The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bliss, S. K.
Right arrow Articles by Denkers, E. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bliss, S. K.
Right arrow Articles by Denkers, E. Y.
The Journal of Immunology, 1999, 162: 7369-7375.
Copyright © 1999 by The American Association of Immunologists

Human Polymorphonuclear Leukocytes Produce IL-12, TNF-{alpha}, and the Chemokines Macrophage-Inflammatory Protein-1{alpha} and -1ß in Response to Toxoplasma gondii Antigens1

Susan K. Bliss2, Anthony J. Marshall2, Yin Zhang and Eric Y. Denkers3

Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The induction of a type 1 inflammatory cytokine response is a key event in the initiation of immunity to Toxoplasma gondii. Because polymorphonuclear leukocytes rapidly respond to infection by exiting the peripheral blood and accumulating at a site of infection, we sought to determine whether these cells produce cytokines in response to T. gondii. When human peripheral blood neutrophils were stimulated with parasite Ag, they produced both IL-12 (p70) and TNF-{alpha}. Similarly, up-regulated expression of macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}) and MIP-1ß gene transcripts was induced. Kinetic analysis of IL-12 and TNF-{alpha} production revealed distinct patterns following stimulation by T. gondii or LPS. Exogenous TNF-{alpha} alone also provided a potent stimulus of MIP-1{alpha} and MIP-1ß expression, and when neutralizing anti-TNF-{alpha} antiserum was included in cultures of parasite-stimulated cells, expression of these CC-family chemokines was partially blocked. These results establish that T. gondii possesses the ability of driving neutrophil proinflammatory cytokine production, and they suggest that parasite-induced MIP-1{alpha} and MIP-1ß partly results from autocrine stimulation through TNF-{alpha}.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Polymorphonuclear leukocytes (PMN)4 are well known as one of the earliest cell types arriving at a site of infection. Once there, neutrophils exert anti-microbial activity through their capacity to phagocytose and inactivate pathogens, using mechanisms such as NADPH oxidase-catalyzed production of superoxide and release of neutrophil elastase from azurophil granules (1, 2). During infection, human bone marrow PMN production may increase from 1011 to 1012 per day, although the half-life of these cells in vivo has generally been believed to be on the order of 6–8 h (3). While neutrophils normally undergo rapid apoptosis during culture, several inflammatory cytokines (e.g., IL-1ß, TNF-{alpha}, IFN-{gamma}, IL-6, G-CSF, GM-CSF) prolong their lifespan, suggesting that PMN may be longer-lived, particularly during infectious settings, than previously believed (4, 5).

In addition to microbicidal activity, PMN are capable of producing several cytokines. Indeed, their ability to rapidly migrate to a focus of infection, as well as their large numbers in peripheral blood, suggest that neutrophils may play an important role as a cytokine source during early infection. In recent years, PMN have been shown to produce both TNF-{alpha} and IL-12 after stimulation with microbial products such as bacterial LPS, as well as the yeast pathogen Candida albicans (6, 7, 8, 9, 10, 11, 12). Neutrophils are also capable of secreting chemokines of both the CC and CXC families, including the neutrophil chemotactic factor IL-8 and the macrophage chemotactic factors macrophage-inflammatory protein-1{alpha} (MIP-1{alpha}) and MIP-1ß (13, 14, 15). Together, these findings suggest that PMN may be important both in early cellular recruitment to a focus of infection and in producing cytokines that influence the activity of the incoming immune cells.

The control of infection with the opportunistic protozoan parasite Toxoplasma gondii is dependent upon strong cell-mediated immunity (16, 17, 18). This response is initiated by early IL-12 production from cell types such as macrophages and dendritic cells (19, 20), which can promote macrophage microbicidal function through IFN-{gamma} induction, as well as driving differentiation of Th1 type CD4+ and CD8+ effector T lymphocytes (21). Recently, granulocytes have also been found to contribute to resistance during acute infection. Thus, depletion of PMN with mAb specific for the granulocyte marker GR-1 impairs the ability of mice to survive acute infection with the low-virulence strain ME49 introduced either by i.p. injection or oral administration (22, 23).

The mechanism by which neutrophils contribute to resistance to the parasite is not presently known, but recent work from our laboratory may shed light on this issue. We have found an essential role for PMN in a model of lethal inflammatory cytokine shock induced by the administration of low doses of tachyzoite lysate to D-galactosamine-sensitized mice (24), a result suggesting that neutrophils are involved in Toxoplasma-induced proinflammatory cytokine production in vivo. Nevertheless, this finding does not establish whether PMN themselves release cytokines such as TNF-{alpha} and IL-12 in response to T. gondii, or whether neutrophils promote production of these cytokines by another cell type, for example by recruiting and activating monocytes through the release of chemotactic factors (14).

To address this issue, we used human peripheral blood as a source from which to obtain large numbers of purified PMN. As we show in this paper, PMN rapidly release both IL-12 and TNF-{alpha} when cultured in vitro with T. gondii Ag. Among several chemokines examined, we found strong up-regulation of transcripts for MIP-1{alpha} and MIP-1ß after Ag stimulation. The latter CC chemokines were similarly up-regulated by the addition of exogenous TNF-{alpha} in the absence of further stimulation. These results show that neutrophils are involved in early cytokine responses to the parasite and suggest that they may play a role in establishing the cytokine network initiated by Toxoplasma infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Parasite extracts

RH strain T. gondii tachyzoites were maintained by biweekly passage on human foreskin fibroblasts in DMEM (Life Technologies, Grand Island, NY), 1% FCS (HyClone, Logan, UT), 100 U/ml of penicillin, and 0.1 mg/ml of streptomycin (Sigma, St. Louis, MO). Soluble tachyzoite Ag (STAg) was prepared as previously described (24). Briefly, tachyzoites were sonicated in the presence of protease inhibitors (0.2 mM PMSF, 0.2 mM aprotinin, 1 mM leupeptin, and 1 mM EDTA), dialyzed into PBS, and filter sterilized through a 0.2-µm membrane (Corning Costar, Cambridge, MA), assayed for protein concentration, and stored at -70°C. Parasite extracts were found to be free of endotoxin as measured by the Limulus amebocyte assay. Parasite cultures were free of Mycoplasma contamination as determined by diagnostic RT-PCR and ELISA (kits from Strategene, La Jolla, CA and Boehringer-Mannheim, Indianapolis, IN, respectively), as well as by microbiological assay and fluorescent DNA staining (performed by the Mycoplasma Testing Laboratory, Coriell Institute for Medical Research, Camden, NJ)

Toxoplasma ELISA

Peripheral blood from healthy human donors was obtained by venipuncture and collected in vacutainer tubes (Becton Dickinson, Franklin Lakes, NJ) containing EDTA. Whole blood was centrifuged (13,000 x g, 5 min), plasma was transferred to a new tube, and an ELISA was performed to test for T. gondii-seropositive individuals as described below.

First, 96-well ELISA plates (Corning Costar) were coated with STAg diluted in PBS (25 µg/ml), and the plates were incubated at 37°C for 2 h. After washing in PBS with 0.05% Tween 20, the plates were blocked by overnight incubation at 4°C in 1% BSA in PBS. Plates were subsequently washed and a serial dilution of each plasma sample was added to wells and incubated at 37°C for 2 h. After washing the plates, a HRP-conjugated goat anti-human Ab (Jackson Immunoresearch Laboratories, West Grove, PA) was added to sample wells and the plates were incubated a further 90 min at 37°C. After washing, the plates were developed with 2.2-azino-di(3-ethyl-benzthiazoline sulfonate) (ABTS; Kirkegard and Perry Laboratories, Gaithersburg, MD), absorbance (405 nm) was measured on a Microplate BIO Kinetics Reader (Bio-Tek Instruments, Winooski, VT), and the results were compared with a positive serum pool.

Isolation of human neutrophils

Whole blood was obtained from T. gondii-seronegative individuals by venipuncture and was placed on ice. Neutrophils were isolated as previously described (25) with the following modifications. Before blood collection, an isotonic solution of Percoll (Pharmacia Biotech, Piscataway, NJ) was prepared by mixing nine parts Percoll with one part 10x HBSS (Life Technologies). Next, 69% and 75% Percoll solutions were prepared from isotonic Percoll diluted with 1x HBSS. Then 1.5 ml of 75% Percoll was poured into a 15-ml round-bottom tube and overlaid with 3 ml of the 69% solution. Whole blood was diluted 2-fold with complete RPMI 1640 media (10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 30 mM HEPES, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 5 x 10-5 M 2-ME), and 4 ml was overlaid on the Percoll gradients. Tubes containing Percoll gradients and blood were centrifuged (500 x g) for 30 min at room temperature. The band corresponding to the neutrophil fraction was collected, washed twice with complete RPMI 1640 media, and cells were counted. To determine the purity of isolated cells, differential cell counts were performed on Diff-Quik (American Scientific Products, McGraw Park, IL)-stained cytocentrifuge slides, counting a minimum of 500 cells per slide.

Neutrophil stimulation

PMN were plated in triplicate for each experimental group in a 96-well tissue culture plate (Corning Costar) at 1 x 106 cells/well in complete RPMI 1640 media with either media alone, LPS (1 µg/well), or STAg (50 and 100 µg/well). Tissue culture plates were incubated at 37°C with 5% CO2. Culture supernatants were removed at various times after culture initiation and stored (-70°C) until assayed for the presence of cytokines.

RNA isolation

At the time of supernatant harvest, cells were collected from triplicate wells and pooled in 200 µl of RNA STAT 60 (Tel-Test, Friendswood, TX), then placed in 2 ml Eppendorf tubes. To obtain sufficient RNA for analysis, triplicate samples were pooled. Cellular RNA was subsequently isolated by adding 40 µl of chloroform (Sigma) per 1 x 106 cells, vortexing the tube, and centrifuging at 13,000 x g at 4°C for 15 min. The resulting aqueous phase was transferred to a new tube containing an equal volume of isopropanol (Sigma) and incubated at -20°C overnight. To precipitate RNA, a one-tenth volume of 3 M sodium acetate was added to the RNA-isopropanol solution, and the mixture was vortexed then centrifuged at 13,000 x g at 4°C for 15 min. The resulting pellet was washed in 75% ethanol, resuspended in H2O, and the concentration was determined using a spectrophotometer equipped with a UV lamp (Beckman DU-50, Beckman Instruments, Palo Alto, CA).

RT-PCR and Southern blotting

RNA (6 µg) was reverse transcribed using oligo(dT) primers (Promega, Madison, WI). After heating samples to 72°C and chilling on ice to allow hybridization, a master mix (5x reverse transcriptase buffer, 0.1 M DTT, 2.5 mM dNTPs, 40 U/ml RNasin, and 200 U/ml superscript reverse transcriptase) was added, and the samples were incubated at 45°C for 60 min followed by 10 min at 94°C. The resulting cDNA was either used immediately or stored at -20°C until PCR-mediated gene amplification.

The PCR was performed using a master mix containing dNTPs (2.5 mM), PCR buffer containing 1.5 mM MgCl2 (Promega), primers (0.5 µM; 1:1 antisense: sense), and Taq polymerase (5 U/µl; Life Technologies). The nucleotide sequences employed as sense and antisense primers were: ß-actin, TGACGGGGGTCACCCACACTGTGCCCATCTA, CTAGAAGCATTGCGGTGGACGATGGAGGG; MIP-1{alpha}, CGCCTGCTGCTTCAGCTACCTCCCGGCA, TGGACCCCTCAGGCACTCAGCTCCAGGTCG; MIP-1ß, ACCCTCCCACCGCCTGCTGCTTTTCTTCAC, GTTGCAGGTCATACACGTACTCCTGGACCC. The program for PCR consisted of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min, with a final extension of 7 min at 72°C. The cDNA was amplified 33 cycles (ß-actin), 31 cycles (MIP-1{alpha}), and 29 cycles (MIP-1ß).

The RT-PCR products were resolved on 2% agarose gels, and bands were visualized by staining with ethidium bromide. A 100-bp DNA ladder (Life Technologies) was simultaneously run on the gels to confirm that PCR products possessed the predicted size. Photographs of gels were scanned and analyzed with the use of Adobe Photoshop software (Adobe Systems, Mountain View, CA). Integrated band size and pixel density was evaluated and expressed as a ratio of chemokine band intensity divided by ß-actin band intensity.

Southern blotting was performed as described in detail elsewhere (26). Briefly, amplified DNA was blotted from agarose gels onto a Hybond-N+ membrane (Amersham International, Buckinghamshire, U.K.) and subsequently probed with internal cytokine-specific oligonucleotides. An enhanced chemiluminescence protocol was employed to detect binding (Amersham). The following probes were employed: MIP-1{alpha}, GACACCGGGCTTGGAGCACTGGCTGCTCGT; MIP-1ß, AGAGGCTGCTGGTCTCATAGTAATCTACCA; ß-actin, CATGAGGTAGTCAGTCAGGTCCCGGCCAGC.

Cytokine measurement

Levels of TNF-{alpha} and IL-12 (p70) in culture supernatants were measured using commercially available ELISA kits according to the manufacturer’s instructions (Genzyme, Cambridge, MA).

Recombinant cytokine and anti-cytokine treatment

The neutrophils were stimulated in the presence and absence of STAg with recombinant human TNF-{alpha} (100 ng/ml) and IFN-{gamma} (20 U/ml) (PharMingen, San Diego, CA). The induction of MIP-1{alpha} and MIP-1ß mRNA transcript synthesis was detected by RT-PCR 3 h after culture initiation. For blocking TNF-{alpha}, a neutralizing rabbit antiserum (Genzyme) was employed and compared with normal rabbit serum. Both reagents were used at a 1/500 dilution, a 100-fold excess in the amount required to neutralize >95% of the TNF-{alpha} activity.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Purification of PMN from T. gondii-seronegative donors

We wished to initially focus our study on donors possessing low T. gondii Ab titers who presumably had not been exposed previously to the parasite. T. gondii-specific serum Ab levels were measured by ELISA and 4 donors with titers >1/50 were selected for purification of PMN from peripheral blood. As shown in Table IGo, the populations obtained ranged from 94–99% PMN. The vast majority of these cells were neutrophils, although for the case of donor 1, a relatively large proportion obtained were eosinophils on several separate occasions. Because neutrophils may undergo apoptotic death when cultured for 24 h and beyond (4, 5), we also measured cell viability after 12 h, the time at which our experiments were terminated. As shown in Table IGo, there was no significant cell death during this period.


View this table:
[in this window]
[in a new window]
 
Table I. Donor cell populations after neutrophil enrichment of peripheral blood leukocytes1

 
T. gondii stimulates neutrophil TNF-{alpha} and IL-12 production

Previous studies have shown that human neutrophils are capable of responding to bacterial LPS by producing TNF-{alpha} and IL-12 (8, 9), but their ability to produce these cytokines in response to protozoan stimulation is unexplored. Accordingly, PMN cultures were initiated from the seronegative donors listed in Table IGo, and supernatants were assayed for the presence of IL-12 (p70) and TNF-{alpha} after stimulation with media or STAg.

As shown in Fig. 1Go, parasite Ag induced IL-12 (p70) release from each of the donors. A low level of IL-12 production was found in the absence of parasite stimulation, possibly a result of nonspecific activation during the course of purification. Similar results were obtained in an RT-PCR analysis (data not shown), suggesting that the background IL-12 shown in Fig. 1Go is not an artifact of the ELISA. We also found that STAg stimulated production of TNF-{alpha} from the PMN. Although we found a degree of variability in the amount of cytokine produced from donor to donor, the production of TNF-{alpha} in the presence of STAg was consistently much greater than in media alone.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 1. Human PMN secrete both IL-12 (p70) and TNF-{alpha} during in vitro stimulation with T. gondii. Responder cells were obtained from healthy donors with no previous exposure to T. gondii. The PMN were cultured with STAg (ST) or media alone (Med) for 2 h, then supernatants were collected for cytokine measurement. Levels of IL-12 (p70) and TNF-{alpha} were measured by cytokine-specific ELISA (see Materials and Methods for details). The results represent mean ± SD values for triplicate wells. In this figure, donors 1–4 correspond to those listed in Table IGo.

 
Fig. 2Go shows the kinetics of cytokine production using PMN from one individual (donor 4). The release of IL-12 (p70) into culture supernatants in response to STAg occurred extremely rapidly, reaching maximal levels within 2 h. We do not at present know if this response is the result of preformed cytokine release, for example by granule exocytosis, or whether it represents the rapid up-regulation of IL-12 gene transcripts. However, similar studies using mouse neutrophils suggest that much of the IL-12 produced in response to STAg results from de novo protein synthesis.5 Interestingly, the kinetics of LPS-driven cytokine production differed from that of STAg (Fig. 2Go). At 2 h, STAg-induced production of TNF-{alpha} was higher relative to LPS. Whereas STAg-induced TNF-{alpha} reached maximal levels at 6 h and subsequently declined, LPS-stimulated TNF-{alpha} production rapidly rose through this period. A similar kinetic profile was found for LPS-driven IL-12 (p70) production, but in contrast to TNF-{alpha}, LPS was a less potent stimulus for IL-12 production than was STAg. These and previously published data (24, 27) indicate that the underlying biochemical pathways triggered by LPS and T. gondii, which result in the induction of IL-12 and TNF-{alpha}, are distinct.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 2. Kinetics of IL-12 and TNF-{alpha} production by PMN in response to T. gondii or LPS. Neutrophils were purified and stimulated with STAg (ST), LPS, or media (Med), and supernatants were harvested for cytokine measurement at the indicated time points after culture initiation. This figure shows the results from a single individual, but similar results were obtained from three additional donors.

 
T. gondii induces up-regulation of MIP-1{alpha} and MIP-1ß in PMN

Because PMN, more than other cell types, are able to rapidly accumulate at a site of infection, we asked whether parasite-stimulated PMN produced chemotactic factors potentially involved in further immune cell recruitment. Both MIP-1{alpha} and MIP-1ß, members of the CC chemokine family, are chemotactic factors for monocytes and dendritic, NK, and T cells (28, 29, 30, 31). As shown in Fig. 3Go, RT-PCR analysis demonstrates rapid up-regulation of transcripts for both MIP-1{alpha} and MIP-1ß, and up-regulation of these transcripts was sustained for at least 12 h following culture initiation.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 3. T. gondii up-regulates neutrophil MIP-1{alpha} and MIP-1ß gene expression. PMN were purified and incubated with STAg (ST) or media (M). At the times indicated, cells were collected, RNA was isolated, and RT-PCR amplification was conducted as described in Materials and Methods. Amplified PCR products were separated on an agarose gel, stained with ethidium bromide, and photographed (A). A 100-bp ladder (mw, molecular weight) demonstrates that the PCR products possess the predicted size (MIP-1{alpha}, 195 bp; MIP-1ß, 190 bp; ß-actin, 661 bp). B, PCR products were amplified and subjected to Southern blot analysis employing internal chemokine-specific probes. The cell population used in this experiment was comprised of 94.7% neutrophils, 4.6% eosinophils, and 0.7% lymphocytes. Monocytes were not detected. This figure shows results using PMN from one representative donor but similar data were obtained over the course of three additional experiments using other donors.

 
The cytokines TNF-{alpha} and IFN-{gamma} have been reported to exert effects on cytokine production by PMN. Thus, TNF-{alpha} possesses the ability to induce MIP-1{alpha} and IL-8, while IFN-{gamma} appears capable of both inhibitory and stimulatory activity dependent upon the time of analysis (32, 33, 34). Accordingly, PMN were cultured with STAg or media in the presence of recombinant TNF-{alpha} or IFN-{gamma}, and 3 h later cells were harvested and the induction of gene transcripts was examined. Fig. 4Go, A and B show that exogenous TNF-{alpha} alone provided a potent stimulus for increased expression of MIP-1{alpha} and MIP-1ß gene transcripts. The inclusion of STAg with TNF-{alpha} did not appear to further augment the expression of the chemokines. We found a different pattern when examining the effect of exogenous IFN-{gamma}. In this case, the cytokine alone did not induce up-regulation of MIP-1{alpha} or MIP-1ß transcripts. STAg-driven expression of the chemokines appeared slightly augmented when exogenous IFN-{gamma} was included in the cultures (Fig. 4Go, A and B).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of exogenous IFN-{gamma} and TNF-{alpha} on MIP-1{alpha} and MIP-1ß expression. Human neutrophils were isolated and stimulated with STAg (ST) or media (M) in the presence or absence of recombinant human IFN-{gamma} (20 U/ml) or TNF-{alpha} (100 ng/ml). Cells were harvested after 3 h, and RT-PCR analysis was conducted as described in Materials and Methods. A, The amplification products separated by agarose gel electrophoresis followed by ethidium bromide staining are shown. B, Transcript levels relative to ß-actin, determined by scanning densitometric analysis, are shown. In this experiment, the cell population consisted of 95.3% neutrophils, 2.6% monocytes, and 2.1% lymphocytes. This experiment was repeated twice with essentially identical results.

 
Because TNF-{alpha} alone provided a strong stimulus for MIP-1, we wished to determine whether the expression of this chemokine was driven by TNF-{alpha}, itself induced early during STAg stimulation. As shown in Fig. 5Go, when a neutralizing anti-TNF antiserum was included in the cultures, up-regulation of MIP-1 gene transcription in response to STAg was partially blocked (MIP-1{alpha}, 62% inhibition; MIP-1ß, 78% inhibition, as estimated from densitometric analysis of scanned gel images). In contrast, normal control serum had no inhibitory effect on STAg-induced chemokine production. We conclude that the T. gondii-induced chemokine response is, in part, driven through TNF-{alpha} production. Nevertheless, we cannot exclude the possibility that the parasite directly stimulates neutrophil production of MIP-1{alpha} and MIP-1ß.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. Neutralizing anti-TNF-{alpha} antiserum partially blocks T. gondii-induced neutrophil chemokine up-regulation. Human PMN were isolated and stimulated with media (lane 1), STAg (lane 2), STAg in the presence of anti-TNF-{alpha} antiserum (lane 3), and STAg with control serum (lane 4). Three hours after culture initiation, cells were harvested and transcript levels were determined by RT-PCR-assisted amplification followed by agarose gel separation and visualization with ethidium bromide (A). Transcript levels were estimated using scanning densitometry and expressed relative to ß-actin levels (B). The cells employed in this study were comprised of 90% neutrophils, 9% eosinophils, and 1% lymphocytes. This experiment was repeated twice with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of this study demonstrate that human PMN respond to T. gondii stimulation by producing several cytokines, including TNF-{alpha} and IL-12. The production of the latter cytokine occurred within 2 h in vitro, and while it is possible that this rapid appearance results from exocytosis of preformed cytokine, RT-PCR analysis indicates that at least some of the IL-12 produced is the result of de novo gene transcription (data not shown). Interestingly, the kinetics of TNF-{alpha} and IL-12 production induced by the parasite appear distinct from the response elicited by LPS. Thus, T. gondii was a more potent stimulus for neutrophil IL-12 than was LPS, and conversely, LPS was a much stronger stimulus for TNF-{alpha} production than was tachyzoite lysate. These disparate responses suggest that LPS and STAg induced PMN triggering follow distinct molecular pathways, a conclusion that is supported by findings in mouse systems indicating that LPS nonresponsive strains remain responsive to T. gondii-triggered type 1 inflammatory cytokine production (24, 27).

The ability of neutrophils to serve as a cytokine source, in combination with their large numbers in peripheral blood and the ability to rapidly migrate to a focus of infection, suggest that PMN may be a key cell type in cytokine-initiated immune system triggering. The capacity of neutrophils to serve such an immunoregulatory role is underscored by findings in C. albicans-infected mice (11). In the latter experimental system, neutrophils produce IL-12 or IL-10 depending upon whether the animals are undergoing self-healing (Th1-associated) or progressive (Th2-associated) disease, respectively (12, 35). The depletion of granulocytes in Candida-infected mice undergoing infection with a normally self-healing yeast strain leads to the development of a Th2 response and progressive disease. Thus, by virtue of their ability to produce two key immunomodulatory cytokines, neutrophils exert a major impact in determining whether or not the host survives C. albicans infection.

We do not yet know if PMN play such a critical immunoregulatory role during early T. gondii infection. The ability of the host to survive T. gondii infection is critically dependent upon IL-12 and subsequent Th1 development (16, 27, 36, 37, 38, 39). Studies in mice indicate that neutrophil depletion increases the susceptibility to acute toxoplasmosis (22, 23), and while the reasons for this are unclear, it is plausible that early neutrophil IL-12 production contributes to the protective activity of these cells. Nevertheless, monocytes/macrophages and dendritic cells are also capable of T. gondii-induced IL-12 synthesis, and it is probable that all three cell types are active in IL-12 production during the first contact of Toxoplasma with the innate immune system.

The stimulation of human neutrophils with T. gondii also resulted in the rapid induction of MIP-1 mRNA, and the up-regulation of transcripts was sustained for at least 12 h. The ability of neutrophils to produce MIP-1 proteins has been previously reported (13, 14, 33), although chemokine expression induced by Toxoplasma itself is relatively little studied. In this regard, the mouse CXC chemokines MuMig and Crg-2 are induced in dependence upon IFN-{gamma} during T. gondii infection, although the functional consequences resulting from the expression of these T cell chemoattractants are not known (40).

The MIP-1 cytokines themselves are related CC-family chemokines that display extensively overlapping biological activity (41). Both MIP-1{alpha} and MIP-1ß display chemotactic activity for macrophages, NK cells, and dendritic cells (28, 30, 42, 43). The synthesis of MIP-1{alpha} and MIP-1ß is associated with type 1 immune responses (44). Indeed, it was recently reported that MIP-1{alpha} and MIP-1ß serve as chemoattractants for Th1, but not Th2, cells (45, 46). Therefore, the strong type 1 cytokine response induced by T. gondii would predict the up-regulation of parasite-induced MIP-1 gene transcription, which we report here. We are presently employing mouse model systems to more closely examine the role of these chemokines during infection.

The role of IFN-{gamma} in neutrophil chemokine responses is complex (32, 47). Thus, the cytokine appears to display an inhibitory activity on neutrophil MIP-1 expression, as measured by gene transcript induction and protein expression. However, during extended incubation, IFN-{gamma} has the opposite effect, promoting neutrophil MIP-1 expression. IFN-{gamma} also appears to be a potent inhibitor of MIP-1{alpha} and MIP-1ß expression by thioglycollate-elicited macrophages stimulated with hyaluronan (48). In our experiments, the addition of IFN-{gamma} did not inhibit chemokine transcript levels, and, indeed, their levels appeared slightly augmented. Because STAg and LPS display distinct TNF-{alpha} induction patterns (e.g., Fig. 2Go), it may also be that these chemokines are regulated differently when triggered by alternate stimuli. We are currently further examining the role of IFN-{gamma} on neutrophil chemokine expression.

The cytokine TNF-{alpha} has previously been shown to induce the expression of several neutrophil cytokines, including MIP-1{alpha} and IL-8 (15, 49). We also found that TNF-{alpha} alone displayed potent MIP-1{alpha}- and MIP-1ß-inducing activity in PMN. Our finding that STAg also induces PMN TNF-{alpha} production raises the possibility that MIP-1 expression in these cultures is an indirect activity of STAg resulting from autocrine stimulation by TNF-{alpha}. Indeed, the addition of a neutralizing anti-TNF-{alpha} antiserum blocked increases in MIP-1{alpha} and MIP-1ß gene transcript levels. Nevertheless, up-regulation of the MIP-1 genes was never completely eliminated and it is, therefore, possible that there remains a TNF-{alpha}-independent component to STAg-induced MIP-1 gene induction. We are currently further examining this issue.

Neutrophils are present in high numbers in the peripheral blood and in response to infection rapidly exit the circulation and accumulate at sites of tissue damage or infection. The finding that PMN are capable of producing several major inflammatory cytokines in response to T. gondii suggests that neutrophils may be important in directing early cell trafficking and cytokine-producing activities during infection with this microbial pathogen. Thus, a scenario that we favor is that PMN initially migrate to a focus of infection, where they are stimulated by the parasite to produce chemokines that subsequently serve an instrumental role in recruiting cells such as monocytes and dendritic cells during early infection. The activation of these cells, in turn, could be accomplished by the combined stimuli of parasites and neutrophil-derived cytokines.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant AI-40540 and the U.S. Department of Agriculture Hatch Act and Animal Health and Disease Research Program (Cornell University College of Veterinary Medicine). Back

2 A.J.M. and S.K.B. made equal contributions to this study. Back

3 Address correspondence and reprint requests to Dr. E. Denkers, Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401. E-mail address: Back

4 Abbreviations used in this paper: PMN, polymorphonuclear leukocyte; MIP, macrophage-inflammatory protein; STAg, soluble tachyzoite Ag. Back

5 S.K.B., Y.Z., and E.Y.D. Mouse neutrophils are a source of high level, IFN-{gamma}-independent IL-12 during Toxoplasma gondii infection. Submitted for publication. Back

Received for publication December 23, 1998. Accepted for publication March 31, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jackson, S. H., J. I. Gallin, S. M. Holland. 1995. The p47phox mouse knockout model of chronic granulomatous disease. J. Exp. Med. 182:751.[Abstract/Free Full Text]
  2. Belaaouaj, A., R. McCarthy, M. Baumann, Z. Gao, T. J. Ley, S. N. Abraham, S. D. Shapiro. 1998. Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis. Nat. Med. 4:615.[Medline]
  3. Gallin, J. I.. 1994. Inflammation. W. E. Paul, ed. Fundamental Immunology Third Edition.1015. Raven Press, New York.
  4. Brach, M. A., S. deVos, H. J. Gruss, F. Herrmann. 1992. Prolongation of survival of human polymorphonuclear neutrophils by granulocyte-macrophage colony-stimulating factor is caused by inhibition of programmed cell death. Blood 80:2920.[Abstract/Free Full Text]
  5. Colotta, F., F. Re, N. Polentarutti, S. Sozzani, A. Mantovani. 1992. Modulation of granulocyte survival and programmed cell death by cytokines and bacterial products. Blood 80:2012.[Abstract/Free Full Text]
  6. Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, W. I. Wood, M. W. Moore. 1994. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Nature 265:682.
  7. Cassatella, M. A.. 1995. The production of cytokines by polymorphonuclear neutrophils. Immunol. Today 16:21.[Medline]
  8. Cassatella, M. A., L. Meda, S. Gasperini, A. D’Andrea, X. Ma, G. Trinchieri. 1995. Interleukin-12 production by human polymorphonuclear leukocytes. Eur. J. Immunol. 25:1.[Medline]
  9. Dubravec, D. B., D. R. Spriggs, J. A. Mannick, M. L. Rodrick. 1990. Circulating human peripheral blood granulocytes synthesize and secrete tumor necrosis factor {alpha}. Proc. Natl. Acad. Sci. USA 87:6758.[Abstract/Free Full Text]
  10. Haziot, A., B. Z. Tsuberi, S. M. Goyert. 1993. Neutrophil CD14: biochemical properties and role in the secretion of tumor necrosis factor-{alpha} in response to lipopolysaccharide. J. Immunol. 150:5556.[Abstract]
  11. Romani, L., F. Bistoni, P. Puccetti. 1997. Initiation of T-helper cell immunity to Candida albicans by IL-12: the role of neutrophils. Chem. Immunol. 68:110.[Medline]
  12. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti, G. Trinchieri, F. Bistoni, P. Puccetti. 1997. Neutrophil production of IL-12 and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Immunol. 158:5349.[Abstract]
  13. Kasama, T., R. M. Strieter, N. W. Lukacs, M. D. Burdick, S. L. Kunkel. 1994. Regulation of neutrophil-derived chemokine expression by IL-10. J. Immunol. 152:3559.[Abstract]
  14. Kasama, T., R. M. Strieter, T. J. Standiford, M. D. Burdick, S. L. Kunkel. 1993. Expression and regulation of human neutrophil-derived macrophage inflammatory protein 1{alpha}. J. Exp. Med. 178:63.[Abstract/Free Full Text]
  15. Hachicha, M., P. Rathanaswami, P. H. Naccache, S. R. McColl. 1998. Regulation of chemokine gene expression in human peripheral blood neutrophils phagocytosing microbial pathogens. J. Immunol. 160:449.[Abstract/Free Full Text]
  16. Denkers, E. Y., R. T. Gazzinelli. 1998. Regulation and function of T cell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11:569.[Abstract/Free Full Text]
  17. Alexander, J., C. A. Hunter. 1998. Immunoregulation during toxoplasmosis. Chem. Immunol. 70:81.[Medline]
  18. Scharton-Kersten, T., E. Y. Denkers, R. T. Gazzinelli, A. Sher. 1995. Role of IL-12 in the induction of cell-mediated immunity to Toxoplasma gondii. Res. Immunol. 146:539.[Medline]
  19. Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, R. N. Germain, A. Sher. 1997. In vivo microbial stimulation induces rapid CD40L-independent production of IL-12 by dendritic cells and their re-distribution to T cell areas. J. Exp. Med. 186:1819.[Abstract/Free Full Text]
  20. Gazzinelli, R. T., S. Hieny, T. Wynn, S. Wolf, A. Sher. 1993. IL-12 is required for the T-cell independent induction of IFN-{gamma} by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115.[Abstract/Free Full Text]
  21. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  22. Sayles, P. C., L. J. Johnson. 1997. Exacerbation of toxoplasmosis in neutrophil depleted mice. Nat. Immun. 15:249.
  23. Scharton-Kersten, T., G. Yap, J. Magram, A. Sher. 1997. Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J. Exp. Med. 185:1.[Abstract/Free Full Text]
  24. Marshall, A. J., E. Y. Denkers. 1998. Toxoplasma gondii triggers granulocyte-dependent, cytokine-mediated lethal shock in D-galactosamine sensitized mice. Infect. Immun. 66:1325.[Abstract/Free Full Text]
  25. Gentle, T. A., R. A. Thompson. 1990. Neutrophil function tests in clinical immunology. H. C. Gooi, and H. Chapel, eds. Clinical Immunology: A Practical Approach 55. Oxford University Press, New York.
  26. Denkers, E. Y., T. Scharton-Kersten, S. Barbieri, P. Caspar, A. Sher. 1996. A role for CD4+NK1.1+ T lymphocytes as MHC class II independent helper cells in the generation of CD8+ effector function against intracellular infection. J. Exp. Med. 184:131.[Abstract/Free Full Text]
  27. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, G. Trinchieri, A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-{gamma} synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
  28. Loetscher, P., M. Seitz, I. Clark-Lewis, M. Baggiolini, B. Moser. 1996. Activation of NK cells by CC chemokines: chemotaxis, Ca+2 mobilization, and enzyme release. J. Immunol. 156:322.[Abstract]
  29. Xu, L. L., W. L. Warren, W. L. Rose, W. Gong, J. M. Wang. 1996. Human recombinant monocyte chemotactic protein and other C-C chemokines bind and induce directional migration of dendritic cells in vitro. J. Leukocyte Biol. 60:365.[Abstract]
  30. Uguccioni, M., M. D’Apuzzo, M. Loetscher, B. Dewald, M. Baggiolini. 1995. Actions of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, MIP-1{alpha} and MIP-1ß. Eur. J. Immunol. 25:64.[Medline]
  31. Taub, D. D., K. Conlon, A. R. Lloyd. 1993. Preferential migration of activated CD4+ and CD8+ T cells in response to MIP-1{alpha} and MIP-1ß. Science 260:355.[Abstract/Free Full Text]
  32. Kasama, T., R. M. Strieter, N. W. Lukacs, P. M. Lincoln, M. D. Burdick, S. L. Kunkel. 1995. Interferon {gamma} modulates the expression of neutrophil-derived chemokines. J. Invest. Med. 43:58.[Medline]
  33. Hachicha, M., P. Rathanaswami, P. H. Naccache, S. R. McColl. 1998. Regulation of chemokine gene expression in human peripheral blood neutrophils phagocytosing microbial pathogens. J. Immunol. 160:449.
  34. Cassatella, M. A.. 1996. Interferon-{gamma} inhibits the lipopolysaccharide-induced macrophage inhibitory protein-1{alpha} gene transcription in human neutrophils. Immunol. Lett. 49:79.[Medline]
  35. Romani, L., A. Mencacci, E. Cenci, G. Del Sero, F. Bistoni, P. Puccetti. 1997. An immunoregulatory role for neutrophils in CD4+ T helper subset selection in mice with candidiasis. J. Immunol. 158:2356.[Abstract]
  36. Scharton-Kersten, T. M., T. A. Wynn, E. Y. Denkers, S. Bala, L. Showe, E. Grunvald, S. Hieny, R. T. Gazzinelli, A. Sher. 1996. In the absence of endogenous IFN-{gamma} mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. J. Immunol. 157:4045.[Abstract]
  37. Khan, I. A., T. Matsuura, L. H. Kasper. 1994. Interleukin-12 enhances murine survival against acute toxoplasmosis. Infect. Immun. 62:1639.[Abstract/Free Full Text]
  38. Hunter, C. A., E. Candolfi, C. Subauste, V. Van Cleave, J. S. Remington. 1995. Studies on the role of IL-12 in murine toxoplasmosis. Immunology 84:16.[Medline]
  39. Suzuki, Y., J. S. Remington. 1988. Dual regulation of resistance against Toxoplasma gondii infection by Lyt-2+ and Lyt-1+, L3T4+ T cells in mice. J. Immunol. 140:3943.[Abstract]
  40. Amichay, D., R. T. Gazzinelli, G. Karupiah, T. Moench, A. Sher, J. Farber. 1996. The genes for the chemokines MuMig and Crg-2 are induced in protozoan and viral infections in response to IFN-{gamma} with patterns of tissue expression that suggest nonredundant roles in vivo. J. Immunol. 157:4511.[Abstract]
  41. Miller, M. D., M. S. Krangel. 1992. Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Crit. Rev. Immunol. 12:17.[Medline]
  42. Sozzani, S., W. Luini, A. Borsatti, N. Polentarutti, D. Zhou, L. Piemonti, G. D’Amico, C. A. Power, T. N. C. Wells, M. Gobbi, P. Allavena, A. Mantovani. 1997. Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines. J. Immunol. 159:1993.[Abstract]
  43. Vaddi, K., R. C. Newton. 1994. Comparison of biological responses of human monocytes and THP-1 cells to chemokines of the intercrine-beta family. J. Leukocyte Biol. 55:756.[Abstract]
  44. Schrum, S., P. Probst, B. Fleischer, P. F. Zipfel. 1996. Synthesis of the CC-chemokines MIP-1{alpha} and MIP-1ß, and RANTES is associated with a type 1 immune response. J. Immunol. 157:3598.[Abstract]
  45. Siveke, J. T., A. Hammann. 1998. T helper 1 and T helper 2 cells respond differentially to chemokines. J. Immunol. 160:550.[Abstract/Free Full Text]
  46. Bonecchi, R., G. Bianchi, P. P. Bordignon, D. D’Ambrosio, R. Lang, A. Borsatti, S. Sozzani, P. Allavena, P. A. Gray, A. Mantovani, F. Sinigaglia. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187:129.[Abstract/Free Full Text]
  47. Meda, L., S. Gasperini, M. Ceska, M. A. Cassatella. 1994. Modulation of proinflammatory polymorphonuclear leukocytes by {gamma} interferon. Cell. Immunol. 157:448.[Medline]
  48. Hodge-Defour, J., M. W. Marino, M. R. Horton, A. Jungbluth, M. D. Burdick, R. M. Strieter, P. W. Noble, C. A. Hunter, E. Pure. 1998. Inhibition of interferon {gamma} induced interleukin 12 production: a potential mechanism for the anti-inflammatory activities of tumor necrosis factor. Proc. Natl. Acad. Sci. USA 95:13806.[Abstract/Free Full Text]
  49. Hachicha, M., P. H. Naccache, S. R. McColl. 1995. Inflammatory microcrystals differentially regulate the secretion of macrophage inflammatory protein 1 and interleukin 8 by human neutrophils: a possible mechanism of neutrophil recruitment to sites of inflammation in synovitis. J. Exp. Med. 182:2019.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Sporri, N. Joller, H. Hilbi, and A. Oxenius
A Novel Role for Neutrophils As Critical Activators of NK Cells
J. Immunol., November 15, 2008; 181(10): 7121 - 7130.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Flores, R. Saavedra, R. Bautista, R. Viedma, E. P. Tenorio, L. Leng, Y. Sanchez, I. Juarez, A. A. Satoskar, A. S. Shenoy, et al.
Macrophage migration inhibitory factor (MIF) is critical for the host resistance against Toxoplasma gondii
FASEB J, October 1, 2008; 22(10): 3661 - 3671.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. McFarlane, C. Perez, M. Charmoy, C. Allenbach, K. C. Carter, J. Alexander, and F. Tacchini-Cottier
Neutrophils Contribute to Development of a Protective Immune Response during Onset of Infection with Leishmania donovani
Infect. Immun., February 1, 2008; 76(2): 532 - 541.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. S. Masek, J. Fiore, M. Leitges, S.-F. Yan, B. D. Freedman, and C. A. Hunter
Host cell Ca2+ and protein kinase C regulate innate recognition of Toxoplasma gondii
J. Cell Sci., November 1, 2006; 119(21): 4565 - 4573.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Bennouna, W. Sukhumavasi, and E. Y. Denkers
Toxoplasma gondii Inhibits Toll-Like Receptor 4 Ligand-Induced Mobilization of Intracellular Tumor Necrosis Factor Alpha to the Surface of Mouse Peritoneal Neutrophils
Infect. Immun., July 1, 2006; 74(7): 4274 - 4281.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Allenbach, C. Zufferey, C. Perez, P. Launois, C. Mueller, and F. Tacchini-Cottier
Macrophages Induce Neutrophil Apoptosis through Membrane TNF, a Process Amplified by Leishmania major.
J. Immunol., June 1, 2006; 176(11): 6656 - 6664.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Uddin, H. H. Garcia, R. H. Gilman, A. E. Gonzalez, and J. S. Friedland
Monocyte-Astrocyte Networks and the Regulation of Chemokine Secretion in Neurocysticercosis
J. Immunol., September 1, 2005; 175(5): 3273 - 3281.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. M. Robben, M. LaRegina, W. A. Kuziel, and L. D. Sibley
Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis
J. Exp. Med., June 6, 2005; 201(11): 1761 - 1769.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bennouna and E. Y. Denkers
Microbial Antigen Triggers Rapid Mobilization of TNF-{alpha} to the Surface of Mouse Neutrophils Transforming Them into Inducers of High-Level Dendritic Cell TNF-{alpha} Production
J. Immunol., April 15, 2005; 174(8): 4845 - 4851.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Del Rio, B. A. Butcher, S. Bennouna, S. Hieny, A. Sher, and E. Y. Denkers
Toxoplasma gondii Triggers Myeloid Differentiation Factor 88-Dependent IL-12 and Chemokine Ligand 2 (Monocyte Chemoattractant Protein 1) Responses Using Distinct Parasite Molecules and Host Receptors
J. Immunol., June 1, 2004; 172(11): 6954 - 6960.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. Oktenli, L. Doganci, T. Ozgurtas, R.E. Araz, M. Tanyuksel, U. Musabak, S.Y. Sanisoglu, Z. Yesilova, M.K. Erbil, and A. Inal
Transient hypogonadotrophic hypogonadism in males with acute toxoplasmosis: suppressive effect of interleukin-1{beta} on the secretion of GnRH
Hum. Reprod., April 1, 2004; 19(4): 859 - 866.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. M. Robben, D. G. Mordue, S. M. Truscott, K. Takeda, S. Akira, and L. D. Sibley
Production of IL-12 by Macrophages Infected with Toxoplasma gondii Depends on the Parasite Genotype
J. Immunol., March 15, 2004; 172(6): 3686 - 3694.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. C. Gavrilescu, B. A. Butcher, L. Del Rio, G. A. Taylor, and E. Y. Denkers
STAT1 Is Essential for Antimicrobial Effector Function but Dispensable for Gamma Interferon Production during Toxoplasma gondii Infection
Infect. Immun., March 1, 2004; 72(3): 1257 - 1264.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Schroder, P. J. Hertzog, T. Ravasi, and D. A. Hume
Interferon-{gamma}: an overview of signals, mechanisms and functions
J. Leukoc. Biol., February 1, 2004; 75(2): 163 - 189.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bennouna, S. K. Bliss, T. J. Curiel, and E. Y. Denkers
Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection
J. Immunol., December 1, 2003; 171(11): 6052 - 6058.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Debierre-Grockiego, N. Azzouz, J. Schmidt, J.-F. Dubremetz, H. Geyer, R. Geyer, R. Weingart, R. R. Schmidt, and R. T. Schwarz
Roles of Glycosylphosphatidylinositols of Toxoplasma gondii: INDUCTION OF TUMOR NECROSIS FACTOR-{alpha} PRODUCTION IN MACROPHAGES
J. Biol. Chem., August 29, 2003; 278(35): 32987 - 32993.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Taube, A. Dakhama, Y.-H. Rha, K. Takeda, A. Joetham, J.-W. Park, A. Balhorn, T. Takai, K. R. Poch, J. A. Nick, et al.
Transient Neutrophil Infiltration After Allergen Challenge Is Dependent on Specific Antibodies and Fc{gamma}III Receptors
J. Immunol., April 15, 2003; 170(8): 4301 - 4309.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Y. Channon, K. A. Miselis, L. A. Minns, C. Dutta, and L. H. Kasper
Toxoplasma gondii Induces Granulocyte Colony-Stimulating Factor and Granulocyte-Macrophage Colony-Stimulating Factor Secretion by Human Fibroblasts: Implications for Neutrophil Apoptosis
Infect. Immun., November 1, 2002; 70(11): 6048 - 6057.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. A. Butcher and E. Y. Denkers
Mechanism of Entry Determines the Ability of Toxoplasma gondii To Inhibit Macrophage Proinflammatory Cytokine Production
Infect. Immun., September 1, 2002; 70(9): 5216 - 5224.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. N. Ellis and B. L. Beaman
Murine polymorphonuclear neutrophils produce interferon-{gamma} in response to pulmonary infection with Nocardia asteroides
J. Leukoc. Biol., August 1, 2002; 72(2): 373 - 381.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Venuprasad, P. P. Banerjee, S. Chattopadhyay, S. Sharma, S. Pal, P. B. Parab, D. Mitra, and B. Saha
Human Neutrophil-Expressed CD28 Interacts with Macrophage B7 to Induce Phosphatidylinositol 3-Kinase-Dependent IFN-{gamma} Secretion and Restriction of Leishmania Growth
J. Immunol., July 15, 2002; 169(2): 920 - 928.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. C. Leemans, M. J. B. M. Vervoordeldonk, S. Florquin, K. P. van Kessel, and T. van der Poll
Differential Role of Interleukin-6 in Lung Inflammation Induced by Lipoteichoic Acid and Peptidoglycan from Staphylococcus aureus
Am. J. Respir. Crit. Care Med., May 15, 2002; 165(10): 1445 - 1450.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Del Rio, S. Bennouna, J. Salinas, and E. Y. Denkers
CXCR2 Deficiency Confers Impaired Neutrophil Recruitment and Increased Susceptibility During Toxoplasma gondii Infection
J. Immunol., December 1, 2001; 167(11): 6503 - 6509.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. I. Terrazas, K. L. Walsh, D. Piskorska, E. McGuire, and D. A. Harn Jr.
The Schistosome Oligosaccharide Lacto-N-neotetraose Expands Gr1+ Cells That Secrete Anti-inflammatory Cytokines and Inhibit Proliferation of Naive CD4+ Cells: A Potential Mechanism for Immune Polarization in Helminth Infections
J. Immunol., November 1, 2001; 167(9): 5294 - 5303.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. G. Mordue, F. Monroy, M. La Regina, C. A. Dinarello, and L. D. Sibley
Acute Toxoplasmosis Leads to Lethal Overproduction of Th1 Cytokines
J. Immunol., October 15, 2001; 167(8): 4574 - 4584.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. A. Butcher, L. Kim, P. F. Johnson, and E. Y. Denkers
Toxoplasma gondii Tachyzoites Inhibit Proinflammatory Cytokine Induction in Infected Macrophages by Preventing Nuclear Translocation of the Transcription Factor NF-{kappa}B
J. Immunol., August 15, 2001; 167(4): 2193 - 2201.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. K. Bliss, L. C. Gavrilescu, A. Alcaraz, and E. Y. Denkers
Neutrophil Depletion during Toxoplasma gondii Infection Leads to Impaired Immunity and Lethal Systemic Pathology
Infect. Immun., August 1, 2001; 69(8): 4898 - 4905.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. R. Hall, E. Diaconu, and E. Pearlman
A Dominant Role for Fc{{gamma}} Receptors in Antibody-Dependent Corneal Inflammation
J. Immunol., July 15, 2001; 167(2): 919 - 925.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Tateda, T. A. Moore, M. W. Newstead, W. C. Tsai, X. Zeng, J. C. Deng, G. Chen, R. Reddy, K. Yamaguchi, and T. J. Standiford
Chemokine-Dependent Neutrophil Recruitment in a Murine Model of Legionella Pneumonia: Potential Role of Neutrophils as Immunoregulatory Cells
Infect. Immun., April 1, 2001; 69(4): 2017 - 2024.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. R. Hall, E. Diaconu, R. Patel, and E. Pearlman
CXC Chemokine Receptor 2 But Not C-C Chemokine Receptor 1 Expression Is Essential for Neutrophil Recruitment to the Cornea in Helminth-Mediated Keratitis (River Blindness)
J. Immunol., March 15, 2001; 166(6): 4035 - 4041.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. A. Khan, P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, and G. R. Yeaman
Mice Lacking the Chemokine Receptor CCR1 Show Increased Susceptibility to Toxoplasma gondii Infection
J. Immunol., February 1, 2001; 166(3): 1930 - 1937.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. A. Lapinet, P. Scapini, F. Calzetti, O. Perez, and M. A. Cassatella
Gene Expression and Production of Tumor Necrosis Factor Alpha, Interleukin-1beta (IL-1beta ), IL-8, Macrophage Inflammatory Protein 1alpha (MIP-1alpha ), MIP-1beta , and Gamma Interferon-Inducible Protein 10 by Human Neutrophils Stimulated with Group B Meningococcal Outer Membrane Vesicles
Infect. Immun., December 1, 2000; 68(12): 6917 - 6923.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. M. Smith, Y. Zhang, W. D. Grafton, S. R. Jennings, and D. J. O'Callaghan
Severe Murine Lung Immunopathology Elicited by the Pathogenic Equine Herpesvirus 1 Strain RacL11 Correlates with Early Production of Macrophage Inflammatory Proteins 1alpha , 1beta , and 2 and Tumor Necrosis Factor Alpha
J. Virol., November 1, 2000; 74(21): 10034 - 10040.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
S. K. Bliss, B. A. Butcher, and E. Y. Denkers
Rapid Recruitment of Neutrophils Containing Prestored IL-12 During Microbial Infection
J. Immunol., October 15, 2000; 165(8): 4515 - 4521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Tacchini-Cottier, C. Zweifel, Y. Belkaid, C. Mukankundiye, M. Vasei, P. Launois, G. Milon, and J. A. Louis
An Immunomodulatory Function for Neutrophils During the Induction of a CD4+ Th2 Response in BALB/c Mice Infected with Leishmania major
J. Immunol., September 1, 2000; 165(5): 2628 - 2636.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Brandt, G. Woerly, A. B. Younes, S. Loiseau, and M. Capron
IL-4 production by human polymorphonuclear neutrophils
J. Leukoc. Biol., July 1, 2000; 68(1): 125 - 130.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
M. C. Bosco, A. Rapisarda, S. Massazza, G. Melillo, H. Young, and L. Varesio
The Tryptophan Catabolite Picolinic Acid Selectively Induces the Chemokines Macrophage Inflammatory Protein-1{alpha} and -1{beta} in Macrophages
J. Immunol., March 15, 2000; 164(6): 3283 - 3291.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Pedrosa, B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, and A. M. Cooper
Neutrophils Play a Protective Nonphagocytic Role in Systemic Mycobacterium tuberculosis Infection of Mice
Infect. Immun., February 1, 2000; 68(2): 577 - 583.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bliss, S. K.
Right arrow Articles by Denkers, E. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bliss, S. K.
Right arrow Articles by Denkers, E. Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS