice treated with immune sera did not exhibit parasitemia during the 21-day observation period.

A comparison of the ability of protein G-fractionated immune sera to protect JHo/o, {delta}o/o mice against P. chabaudi challenge

Having observed that the sera of infection-immunized mice delayed the onset of patent parasitemia in JHo/o, {delta}o/o recipients, we fractionated immune sera from {delta}o/o mice by affinity chromatography on a protein G column into Ig-rich and Ig-poor fractions. Double KO mice were injected i.p. with 0.5 ml of either fraction on days, -1, 0, and +1, relative to the time of challenge infection, with 1 x 105 P. chabaudi-parasitized erythrocytes. The onset of parasitemia in mice injected with Ig-rich fractions was delayed in comparison to control mice receiving Ig-poor fractions (Fig. 5Go). Whereas parasitemia became patent in one of three test mice on day 9 of infection, parasitemia was patent in the three control mice on day 5 of infection. A comparison of parasitemia in test vs control mice indicated significant (p < 0.05) mean differences between groups on days 9 and 11 following the initiation of infection.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of {gamma}{delta} T cells in immunity to malaria has been difficult to ascertain. We originally proposed a protective function for these cells based on our observation that the number of {gamma}{delta} T cells was elevated in peripheral blood during acute P. falciparum malaria and remained elevated for at least 4 wk during convalescence (29). We also observed that cloned human {gamma}{delta} T cells were cytotoxic for P. falciparum in vitro (17). However, different conclusions regarding the significance of {gamma}{delta} T cells were derived from the analysis of experimental malaria in {gamma}{delta} T cell-deficient mice, including mice depleted of {gamma}{delta} T cells with mAb and {delta}o/o mice (19, 30). The results of these studies indicate that mice deficient in {gamma}{delta} T cells, but otherwise possessing an intact immune system, display exacerbated levels of parasitemia but suppress acute P. chabaudi blood-stage infections in approximately the same time frame as {gamma}{delta} T cell-intact control mice or after a short delay. The results of the present study in which {delta}o/o mice were infected with P. chabaudi confirm and extend the findings of the above published reports in which {delta}o/o mice were infected with the more virulent chabaudi subspecies of P. chabaudi (19) or utilized mice depleted of {gamma}{delta} T cells by treatment with mAb (30). Whereas we observed that V{gamma}1.1+ and V{gamma}2+ subsets comprised ~90% of the splenic {gamma}{delta} T cells in intact mice, we failed (data not shown) to demonstrate the presence of {gamma}-chain-expressing splenocytes in {delta}o/o mice. Thus, the ability of {delta}o/o mice to resolve P. chabaudi malaria could not be attributed to the presence of an aberrant {gamma}-chain-expressing T cell population in these mice.

As reported previously (18), very different results were observed when {gamma}{delta} T cells were depleted from B cell-deficient mice, which were then challenged with P. chabaudi. These doubly deficient mice failed to suppress their acute malaria; instead, they developed unremitting parasitemia. Our observations have been confirmed by Seixas and Langhorne (31), who recently reported that {gamma}{delta} T cells contribute to the control of chronic P. chabaudi chabaudi malaria in B cell-deficient mice lacking {gamma}{delta} T cells. B cell-deficient mice, whether anti-µ-treated or gene KO, suppress acute P. chabaudi malaria by CMI (23, 32); the observation that they failed to do so when depleted of {gamma}{delta} T cells suggests that {gamma}{delta} T cells are essential for the expression of CMI against the parasites. An alternate explanation for these results is that the depleting mAb was toxic for or removed an essential cell type in addition to {gamma}{delta} T cells. To test this possibility, both JHo/o and {delta}o/o mice were treated with mAb GL-3, the {gamma}{delta} T cell-depleting Ab, and then challenged with P. chabaudi. Whereas the treated JHo/o mice failed to resolve their acute infections, {delta}o/o mice treated with mAb suppressed parasitemia in the same time frame as control {delta}o/o mice treated with hamster Ig. These results indicate that the mAb treatment regimen functions solely by depleting {gamma}{delta} T cells from the host. The observation that JHo/o, {delta}o/o double KO mice are unable to suppress acute P. chabaudi malaria provides additional support that {gamma}{delta} T cells are crucial for CMI against P. chabaudi. The question remains whether murine {gamma}{delta} T cells are directly cytotoxic for the parasites or may also function by secreting cytokines, which in turn, activate effector mechanisms. As indicated above, we observed that clonal human {gamma}{delta} T cells kill P. falciparum in vitro (17). Human {gamma}{delta} T cells have been reported to be the major source of IFN-{gamma} when peripheral blood cells are stimulated in vitro with falciparum Ags (12), and TNF-{alpha} production appears to be depressed in {delta}o/o mice (33). Although CD4+ T cells and macrophages are present in the spleens of mice deficient in B cells and {gamma}{delta} T cells (data not shown), they fail to constitute a major parasite-killing system on their own.

Previously, we reported (23, 34) that B cell-deficient mice suppress the acute parasitemia of P. chabaudi malaria, but then develop chronic low-grade malaria with parasitemia <=1%. As shown in Fig. 3Go, double KO mice do not suppress the parasitemia of acute malaria. Instead, parasitemia reaches a peak and then remains at constant levels in these mice. In contrast, the parasitemia of acute malaria is suppressed in B cell-deficient mice having {gamma}{delta} T cells. The parasitemia then ascends to a level between 1 and 10% with the passage of time during chronic malaria. Similar findings have been reported by Seixas and Langhorne (31). We do not know how parasitemia is stabilized in these mice with chronic malaria. We know that when B cell-deficient mice with chronic malaria are depleted of {gamma}{delta} or CD4+ T cells with mAb, their parasitemia is markedly exacerbated, indicating that both cell types are crucial for CMI (our unpublished data).

Langhorne et al. (19) reported that {delta}o/o mice produce Abs in response to P. chabaudi infection. Production of both IgG3 and IgG1 isotypes of Ab is greater in {delta}o/o mice compared with controls, with IgM and IgG3 Abs being made in approximately equal amounts. The quantities of IgG2a Abs in the sera of {delta}o/o mice either equaled or exceeded those found in control mice. In collaboration with Dr. James Burns (Meharry Medical College, Nashville, TN), we assessed the Ab response of {delta}o/o mice to P. chabaudi infection by Western blot analysis and observed that these mice produce an array of Ab reactivities similar to those seen in C57BL/6 mice infected with P. chabaudi (data not shown). The availability of double KO mice with mutated JH and {delta}-chain genes provided a model with which to determine whether sera from infection-immunized {delta}o/o mice could passively transfer protection. The results indicate that the onset of patent parasitemia was significantly delayed in the recipient mice. Further, the protective activity of affinity-purified immune sera was associated with the Ig-rich fraction retained on the protein G column vs the Ig-poor pass-through fraction. Together, these findings indicate that {delta}o/o mice produce protective Abs when infected with P. chabaudi.

Earlier, we had reported that the nonlethal murine malarial parasites could be compartmentalized into two major groups, depending upon the outcome of their infections in B cell-deficient mice (34, 35). Whereas acute infections with P. chabaudi and P. vinckei resolved in these hosts, acute P. yoelii infections failed to do so and eventually terminated in death. T cell-deficient mice were unable to resolve infections caused by those parasites (23). We thus concluded that acute infection(s) caused by P. chabaudi and P. vinckei are suppressed by CMI, whereas those caused by P. yoelii are cured by AMI. P. chabaudi produced chronic malaria in B cell-deficient mice; a finding that led us to conclude that the subsequent sterilization of this infection requires B cells and presumably Abs (23, 34, 35). A similar conclusion was recently reached by those who observed that µMTo/o mice that lack B cells did not sterilize their P. chabaudi infections (36). The present findings may not seem surprising on first sight; they are, however, quite different from those reported previously. In the present study, mice suppressed acute P. chabaudi infections by CMI or AMI, depending upon the restrictive immunologic environment. Mice lacking B cells used {gamma}{delta} T cell-dependent CMI to suppress infection, whereas B cell-sufficient mice lacking {gamma}{delta} T cells produced Abs and appeared to suppress their P. chabaudi infections by means of AMI. Our recent findings (37) with different cytokine KO mice indicate that both CMI and AMI against P. chabaudi are dependent on the presence of type 1 but not type 2 cytokines, as proposed previously (38). Although the parasitemia curves in both model infections are too similar to suggest that either CMI or AMI alone suppresses acute P. chabaudi malaria in an immunologically intact mouse, it is possible that one response dominates, while the other develops to a protective level. In falciparum malaria, the {gamma}{delta} T cell response is seen in acutely infected humans (28, 39); individuals, either parasitemic or aparasitemic, living in areas of endemic malaria transmissions have undetectable or low levels of {gamma}{delta} T cells in their blood (4, 5). Similarly, the expansion of the splenic {gamma}{delta} T cell subset observed when mice are infected the first time with P. chabaudi fails to occur when infection-immunized mice are rechallenged (our unpublished observations). It is thus possible that the CD4+ T cell-dependent {gamma}{delta} T cell response to acute infection modulates the expansion of the parasite population until a more efficient protective Ab response occurs. What determines which mechanism(s) are activated in the intact host to suppress infection and whether these are activated in some ordered fashion are presently unknown, but the choice might depend on achieving the greatest functional efficiency with the greatest economy of energy. By deliberately removing components of what appears to be a successful immune response, we force the host to select other immune mechanisms capable of suppressing parasitemia. Similar blocks, or the activation of selected immune responses, may occur in nature due to prior or concurrent infection or intoxication by environmental chemicals.

Finally, the implications of other than expected immune mechanisms being activated during the course of infection may confound the interpretation of data and our understanding of immunological events. A mechanism of immunity identified as functional in one model may be replaced by a different mechanism in another. On the other hand, it is possible that the study of such models may reveal previously unrecognized mechanisms of immunity that might be exploited as targets for immunoprophylaxis or immunotherapy.


    Acknowledgments
 
We thank our colleagues Dr. Dean Manning for editorial assistance and Dr. Dennis Heisey for performing statistical analysis.


    Footnotes
 
1 This work is supported by National Institutes of Health Grants AI12710 (to W.P.W.) and AI40667 (to H.C.H.) Back

2 Address correspondence and reprint requests to Dr. William P. Weidanz, Department of Medical Microbiology and Immunology, 1300 University Avenue, Madison, WI 53706. E-mail address: Back

3 Abbreviations used in this paper: CMI, cell-mediated immunity; AMI, Ab-mediated immunity; KO, knockout; JHo/o, JHD (B cell-deficient mice); {delta}o/o, TCR {delta}-chain KO mice. Back

Received for publication November 2, 1998. Accepted for publication March 31, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. van der Heyde, H. C., W.-L. Chang, W. P. Weidanz. 1997. Specific immunity to malaria and the pathogenesis of disease. S. Kaufman, ed. Host Response to Intracellular Pathogens 195. R. G. Landes Co., Austin.
  2. Chang, W. - L., H. C. van der Heyde, D. G. Maki, M. Malkovsky, W. P. Weidanz. 1992. Subset heterogeneity among {gamma} {delta} T cells found in peripheral blood during Plasmodium falciparum malaria. Immunol. Lett. 32:273.[Medline]
  3. Ho, M., P. Tongtawe, J. Kriangkum, T. Wimonwattrawatee, K. Pattanapanyatsat, L. Bryant, J. Shafig, P. Suntharsamai, S. Looareesuwan, H. K. Webster, J. F. Elliot. 1994. Polyclonal expansion of peripheral {gamma}{delta} T cells in human Plasmodium falciparum malaria. Infect. Immun. 62:855.[Abstract/Free Full Text]
  4. Goodier, M., M. Krause-Jauer, A. Sanni, A. Massougbodjii, B. C. Sadeler, G. H. Mitchell, M. Modell, K. Eichmann, J. Langhorne. 1993. {gamma} {delta} T cells in the peripheral blood of individuals from an area of holoendemic Plasmodium falciparum transmission. Trans. R. Soc. Trop. Med. Hyg. 87:692.[Medline]
  5. Hviid, L., J. A. Kurtzhalg, D. Dodoo, O. Rodrigues, A. Ronn, J. O. Commey, F. K. Nkrumah, T. G. Theander. 1996. The {gamma}/{delta} T cell response to Plasmodium falciparum in a population in which malaria is endemic. Infect. Immun. 64:4359.[Abstract]
  6. Troye-Blomberg, M., W. P. Weidanz, and H. C. van der Heyde. The role of T cells in immunity to malaria and the pathogenesis of disease. In Malaria: Molecular and Clinical Aspects. M. Walgren and P. Perlmann, eds. Harwood Academic Publishers, Reading.
  7. Elloso, M. M., H. C. van der Heyde, A. T. Troutt, D. D. Manning, W. P. Weidanz. 1996. The human {gamma}{delta} T cell subset proliferative response to malarial antigen in vivo depends on CD4+ T cells or cytokines that signal through components of the IL-2R. J. Immunol. 157:2096.[Abstract]
  8. van der Heyde, H. C., D. D. Manning, W. P. Weidanz. 1993. Role of CD4+ T cells in the expansion of the CD4-, CD8- {gamma} {delta} T cell subset in the spleens of mice during blood-stage malaria. J. Immunol. 157:6311.
  9. Jones, S. M., M. R. Goodier, J. Langhorne. 1996. The response to Plasmodium falciparum is dependent on activated CD4+ T cells and the recognition of MHC class I molecules. Immunology 89:405.[Medline]
  10. van der Heyde, H. C., D. D. Manning, D. C. Roopenian, W. P. Weidanz. 1993. Regulation of blood-stage malarial infections in CD8+ cell-deficient ß2-mo/o mice. J. Immunol. 151:3187.[Abstract]
  11. Behr, C., R. Poupot, M. A. Peyrat, Y. Poquet, P. Constant, P. Dubois, M. Bonneville, J. J. Fournie. 1996. Plasmodium falciparum stimuli for human {gamma}{delta} T cells are related to phosphorylated antigens of mycobacteria. Infect. Immun. 64:2892.[Abstract]
  12. Goodier, M. R., C. Lundquist, M. L. Hammarstrom, M. Troye-Blomberg, J. Langhorne. 1995. Cytokine profiles for human V{gamma}9+ T cells stimulated by Plasmodium falciparum. Parasite Immunol. 17:413.[Medline]
  13. Jr Janeway, C. A.. 1998. Frontiers of the immune system. Nature 333:804.
  14. Perera, M. K., R. Carter, R. Goonewardene, K. N. Mendis. 1994. Transient increase in circulating {gamma}{delta} T cells during Plasmodium vivax paroxysms. J. Exp. Med. 179:311.[Abstract/Free Full Text]
  15. Roussilhon, C., M. Agrapart, I. Gugliemi, A. Bensussan, P. Brasseur, J. J. Ballet. 1994. Human TcR{gamma}{delta}+ lymphocyte response on primary exposure to Plasmodium falciparum. Clin. Exp. Immunol. 95:91.[Medline]
  16. Yañez, D. M., J. M. Batchelder, H. C. van der Heyde, D. D. Manning, W. P. Weidanz. 1999. {gamma}{delta} T cells function in the pathogenesis of cerebral malaria in mice infected with Plasmodium berghei ANKA. Infect. Immun. 67:446.[Abstract/Free Full Text]
  17. Elloso, M. M., H. C. van der Heyde, J. A. vande Waa, D. D. Manning, W. P. Weidanz. 1994. Inhibition of Plasmodium falciparum in vitro by human {gamma} {delta} T cells. J. Immunol. 153:1187.[Abstract]
  18. van der Heyde, H. C., M. M. Elloso, W.-L. Chang, M. Kaplan, D. D. Manning, W. P. Weidanz. 1995. {gamma}{delta} T cell function in cell-mediated immunity to acute blood-stage Plasmodium chabaudi adami malaria. J. Immunol. 154:3985.[Abstract]
  19. Langhorne, J., P. Mombaerts, S. Tonegawa. 1995. {alpha}ß and {gamma}{delta} T cells in the immune response to the erythrocytic stages of malaria in mice. Int. Immunol. 7:1005.[Abstract/Free Full Text]
  20. Hohara, S., P. Mombaerts, J. Lafaille, J. Iacomini, A. Nelson, A. R. Clarke, M.-L. Hooper, A. Farr, S. Tonegawa. 1993. T cell receptor mutant mice: independent generation of {alpha}ß T cells and programmed rearrangement of {gamma}{delta} TCR genes. Cell 72:337.[Medline]
  21. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. F. Loring, D. Huszar. 1993. Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5:647.[Abstract/Free Full Text]
  22. Hoffmann, E. J., W. P. Weidanz, C. A. Long. 1984. Susceptibility of C x B recombinant inbred mice to murine plasmodia. Infect. Immun. 43:981.[Abstract/Free Full Text]
  23. Grun, J. L., W. P. Weidanz. 1981. Immunity to Plasmodium chabaudi adami in the B-cell deficient mouse. Nature 290:143.[Medline]
  24. van der Heyde, H. C., M. M. Elloso, D. C. Roopenian, D. D. Manning, W. P. Weidanz. 1993. Expansion of the CD4-, CD8-, {gamma}{delta} T cell subset in the spleens of mice during non-lethal blood-stage malaria. Eur. J. Immunol. 23:1846.[Medline]
  25. Pereira, P., D. Gerber, S. Y. Huang, S. Tonegawa. 1995. Ontogenic development and tissue distribution of V{gamma}-1 expressing {gamma}/{delta} T lymphocytes in normal mice. J. Exp. Med. 182:1921.[Abstract/Free Full Text]
  26. Dent, A. L., L. A. Matis, F. Hooshmand, S. M. Widacki, J. A. Bluestone, S. M. Hedrick. 1990. Self-reactive {gamma}{delta} T cells are eliminated in the thymus. Nature 343:714.[Medline]
  27. Goodman, T., R. LeCarre, L. Lefrancois. 1992. A T-cell receptor {gamma}{delta}-specific monoclonal antibody detects a V{gamma}5 region polymorphism. Immunogenetics 35:65.[Medline]
  28. Stern, M. H., S. Lipkowitz, A. Aurias, C. Griscelli, G. Thomas, I. R. Kirsch. 1989. Inversion of chromosome 7 in ataxia telangiectasia is generated by a rearrangement between T cell receptor, B and T cell receptor {gamma} genes. Blood 74:2076.[Abstract/Free Full Text]
  29. Ho, M., H. K. Webster, P. Tongtawe, K. Pattanapanyasat, W. P. Weidanz. 1990. Increased {gamma}{delta} T cells in acute Plasmodium falciparum malaria. Immunol. Lett. 25:139.[Medline]
  30. Sayles, P. C., L. Rakhmilevich. 1996. Exacerbation of Plasmodium chabaudi malaria in mice by depletion of TCR {alpha}ß+ T cells, but not TCR {gamma}{delta}+ T cells. Immunology 87:29.[Medline]
  31. Seixas, E. M. G., J. Langhorne. 1999. {gamma}{delta} T cells contribute to control of chronic parasitemia in Plasmodium chabaudi infections in mice. J. Immunol. 162:2837.[Abstract/Free Full Text]
  32. van der Heyde, H. C., D. Huszar, C. Woodhouse, D. D. Manning, W. P. Weidanz. 1994. The resolution of acute malaria in a definitive model of B cell deficiency, the JHD mouse. J. Immunol. 152:4557.[Abstract]
  33. Nishimura, H., M. Emoto, K. Hiromatsu, S. Yamamoto, K. Matsuura, H. Gomi, T. Ikeda, S. Hohora, Y. Yoshikai. 1995. The role of {gamma}{delta} T cells in priming macrophages to produce tumor necrosis factor-{alpha}. Eur. J. Immunol. 25:1465.[Medline]
  34. Weidanz, W. P., J. L. Grun. 1981. Antibody-independent mechanisms in the development of acquired immunity to malaria. Adv. Exp. Med. Biol. 162:409.
  35. Grun, J. L., W. P. Weidanz. 1983. Antibody-independent immunity to reinfection malaria in B cell deficient mice. Infect. Immun. 41:1197.[Abstract/Free Full Text]
  36. von der Weid, T., N. Honavar, J. Langhorne. 1996. Gene targeted mice lacking B cells are unable to eliminate a blood stage malaria infection. J. Immunol. 156:2510.[Abstract]
  37. van der Heyde, H. C., B. Pepper, J. Batchelder, W. P. Weidanz. 1997. The time course of selected malarial infections in cytokine-deficient mice. Exp. Parasitol. 85:206.[Medline]
  38. von der Weid, T., J. Langhorne. 1993. The roles of cytokines produced in the immune response to the erythrocytic stages of mouse malarias. Immunobiology 189:397.[Medline]
  39. Roussilhon, C., M. Agrapart, J. J. Ballet, A. Bensussan. 1990. T lymphocytes bearing the gamma delta T cell receptor in patients with acute Plasmodium falciparum malaria. J. Infect. Dis. 162:283.[Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
H. C. van der Heyde, J. M. Batchelder, M. Sandor, and W. P. Weidanz
Splenic {gamma}{delta} T Cells Regulated by CD4+ T Cells Are Required To Control Chronic Plasmodium chabaudi Malaria in the B-Cell-Deficient Mouse.
Infect. Immun., May 1, 2006; 74(5): 2717 - 2725.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Gramaglia, H. Sahlin, J. P. Nolan, J. A. Frangos, M. Intaglietta, and H. C. van der Heyde
Cell- Rather Than Antibody-Mediated Immunity Leads to the Development of Profound Thrombocytopenia during Experimental Plasmodium berghei Malaria
J. Immunol., December 1, 2005; 175(11): 7699 - 7707.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. M. Gillman, J. Batchelder, P. Flaherty, and W. P. Weidanz
Suppression of Plasmodium chabaudi Parasitemia Is Independent of the Action of Reactive Oxygen Intermediates and/or Nitric Oxide
Infect. Immun., November 1, 2004; 72(11): 6359 - 6366.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. M. Burns Jr., P. R. Flaherty, P. Nanavati, and W. P. Weidanz
Protection against Plasmodium chabaudi Malaria Induced by Immunization with Apical Membrane Antigen 1 and Merozoite Surface Protein 1 in the Absence of Gamma Interferon or Interleukin-4
Infect. Immun., October 1, 2004; 72(10): 5605 - 5612.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Rummel, J. Batchelder, P. Flaherty, G. LaFleur, P. Nanavati, J. M. Burns, and W. P. Weidanz
CD28 Costimulation Is Required for the Expression of T-Cell-Dependent Cell-Mediated Immunity against Blood-Stage Plasmodium chabaudi Malaria Parasites
Infect. Immun., October 1, 2004; 72(10): 5768 - 5774.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Rainczuk, T. Scorza, P. M. Smooker, and T. W. Spithill
Induction of Specific T-Cell Responses, Opsonizing Antibodies, and Protection against Plasmodium chabaudi adami Infection in Mice Vaccinated with Genomic Expression Libraries Expressed in Targeted and Secretory DNA Vectors
Infect. Immun., August 1, 2003; 71(8): 4506 - 4515.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. M. Mota, K. N. Brown, V. E. Do Rosario, A. A. Holder, and W. Jarra
Antibody Recognition of Rodent Malaria Parasite Antigens Exposed at the Infected Erythrocyte Surface: Specificity of Immunity Generated in Hyperimmune Mice
Infect. Immun., April 1, 2001; 69(4): 2535 - 2541.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. R. Choudhury, N. A. Sheikh, G. J. Bancroft, D. R. Katz, and J. B. de Souza
Early Nonspecific Immune Responses and Immunity to Blood-Stage Nonlethal Plasmodium yoelii Malaria
Infect. Immun., November 1, 2000; 68(11): 6127 - 6132.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. C. van der Heyde, Y. Gu, Q. Zhang, G. Sun, and M. B. Grisham
Nitric Oxide Is Neither Necessary Nor Sufficient for Resolution of Plasmodium chabaudi Malaria in Mice
J. Immunol., September 15, 2000; 165(6): 3317 - 3323.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Xu, A. N. Hodder, H. Yan, P. E. Crewther, R. F. Anders, and M. F. Good
CD4+ T Cells Acting Independently of Antibody Contribute to Protective Immunity to Plasmodium chabaudi Infection After Apical Membrane Antigen 1 Immunization
J. Immunol., July 1, 2000; 165(1): 389 - 396.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weidanz, W. P.
Right arrow Articles by Heyde, H. C. v. d.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weidanz, W. P.
Right arrow Articles by Heyde, H. C. v. d.
Right arrowPubmed/NCBI databases
*Gene
Medline Plus Health Information
*Malaria


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS