|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Departments of
*
Medical Microbiology and Immunology and
Pathology, University of Wisconsin Medical School, Madison, WI 53706; and
Department of Microbiology and Immunology, Louisiana State University Medical Center, Shreveport, LA 71103
| Abstract |
|---|
|
|
|---|

T cells have a crucial role in cell-mediated immunity (CMI)
against P. chabaudi malaria, but
-chain knockout (KO)
(
o/o) mice and mice depleted of 
T cells with mAb
cure this infection. To address the question of why mice deficient in

T cells resolve P. chabaudi infections, we
immunized
o/o mice by infection with viable blood-stage
parasites. Sera from infection-immunized mice were tested for their
ability to protect JHo/o,
o/o
double KO mice passively against P. chabaudi challenge
infection. The onset of parasitemia was significantly delayed in mice
receiving immune sera, compared with saline or uninfected serum
controls. Immune sera were then fractionated into Ig-rich and
Ig-depleted fractions by HPLC on a protein G column. Double KO mice
were passively immunized with either fraction and challenged with
P. chabaudi. The onset of parasitemia was significantly
delayed in recipients of the Ig-rich fraction compared with recipients
of the Ig-poor fraction of immune sera. We conclude that
o/o mice, which are unable to activate CMI against the
parasite, suppress P. chabaudi infection by a redundant
Ab-mediated process. | Introduction |
|---|
|
|
|---|

T cells are found in the blood and spleens of human
subjects and experimental animals with acute malaria (reviewed in 1). After cure, these cell counts remain elevated for prolonged periods
of time. In human malaria, the expansion of the 
T cell subset is
polyclonal, involving the V
9+,
V
2+, and V
1+ subsets (2, 3). Recent
findings indicate that subjects living in areas of endemic malaria
transmission either lack 
T cells or have subnormal numbers of

T cells in their peripheral blood (4, 5). Whether parasitemic or
not, these individuals, who are infected repeatedly or continuously
with malarial parasites, may have down-regulated their 
T cell
response after developing more efficient mechanisms of immunity to
control the low-grade parasitemia of chronic malaria.
Human 
T cells proliferate in response to falciparum Ags in vitro
(reviewed in 6). Their response is dependent upon CD4+
T cells that supply help through the production of cytokines; the
CD4+ T cell requirement is replaced by cytokines that
stimulate through components of the IL-2R (7). Similarly, the expansion
of the splenic 
T cell subset during murine malaria induced with
Plasmodium chabaudi is also dependent upon
CD4+ T cells; treatment with anti-CD4 mAb prevents the
expansion of the 
T cell subset in infected mice (8). Human

T cells appear to recognize malarial Ags complexed to MHC class
I, but not to MHC class II, molecules (9). In contrast, murine 
T
cells recognize malarial Ags independent of MHC class I molecules (10).
Although the nature of the 
T cell-stimulating Ags remains
uncertain, human 
T cells having the V
9, V
2 phenotype
respond to nonpeptide pyrophosphate Ags similar to those extracted from
mycobacterial species (11). When activated by malarial Ags, 
T
cells produce an array of cytokines, including IFN-
and TNF-
, and
less frequently, IL-4 (12). Thus, it has been suggested that these
cells may function to activate other cells of both the innate and
adaptive immune systems or function as a "first line of defense"
(13).
Accumulating evidence suggests that 
T cells function in
protective immunity against malaria and are responsible for certain of
the pathological changes associated with this disease (14, 15, 16). In
addition to the characteristics described above, we have reported that
cloned human 
T cells are cytotoxic for blood-stage P.
falciparum parasites (17). Moreover, we have observed that murine

T cells are a crucial component of cell-mediated immunity
(CMI)3 against P.
chabaudi malaria (18); mAb depletion of 
T cells from
JHo/o mice prevents the suppression of acute
malaria that normally occurs in JHo/o mice. In
contrast, when
o/o mice deficient in 
T cells, but
otherwise intact, were infected with P. chabaudi, the course
of infection was slightly prolonged and the recrudescent parasitemia
was higher when compared with control
+/+ mice (19).
These authors suggest "... that 
T cells can contribute,
albeit in a minor way, to the clearance of the acute stage parasitemia
of P. chabaudi." Preliminary studies in our laboratory
confirmed this observation, i.e., P. chabaudi infections in
o/o mice were resolved in nearly the same time frame as
control mice. Accordingly, the current study was undertaken to
determine the mechanism by which acute P. chabaudi malaria
is suppressed in mice deficient in 
T cells. The results of
passive immunization experiments with sera obtained from
infection-immunized
o/o mice indicate that these mice
suppress P. chabaudi malaria by mechanisms of Ab-mediated
immunity (AMI). Moreover, they suggest a plasticity of immune responses
that the host may activate to resolve infections caused by a single
species of malarial parasite. Thus, in addition to suppressing the
parasitemia of acute P. chabaudi malaria by CMI, mice can
suppress acute P. chabaudi infection by AMI in approximately
the same time frame.
| Materials and Methods |
|---|
|
|
|---|
Female C57BL/6 mice were purchased from The Jackson Laboratory
(Bar Harbor, ME) and used at 610 wks of age.
o/o and
JHo/o mice homozygous for targeted deletions of
TCR
genes (20) and JH Ig genes (21), originally
purchased from The Jackson Laboratory or kindly provided by Dr. D.
Huszar (GenPharm International, Mountain View, CA), respectively, were
maintained and bred at the University of Wisconsin Animal Care Unit
(Madison, WI). Double knockout (KO) mice lacking both JH
and
-chain genes were produced by crossing single KO mice to produce
F1 progeny heterozygous for both genes and then mating
these back to the JHo/o parent. KO mice
homozygous for the mutated JH gene but heterozygous for the
-chain gene were then crossed to produce double KO
(JHo/o,
o/o) mice lacking B
cells and 
T cells. Mice homozygous for mutated JH
genes and lacking serum Igs were identified by gel diffusion analysis.
Mice homozygous or heterozygous for mutated
-chain genes were
identified by standard PCR-based analysis. Briefly, The Wizard Genomic
DNA purification system (Promega, Fitchburg, WI) was used to extract
DNA from
100 µl of heparinized blood. Subsequently, 10 µl of the
DNA sample was amplified in a 35-cycle PCR reaction with the GeneAmp
PCR System 9600 (Perkin-Elmer, Norwalk, CT) and the following cycling
conditions: 50 s at 94°C, 50 s at 60°C, and 1 min at
72°C. The primers used were as follows: CTATCTGCCCATTGATGAGA (D/Neo),
CCATTTGTCACGTCCTGCACG (pgk -286), CAAATGTTGCTTGTCTGGTG
(TCR CD1), and GTCAGTCGAGTGCACAGTTT (TCR CD2). Amplicons were analyzed
on a 1.8% ethidium bromide-stained agarose gel. Heterozygote mice
yielded a 280-bp band (KO primers, D/Neo and pgk -286) and
a 200-bp band (wild-type primers, TCR CD1 and TCR CD2). Mice homozygous
for the
-chain deficiency produced only the 280-bp KO band. Age- and
sex-matched mice of both sexes were used between 8 and 12 wk of age.
Parasites and infection of mice
P. chabaudi adami 556KA, hereafter referred to as P. chabaudi, was maintained as frozen stabilate material and used as described previously (22). Briefly, malarial infections were initiated in mice that were not treated with Abs or sera by the i.p. injection of 1 x 106 parasitized erythrocytes obtained from a donor mouse. Mice treated i.p. with Abs or sera were injected i.v. with 1 x 105 parasitized erythrocytes. Comparison of parasitemia curves (23) suggests a similarity in the course of infection initiated by the injections of 105 parasites given by the i.v. route vs 106 parasites injected i.p. We have found that the injection of both parasites and serum i.p. can kill the parasites, thereby preventing infection. Therefore, we routinely use 105 parasites i.v. to give a course of infection comparable to 106 parasites i.p.
Parasitemia was assessed by enumerating 200-1000 erythrocytes in
Giemsa-stained films of tail blood. ANOVA was performed with the
Minitab (State College, PA) program and with SAS (Cary, NC) statistical
software. With the exception of the passive immunization experiment
with fractionated immune serum, all experiments were replicated at
least once and gave essentially identical results. Because of the
similarity of the data from passive immunization with immune sera
presented in Fig. 4
and the results of the passive immunization
experiment with fractionated immune sera (Fig. 5
), we did not believe
it necessary to repeat the experiment with fractionated immune sera.
|
|
HPLC-purified anti-TCR
(GL3) was kindly provided by
Dr. C. Czu-prynski (University of Wisconsin, Madison, WI). Purified
hamster IgG was obtained commercially (Accurate Chemicals, Westbury,
NY). Anti-TCR
mAb and hamster Ig were injected (i.p.) into mice
(four mice per treatment group) with 0.5 mg/mouse on days -1, 0, and
1. Mice were infected with 1 x 105 P.
chabaudi-parasitized erythrocytes i.v. on day 0, and parasitemia
was estimated subsequently, as above.
Immune sera
Immune sera were obtained from
o/o mice following
the suppression of parasitemia in mice inoculated i.p. 4 wk previously
with 1 x 106 P. chabaudi-parasitized
erythrocytes. Infection-immunized and uninfected control
o/o mice were bled by cardiac puncture under metofane
anesthesia; the sera were pooled as immune or control sera,
respectively, and stored at -80°C. P. chabaudi immune
sera were fractionated into Ig-rich and Ig-poor components as follows:
immune sera were diluted 1:5 in running buffer (25 mM Tris, 0.1 M NaCl
(pH 8)) and subjected to HPLC on a Poros protein G column (Perceptive
Biosystems, Framingham, MA). The Ig-poor pass-through eluate was
collected and pooled. Bound Ig was subsequently eluted stepwise with
0.3 M MgCl2 in 3% acetic acid. The pH was immediately
adjusted to
7.2, and the Ig-rich fractions were pooled. Both
fractions were dialyzed against PBS (pH 7.2) and concentrated to the
original serum volume by means of ultrafiltration through an
ULTRAFREE-20 filter (Millipore, Bedford, MA) having a 10-kDa cutoff.
Before injection into mice, the fractions were sterilized by passage
through a 0.22-µM filter (Costar, Cambridge, MA).
Passive immunization
The immune sera obtained above were injected in a dose of 0.45
ml i.p. on days -1, 0, and +1, relative to i.v. inoculation with
1 x 105 P. chabaudi-parasitized
erythrocytes. Control mice were injected identically with sterile
saline or control sera from uninfected
o/o mice and
challenged with 1 x 105 P.
chabaudi-parasitized erythrocytes. Passive immunization with
fractionated immune sera was conducted in the same manner, except that
the recipients were injected with 0.5 ml of Ig-rich or Ig-poor
fractions of immune sera.
Flow cytometry
Two-color flow cytometry was performed on single cell
suspensions of spleen cells as described previously (24). The
biotinylated Abs were anti-CD3-
(Boehringer Mannheim,
Indianapolis, IN), anti-TCR-
ß, anti-TCR-
,
anti-V
3, and hamster IgG isotype control (PharMingen, San Diego,
CA). The streptavidin-PE was obtained from Southern Biotechnology
Associates (Birmingham, AL). FITC-conjugated Abs were: anti-CD3,
anti-CD4, anti-CD8 (Boehringer Mannheim), and rat IgG isotype
control (PharMingen). Hybridomas producing anti-V
1.1 (25),
anti-V
2 (26), and anti-V
5 (27) were kindly provided by
Dr. Jeffrey Bluestone (Ben May Institute for Cancer Research,
University of Chicago, Chicago, IL). The hybridomas were grown in
serum-free medium, and the resulting mAbs were conjugated with FITC
using standard procedures. Propidium iodide was added 5 min before data
acquisition to allow exclusion of dead cells. Data acquisition and
analysis were performed on a FACScan (Becton Dickinson, Mountain View,
CA) with the use of Cellquest and Attractors (Becton Dickinson)
programs, respectively.
| Results |
|---|
|
|
|---|
0/0 mice
Previously, we reported that P. chabaudi infections are
prolonged and display higher parasitemia in C57BL/6 mice depleted of

T cells by treatment with anti-TCR
mAb in comparison
with TCR
-intact controls (18). To determine whether the time
course of P. chabaudi infection is prolonged similarly in
gene KO mice lacking 
T cells, we infected
0/0mice and 
T cell-intact C57BL/6 control mice with 1
x 106 parasitized erythrocytes i.p.; the resulting
parasitemia was monitored as described above. The results (Fig. 1
) reveal that the parasitemia in
0/0 mice was significantly greater during the latter
part of the acute infection and the course of infection prolonged by
several days compared with control mice. However, for the most part,
the time course was similar in both groups of mice.
|
o/o mice with anti-TCR
mAb on the course of P. chabaudi malaria
To make a functional check for the depletion of minor
subpopulations of cells, due to the possible toxicity of the mAb, we
treated
o/o and JHo/o mice with
the same regimen of anti-TCR
mAb injected i.p., as described
above. Control
o/o and JHo/o
mice were injected with hamster Ig. All mice were infected i.v. with
1 x 105 P. chabaudi-parasitized
erythrocytes. Parasitemia was subsequently monitored as described
above. Whereas treatment with the depleting mAb had little, if any,
effect on the course of P. chabaudi malaria in
o/o mice (Fig. 2
A), it prevented the
suppression of parasitemia in JHo/o mice (Fig. 2
B), as reported previously (18).
|
o/o mice
To determine whether
o/o mice harbored aberrant
CD3+ T cells (e.g., bearing TCR
ß (28)) that would not
be depleted by treatment with mAb GL-3, nor detected by flow cytometric
analysis of spleen cells stained with mAb GL-3, we analyzed single cell
suspensions from spleens of uninfected and P.
chabaudi-infected
o/o and
-chain-intact control
mice. Spleens were harvested from infected mice 3 wks postinoculation
i.p. with 1 x 106 P. chabaudi, and cells
suspensions were stained with mAb specific for V
1.1, V
2, V
3,
and V
5. Approximately 90% of the CD3+ TCR
splenocytes from infected or uninfected
-chain-intact mice belonged
to the V
1.1+ and V
2+ subsets (data not
shown.) None of the cells were stained with anti-V
3 or
anti-V
5. Moreover, V
-expressing CD3+ cells were
not detected in splenocyte preparations from
o/o mice,
regardless of their infection status.
The course of P. chabaudi parasitemia in
JHo/o,
o/o mice
We previously reported that acute P. chabaudi
infections failed to clear in JHo/o treated
with anti-
-chain mAb (18). To confirm this observation, we
produced JHo/o,
o/o as described
above. JHo/o,
o/o and
JHo/o,
o/+ control mice were
infected i.p. with 1 x 106 P.
chabaudi-parasitized erythrocytes. Whereas control mice deficient
in B cells suppressed their acute infections as described previously,
double KO mice deficient in both B cells and 
T cells were unable
to do so and instead developed progressive infection with relatively
high levels of parasitemia (Fig. 3
).
|
To determine whether the sera of infection-immunized mice was
capable of protecting JHo/o,
o/o
mice against challenge infection with 1 x 105
P. chabaudi-parasitized erythrocytes injected i.v. on
day 0, JHo/o mice were injected i.p. as
described above with 0.45 ml of immune sera obtained from
infection-immunized
o/o mice on days -1, 0, and +1.
Control double KO mice were injected identically with pooled serum from
uninfected
o/o mice or saline and challenged
identically. The results (Fig. 4
)
indicate that the onset of parasitemia in the mice given immune sera
was not detected until the 11th day following the inoculation of
parasites. In contrast, all the control mice injected with nonimmune
sera were parasitemic by day 5 following the initiation of infection. A
comparison of the two groups of mice revealed significant differences
in mean parasitemia (p < 0.05) on days 11, 13,
15, and 17. One of three mice treated with immune sera did not exhibit
parasitemia during the 21-day observation period.
A comparison of the ability of protein G-fractionated immune sera
to protect JHo/o,
o/o mice
against P. chabaudi challenge
Having observed that the sera of infection-immunized mice delayed
the onset of patent parasitemia in JHo/o,
o/o recipients, we fractionated immune sera from
o/o mice by affinity chromatography on a protein G
column into Ig-rich and Ig-poor fractions. Double KO mice were injected
i.p. with 0.5 ml of either fraction on days, -1, 0, and +1, relative
to the time of challenge infection, with 1 x 105 P. chabaudi-parasitized erythrocytes. The onset of
parasitemia in mice injected with Ig-rich fractions was delayed in
comparison to control mice receiving Ig-poor fractions (Fig. 5
). Whereas parasitemia became patent in
one of three test mice on day 9 of infection, parasitemia was patent in
the three control mice on day 5 of infection. A comparison of
parasitemia in test vs control mice indicated significant
(p < 0.05) mean differences between groups on
days 9 and 11 following the initiation of infection.
| Discussion |
|---|
|
|
|---|

T cells in immunity to malaria has been
difficult to ascertain. We originally proposed a protective function
for these cells based on our observation that the number of 
T
cells was elevated in peripheral blood during acute P.
falciparum malaria and remained elevated for at least 4 wk during
convalescence (29). We also observed that cloned human 
T cells
were cytotoxic for P. falciparum in vitro (17). However,
different conclusions regarding the significance of 
T cells were
derived from the analysis of experimental malaria in 
T
cell-deficient mice, including mice depleted of 
T cells with mAb
and
o/o mice (19, 30). The results of these studies
indicate that mice deficient in 
T cells, but otherwise
possessing an intact immune system, display exacerbated levels of
parasitemia but suppress acute P. chabaudi blood-stage
infections in approximately the same time frame as 
T cell-intact
control mice or after a short delay. The results of the present study
in which
o/o mice were infected with P.
chabaudi confirm and extend the findings of the above published
reports in which
o/o mice were infected with the more
virulent chabaudi subspecies of P. chabaudi (19) or utilized
mice depleted of 
T cells by treatment with mAb (30). Whereas we
observed that V
1.1+ and V
2+ subsets
comprised
90% of the splenic 
T cells in intact mice, we
failed (data not shown) to demonstrate the presence of
-chain-expressing splenocytes in
o/o mice. Thus, the
ability of
o/o mice to resolve P. chabaudi
malaria could not be attributed to the presence of an aberrant
-chain-expressing T cell population in these mice.
As reported previously (18), very different results were observed when

T cells were depleted from B cell-deficient mice, which were
then challenged with P. chabaudi. These doubly deficient
mice failed to suppress their acute malaria; instead, they developed
unremitting parasitemia. Our observations have been confirmed by Seixas
and Langhorne (31), who recently reported that 
T cells
contribute to the control of chronic P. chabaudi chabaudi
malaria in B cell-deficient mice lacking 
T cells. B
cell-deficient mice, whether anti-µ-treated or gene KO, suppress
acute P. chabaudi malaria by CMI (23, 32); the observation
that they failed to do so when depleted of 
T cells suggests that

T cells are essential for the expression of CMI against the
parasites. An alternate explanation for these results is that the
depleting mAb was toxic for or removed an essential cell type in
addition to 
T cells. To test this possibility, both
JHo/o and
o/o mice were treated
with mAb GL-3, the 
T cell-depleting Ab, and then challenged with
P. chabaudi. Whereas the treated
JHo/o mice failed to resolve their acute
infections,
o/o mice treated with mAb suppressed
parasitemia in the same time frame as control
o/o mice
treated with hamster Ig. These results indicate that the mAb treatment
regimen functions solely by depleting 
T cells from the host. The
observation that JHo/o,
o/o
double KO mice are unable to suppress acute P. chabaudi
malaria provides additional support that 
T cells are crucial for
CMI against P. chabaudi. The question remains whether murine

T cells are directly cytotoxic for the parasites or may also
function by secreting cytokines, which in turn, activate effector
mechanisms. As indicated above, we observed that clonal human 
T
cells kill P. falciparum in vitro (17). Human 
T cells
have been reported to be the major source of IFN-
when peripheral
blood cells are stimulated in vitro with falciparum Ags
(12), and TNF-
production appears to be depressed in
o/o mice (33). Although CD4+ T cells and
macrophages are present in the spleens of mice deficient in B cells and

T cells (data not shown), they fail to constitute a major
parasite-killing system on their own.
Previously, we reported (23, 34) that B cell-deficient mice suppress
the acute parasitemia of P. chabaudi malaria, but then
develop chronic low-grade malaria with parasitemia
1%. As shown in
Fig. 3
, double KO mice do not suppress the parasitemia of acute
malaria. Instead, parasitemia reaches a peak and then remains at
constant levels in these mice. In contrast, the parasitemia of acute
malaria is suppressed in B cell-deficient mice having 
T cells.
The parasitemia then ascends to a level between 1 and 10% with the
passage of time during chronic malaria. Similar findings have been
reported by Seixas and Langhorne (31). We do not know how parasitemia
is stabilized in these mice with chronic malaria. We know that when B
cell-deficient mice with chronic malaria are depleted of 
or
CD4+ T cells with mAb, their parasitemia is markedly
exacerbated, indicating that both cell types are crucial for CMI (our
unpublished data).
Langhorne et al. (19) reported that
o/o mice produce Abs
in response to P. chabaudi infection. Production of both
IgG3 and IgG1 isotypes of Ab is greater in
o/o mice
compared with controls, with IgM and IgG3 Abs being made in
approximately equal amounts. The quantities of IgG2a Abs in the sera of
o/o mice either equaled or exceeded those found in
control mice. In collaboration with Dr. James Burns (Meharry Medical
College, Nashville, TN), we assessed the Ab response of
o/o mice to P. chabaudi infection by Western
blot analysis and observed that these mice produce an array of Ab
reactivities similar to those seen in C57BL/6 mice infected with
P. chabaudi (data not shown). The availability of double KO
mice with mutated JH and
-chain genes provided a model
with which to determine whether sera from infection-immunized
o/o mice could passively transfer protection. The
results indicate that the onset of patent parasitemia was significantly
delayed in the recipient mice. Further, the protective activity of
affinity-purified immune sera was associated with the Ig-rich fraction
retained on the protein G column vs the Ig-poor pass-through fraction.
Together, these findings indicate that
o/o mice produce
protective Abs when infected with P. chabaudi.
Earlier, we had reported that the nonlethal murine malarial parasites
could be compartmentalized into two major groups, depending upon the
outcome of their infections in B cell-deficient mice (34, 35). Whereas
acute infections with P. chabaudi and P. vinckei
resolved in these hosts, acute P. yoelii infections failed
to do so and eventually terminated in death. T cell-deficient mice were
unable to resolve infections caused by those parasites (23). We thus
concluded that acute infection(s) caused by P. chabaudi and
P. vinckei are suppressed by CMI, whereas those caused by
P. yoelii are cured by AMI. P. chabaudi produced
chronic malaria in B cell-deficient mice; a finding that led us to
conclude that the subsequent sterilization of this infection requires B
cells and presumably Abs (23, 34, 35). A similar conclusion was
recently reached by those who observed that µMTo/o mice
that lack B cells did not sterilize their P. chabaudi
infections (36). The present findings may not seem surprising on first
sight; they are, however, quite different from those reported
previously. In the present study, mice suppressed acute P.
chabaudi infections by CMI or AMI, depending upon the restrictive
immunologic environment. Mice lacking B cells used 
T
cell-dependent CMI to suppress infection, whereas B cell-sufficient
mice lacking 
T cells produced Abs and appeared to suppress their
P. chabaudi infections by means of AMI. Our recent findings
(37) with different cytokine KO mice indicate that both CMI and AMI
against P. chabaudi are dependent on the presence of type 1
but not type 2 cytokines, as proposed previously (38). Although the
parasitemia curves in both model infections are too similar to suggest
that either CMI or AMI alone suppresses acute P. chabaudi
malaria in an immunologically intact mouse, it is possible that one
response dominates, while the other develops to a protective level. In
falciparum malaria, the 
T cell response is seen in acutely
infected humans (28, 39); individuals, either parasitemic or
aparasitemic, living in areas of endemic malaria transmissions have
undetectable or low levels of 
T cells in their blood (4, 5).
Similarly, the expansion of the splenic 
T cell subset observed
when mice are infected the first time with P. chabaudi fails
to occur when infection-immunized mice are rechallenged (our
unpublished observations). It is thus possible that the
CD4+ T cell-dependent 
T cell response to acute
infection modulates the expansion of the parasite population until a
more efficient protective Ab response occurs. What determines which
mechanism(s) are activated in the intact host to suppress infection and
whether these are activated in some ordered fashion are presently
unknown, but the choice might depend on achieving the greatest
functional efficiency with the greatest economy of energy. By
deliberately removing components of what appears to be a successful
immune response, we force the host to select other immune mechanisms
capable of suppressing parasitemia. Similar blocks, or the activation
of selected immune responses, may occur in nature due to prior or
concurrent infection or intoxication by environmental chemicals.
Finally, the implications of other than expected immune mechanisms being activated during the course of infection may confound the interpretation of data and our understanding of immunological events. A mechanism of immunity identified as functional in one model may be replaced by a different mechanism in another. On the other hand, it is possible that the study of such models may reveal previously unrecognized mechanisms of immunity that might be exploited as targets for immunoprophylaxis or immunotherapy.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. William P. Weidanz, Department of Medical Microbiology and Immunology, 1300 University Avenue, Madison, WI 53706. E-mail address: ![]()
3 Abbreviations used in this paper: CMI, cell-mediated immunity; AMI, Ab-mediated immunity; KO, knockout; JHo/o, JHD (B cell-deficient mice);
o/o, TCR
-chain KO mice. ![]()
Received for publication November 2, 1998. Accepted for publication March 31, 1999.
| References |
|---|
|
|
|---|
T cells found in peripheral blood during Plasmodium falciparum malaria. Immunol. Lett. 32:273.[Medline]

T cells in human Plasmodium falciparum malaria. Infect. Immun. 62:855.
T cells in the peripheral blood of individuals from an area of holoendemic Plasmodium falciparum transmission. Trans. R. Soc. Trop. Med. Hyg. 87:692.[Medline]
/
T cell response to Plasmodium falciparum in a population in which malaria is endemic. Infect. Immun. 64:4359.[Abstract]

T cell subset proliferative response to malarial antigen in vivo depends on CD4+ T cells or cytokines that signal through components of the IL-2R. J. Immunol. 157:2096.[Abstract]
T cell subset in the spleens of mice during blood-stage malaria. J. Immunol. 157:6311.

T cells are related to phosphorylated antigens of mycobacteria. Infect. Immun. 64:2892.[Abstract]
9+ T cells stimulated by Plasmodium falciparum. Parasite Immunol. 17:413.[Medline]

T cells during Plasmodium vivax paroxysms. J. Exp. Med. 179:311.
+ lymphocyte response on primary exposure to Plasmodium falciparum. Clin. Exp. Immunol. 95:91.[Medline]

T cells function in the pathogenesis of cerebral malaria in mice infected with Plasmodium berghei ANKA. Infect. Immun. 67:446.
T cells. J. Immunol. 153:1187.[Abstract]

T cell function in cell-mediated immunity to acute blood-stage Plasmodium chabaudi adami malaria. J. Immunol. 154:3985.[Abstract]
ß and 
T cells in the immune response to the erythrocytic stages of malaria in mice. Int. Immunol. 7:1005.
ß T cells and programmed rearrangement of 
TCR genes. Cell 72:337.[Medline]

T cell subset in the spleens of mice during non-lethal blood-stage malaria. Eur. J. Immunol. 23:1846.[Medline]
-1 expressing
/
T lymphocytes in normal mice. J. Exp. Med. 182:1921.
T cells are eliminated in the thymus. Nature 343:714.[Medline]

-specific monoclonal antibody detects a V
5 region polymorphism. Immunogenetics 35:65.[Medline]
genes. Blood 74:2076.
T cells in acute Plasmodium falciparum malaria. Immunol. Lett. 25:139.[Medline]
ß+ T cells, but not TCR 
+ T cells. Immunology 87:29.[Medline]

T cells contribute to control of chronic parasitemia in Plasmodium chabaudi infections in mice. J. Immunol. 162:2837.
T cells in priming macrophages to produce tumor necrosis factor-
. Eur. J. Immunol. 25:1465.[Medline]
This article has been cited by other articles:
![]() |
H. C. van der Heyde, J. M. Batchelder, M. Sandor, and W. P. Weidanz Splenic {gamma}{delta} T Cells Regulated by CD4+ T Cells Are Required To Control Chronic Plasmodium chabaudi Malaria in the B-Cell-Deficient Mouse. Infect. Immun., May 1, 2006; 74(5): 2717 - 2725. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gramaglia, H. Sahlin, J. P. Nolan, J. A. Frangos, M. Intaglietta, and H. C. van der Heyde Cell- Rather Than Antibody-Mediated Immunity Leads to the Development of Profound Thrombocytopenia during Experimental Plasmodium berghei Malaria J. Immunol., December 1, 2005; 175(11): 7699 - 7707. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Gillman, J. Batchelder, P. Flaherty, and W. P. Weidanz Suppression of Plasmodium chabaudi Parasitemia Is Independent of the Action of Reactive Oxygen Intermediates and/or Nitric Oxide Infect. Immun., November 1, 2004; 72(11): 6359 - 6366. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Burns Jr., P. R. Flaherty, P. Nanavati, and W. P. Weidanz Protection against Plasmodium chabaudi Malaria Induced by Immunization with Apical Membrane Antigen 1 and Merozoite Surface Protein 1 in the Absence of Gamma Interferon or Interleukin-4 Infect. Immun., October 1, 2004; 72(10): 5605 - 5612. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rummel, J. Batchelder, P. Flaherty, G. LaFleur, P. Nanavati, J. M. Burns, and W. P. Weidanz CD28 Costimulation Is Required for the Expression of T-Cell-Dependent Cell-Mediated Immunity against Blood-Stage Plasmodium chabaudi Malaria Parasites Infect. Immun., October 1, 2004; 72(10): 5768 - 5774. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rainczuk, T. Scorza, P. M. Smooker, and T. W. Spithill Induction of Specific T-Cell Responses, Opsonizing Antibodies, and Protection against Plasmodium chabaudi adami Infection in Mice Vaccinated with Genomic Expression Libraries Expressed in Targeted and Secretory DNA Vectors Infect. Immun., August 1, 2003; 71(8): 4506 - 4515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Mota, K. N. Brown, V. E. Do Rosario, A. A. Holder, and W. Jarra Antibody Recognition of Rodent Malaria Parasite Antigens Exposed at the Infected Erythrocyte Surface: Specificity of Immunity Generated in Hyperimmune Mice Infect. Immun., April 1, 2001; 69(4): 2535 - 2541. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Choudhury, N. A. Sheikh, G. J. Bancroft, D. R. Katz, and J. B. de Souza Early Nonspecific Immune Responses and Immunity to Blood-Stage Nonlethal Plasmodium yoelii Malaria Infect. Immun., November 1, 2000; 68(11): 6127 - 6132. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. van der Heyde, Y. Gu, Q. Zhang, G. Sun, and M. B. Grisham Nitric Oxide Is Neither Necessary Nor Sufficient for Resolution of Plasmodium chabaudi Malaria in Mice J. Immunol., September 15, 2000; 165(6): 3317 - 3323. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, A. N. Hodder, H. Yan, P. E. Crewther, R. F. Anders, and M. F. Good CD4+ T Cells Acting Independently of Antibody Contribute to Protective Immunity to Plasmodium chabaudi Infection After Apical Membrane Antigen 1 Immunization J. Immunol., July 1, 2000; 165(1): 389 - 396. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |