|
|
||||||||
, and the Chemokines Macrophage-Inflammatory Protein-1
and -1ß in Response to Toxoplasma gondii Antigens1
Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853
| Abstract |
|---|
|
|
|---|
. Similarly, up-regulated expression of
macrophage-inflammatory protein-1
(MIP-1
) and MIP-1ß gene
transcripts was induced. Kinetic analysis of IL-12 and TNF-
production revealed distinct patterns following stimulation by
T. gondii or LPS. Exogenous TNF-
alone also provided
a potent stimulus of MIP-1
and MIP-1ß expression, and when
neutralizing anti-TNF-
antiserum was included in cultures of
parasite-stimulated cells, expression of these CC-family chemokines was
partially blocked. These results establish that T.
gondii possesses the ability of driving neutrophil
proinflammatory cytokine production, and they suggest that
parasite-induced MIP-1
and MIP-1ß partly results from autocrine
stimulation through TNF-
. | Introduction |
|---|
|
|
|---|
, IFN-
, IL-6, G-CSF,
GM-CSF) prolong their lifespan, suggesting that PMN may be
longer-lived, particularly during infectious settings, than previously
believed (4, 5).
In addition to microbicidal activity, PMN are capable of producing
several cytokines. Indeed, their ability to rapidly migrate to a focus
of infection, as well as their large numbers in peripheral blood,
suggest that neutrophils may play an important role as a cytokine
source during early infection. In recent years, PMN have been shown to
produce both TNF-
and IL-12 after stimulation with microbial
products such as bacterial LPS, as well as the yeast pathogen
Candida albicans (6, 7, 8, 9, 10, 11, 12). Neutrophils are also capable of
secreting chemokines of both the CC and CXC families, including the
neutrophil chemotactic factor IL-8 and the macrophage chemotactic
factors macrophage-inflammatory protein-1
(MIP-1
) and MIP-1ß
(13, 14, 15). Together, these findings suggest that PMN may be important
both in early cellular recruitment to a focus of infection and in
producing cytokines that influence the activity of the incoming immune
cells.
The control of infection with the opportunistic protozoan parasite
Toxoplasma gondii is dependent upon strong cell-mediated
immunity (16, 17, 18). This response is initiated by early IL-12 production
from cell types such as macrophages and dendritic cells (19, 20), which
can promote macrophage microbicidal function through IFN-
induction,
as well as driving differentiation of Th1 type CD4+ and
CD8+ effector T lymphocytes (21). Recently, granulocytes
have also been found to contribute to resistance during acute
infection. Thus, depletion of PMN with mAb specific for the
granulocyte marker GR-1 impairs the ability of mice to survive acute
infection with the low-virulence strain ME49 introduced either by i.p.
injection or oral administration (22, 23).
The mechanism by which neutrophils contribute to resistance to the
parasite is not presently known, but recent work from our laboratory
may shed light on this issue. We have found an essential role for PMN
in a model of lethal inflammatory cytokine shock induced by the
administration of low doses of tachyzoite lysate to
D-galactosamine-sensitized mice (24), a result suggesting
that neutrophils are involved in Toxoplasma-induced
proinflammatory cytokine production in vivo. Nevertheless, this finding
does not establish whether PMN themselves release cytokines such as
TNF-
and IL-12 in response to T. gondii, or whether
neutrophils promote production of these cytokines by another cell type,
for example by recruiting and activating monocytes through the release
of chemotactic factors (14).
To address this issue, we used human peripheral blood as a source from
which to obtain large numbers of purified PMN. As we show in this
paper, PMN rapidly release both IL-12 and TNF-
when cultured in
vitro with T. gondii Ag. Among several chemokines examined,
we found strong up-regulation of transcripts for MIP-1
and MIP-1ß
after Ag stimulation. The latter CC chemokines were similarly
up-regulated by the addition of exogenous TNF-
in the absence of
further stimulation. These results show that neutrophils are involved
in early cytokine responses to the parasite and suggest that they may
play a role in establishing the cytokine network initiated by
Toxoplasma infection.
| Materials and Methods |
|---|
|
|
|---|
RH strain T. gondii tachyzoites were maintained by biweekly passage on human foreskin fibroblasts in DMEM (Life Technologies, Grand Island, NY), 1% FCS (HyClone, Logan, UT), 100 U/ml of penicillin, and 0.1 mg/ml of streptomycin (Sigma, St. Louis, MO). Soluble tachyzoite Ag (STAg) was prepared as previously described (24). Briefly, tachyzoites were sonicated in the presence of protease inhibitors (0.2 mM PMSF, 0.2 mM aprotinin, 1 mM leupeptin, and 1 mM EDTA), dialyzed into PBS, and filter sterilized through a 0.2-µm membrane (Corning Costar, Cambridge, MA), assayed for protein concentration, and stored at -70°C. Parasite extracts were found to be free of endotoxin as measured by the Limulus amebocyte assay. Parasite cultures were free of Mycoplasma contamination as determined by diagnostic RT-PCR and ELISA (kits from Strategene, La Jolla, CA and Boehringer-Mannheim, Indianapolis, IN, respectively), as well as by microbiological assay and fluorescent DNA staining (performed by the Mycoplasma Testing Laboratory, Coriell Institute for Medical Research, Camden, NJ)
Toxoplasma ELISA
Peripheral blood from healthy human donors was obtained by venipuncture and collected in vacutainer tubes (Becton Dickinson, Franklin Lakes, NJ) containing EDTA. Whole blood was centrifuged (13,000 x g, 5 min), plasma was transferred to a new tube, and an ELISA was performed to test for T. gondii-seropositive individuals as described below.
First, 96-well ELISA plates (Corning Costar) were coated with STAg diluted in PBS (25 µg/ml), and the plates were incubated at 37°C for 2 h. After washing in PBS with 0.05% Tween 20, the plates were blocked by overnight incubation at 4°C in 1% BSA in PBS. Plates were subsequently washed and a serial dilution of each plasma sample was added to wells and incubated at 37°C for 2 h. After washing the plates, a HRP-conjugated goat anti-human Ab (Jackson Immunoresearch Laboratories, West Grove, PA) was added to sample wells and the plates were incubated a further 90 min at 37°C. After washing, the plates were developed with 2.2-azino-di(3-ethyl-benzthiazoline sulfonate) (ABTS; Kirkegard and Perry Laboratories, Gaithersburg, MD), absorbance (405 nm) was measured on a Microplate BIO Kinetics Reader (Bio-Tek Instruments, Winooski, VT), and the results were compared with a positive serum pool.
Isolation of human neutrophils
Whole blood was obtained from T. gondii-seronegative individuals by venipuncture and was placed on ice. Neutrophils were isolated as previously described (25) with the following modifications. Before blood collection, an isotonic solution of Percoll (Pharmacia Biotech, Piscataway, NJ) was prepared by mixing nine parts Percoll with one part 10x HBSS (Life Technologies). Next, 69% and 75% Percoll solutions were prepared from isotonic Percoll diluted with 1x HBSS. Then 1.5 ml of 75% Percoll was poured into a 15-ml round-bottom tube and overlaid with 3 ml of the 69% solution. Whole blood was diluted 2-fold with complete RPMI 1640 media (10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 30 mM HEPES, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 5 x 10-5 M 2-ME), and 4 ml was overlaid on the Percoll gradients. Tubes containing Percoll gradients and blood were centrifuged (500 x g) for 30 min at room temperature. The band corresponding to the neutrophil fraction was collected, washed twice with complete RPMI 1640 media, and cells were counted. To determine the purity of isolated cells, differential cell counts were performed on Diff-Quik (American Scientific Products, McGraw Park, IL)-stained cytocentrifuge slides, counting a minimum of 500 cells per slide.
Neutrophil stimulation
PMN were plated in triplicate for each experimental group in a 96-well tissue culture plate (Corning Costar) at 1 x 106 cells/well in complete RPMI 1640 media with either media alone, LPS (1 µg/well), or STAg (50 and 100 µg/well). Tissue culture plates were incubated at 37°C with 5% CO2. Culture supernatants were removed at various times after culture initiation and stored (-70°C) until assayed for the presence of cytokines.
RNA isolation
At the time of supernatant harvest, cells were collected from triplicate wells and pooled in 200 µl of RNA STAT 60 (Tel-Test, Friendswood, TX), then placed in 2 ml Eppendorf tubes. To obtain sufficient RNA for analysis, triplicate samples were pooled. Cellular RNA was subsequently isolated by adding 40 µl of chloroform (Sigma) per 1 x 106 cells, vortexing the tube, and centrifuging at 13,000 x g at 4°C for 15 min. The resulting aqueous phase was transferred to a new tube containing an equal volume of isopropanol (Sigma) and incubated at -20°C overnight. To precipitate RNA, a one-tenth volume of 3 M sodium acetate was added to the RNA-isopropanol solution, and the mixture was vortexed then centrifuged at 13,000 x g at 4°C for 15 min. The resulting pellet was washed in 75% ethanol, resuspended in H2O, and the concentration was determined using a spectrophotometer equipped with a UV lamp (Beckman DU-50, Beckman Instruments, Palo Alto, CA).
RT-PCR and Southern blotting
RNA (6 µg) was reverse transcribed using oligo(dT) primers (Promega, Madison, WI). After heating samples to 72°C and chilling on ice to allow hybridization, a master mix (5x reverse transcriptase buffer, 0.1 M DTT, 2.5 mM dNTPs, 40 U/ml RNasin, and 200 U/ml superscript reverse transcriptase) was added, and the samples were incubated at 45°C for 60 min followed by 10 min at 94°C. The resulting cDNA was either used immediately or stored at -20°C until PCR-mediated gene amplification.
The PCR was performed using a master mix containing dNTPs (2.5 mM), PCR
buffer containing 1.5 mM MgCl2 (Promega), primers (0.5
µM; 1:1 antisense: sense), and Taq polymerase (5 U/µl;
Life Technologies). The nucleotide sequences employed as sense and
antisense primers were: ß-actin, TGACGGGGGTCACCCACACTGTGCCCATCTA,
CTAGAAGCATTGCGGTGGACGATGGAGGG; MIP-1
,
CGCCTGCTGCTTCAGCTACCTCCCGGCA, TGGACCCCTCAGGCACTCAGCTCCAGGTCG;
MIP-1ß, ACCCTCCCACCGCCTGCTGCTTTTCTTCAC,
GTTGCAGGTCATACACGTACTCCTGGACCC. The program for PCR consisted of
94°C for 1 min, 54°C for 1 min, and 72°C for 2 min, with a final
extension of 7 min at 72°C. The cDNA was amplified 33 cycles
(ß-actin), 31 cycles (MIP-1
), and 29 cycles (MIP-1ß).
The RT-PCR products were resolved on 2% agarose gels, and bands were visualized by staining with ethidium bromide. A 100-bp DNA ladder (Life Technologies) was simultaneously run on the gels to confirm that PCR products possessed the predicted size. Photographs of gels were scanned and analyzed with the use of Adobe Photoshop software (Adobe Systems, Mountain View, CA). Integrated band size and pixel density was evaluated and expressed as a ratio of chemokine band intensity divided by ß-actin band intensity.
Southern blotting was performed as described in detail elsewhere (26).
Briefly, amplified DNA was blotted from agarose gels onto a
Hybond-N+ membrane (Amersham International,
Buckinghamshire, U.K.) and subsequently probed with internal
cytokine-specific oligonucleotides. An enhanced chemiluminescence
protocol was employed to detect binding (Amersham). The
following probes were employed: MIP-1
,
GACACCGGGCTTGGAGCACTGGCTGCTCGT; MIP-1ß,
AGAGGCTGCTGGTCTCATAGTAATCTACCA; ß-actin,
CATGAGGTAGTCAGTCAGGTCCCGGCCAGC.
Cytokine measurement
Levels of TNF-
and IL-12 (p70) in culture supernatants were
measured using commercially available ELISA kits according to the
manufacturers instructions (Genzyme, Cambridge, MA).
Recombinant cytokine and anti-cytokine treatment
The neutrophils were stimulated in the presence and absence of
STAg with recombinant human TNF-
(100 ng/ml) and IFN-
(20 U/ml)
(PharMingen, San Diego, CA). The induction of MIP-1
and MIP-1ß
mRNA transcript synthesis was detected by RT-PCR 3 h after culture
initiation. For blocking TNF-
, a neutralizing rabbit antiserum
(Genzyme) was employed and compared with normal rabbit serum. Both
reagents were used at a 1/500 dilution, a 100-fold excess in the amount
required to neutralize >95% of the TNF-
activity.
| Results |
|---|
|
|
|---|
We wished to initially focus our study on donors possessing low
T. gondii Ab titers who presumably had not been exposed
previously to the parasite. T. gondii-specific serum Ab
levels were measured by ELISA and 4 donors with titers >1/50 were
selected for purification of PMN from peripheral blood. As shown in
Table I
, the populations obtained ranged
from 9499% PMN. The vast majority of these cells were neutrophils,
although for the case of donor 1, a relatively large proportion
obtained were eosinophils on several separate occasions. Because
neutrophils may undergo apoptotic death when cultured for 24 h and
beyond (4, 5), we also measured cell viability after 12 h, the
time at which our experiments were terminated. As shown in Table I
,
there was no significant cell death during this period.
|
and IL-12
production
Previous studies have shown that human neutrophils are capable of
responding to bacterial LPS by producing TNF-
and IL-12 (8, 9), but
their ability to produce these cytokines in response to protozoan
stimulation is unexplored. Accordingly, PMN cultures were initiated
from the seronegative donors listed in Table I
, and supernatants were
assayed for the presence of IL-12 (p70) and TNF-
after stimulation
with media or STAg.
As shown in Fig. 1
, parasite Ag induced
IL-12 (p70) release from each of the donors. A low level of IL-12
production was found in the absence of parasite stimulation, possibly a
result of nonspecific activation during the course of purification.
Similar results were obtained in an RT-PCR analysis (data not shown),
suggesting that the background IL-12 shown in Fig. 1
is not an artifact
of the ELISA. We also found that STAg stimulated production of TNF-
from the PMN. Although we found a degree of variability in the amount
of cytokine produced from donor to donor, the production of TNF-
in
the presence of STAg was consistently much greater than in media alone.
|
was higher
relative to LPS. Whereas STAg-induced TNF-
reached maximal levels at
6 h and subsequently declined, LPS-stimulated TNF-
production
rapidly rose through this period. A similar kinetic profile was found
for LPS-driven IL-12 (p70) production, but in contrast to TNF-
, LPS
was a less potent stimulus for IL-12 production than was STAg. These
and previously published data (24, 27) indicate that the underlying
biochemical pathways triggered by LPS and T. gondii, which
result in the induction of IL-12 and TNF-
, are distinct.
|
and
MIP-1ß in PMN
Because PMN, more than other cell types, are able to rapidly
accumulate at a site of infection, we asked whether parasite-stimulated
PMN produced chemotactic factors potentially involved in further immune
cell recruitment. Both MIP-1
and MIP-1ß, members of the CC
chemokine family, are chemotactic factors for monocytes and dendritic,
NK, and T cells (28, 29, 30, 31). As shown in Fig. 3
, RT-PCR analysis demonstrates rapid
up-regulation of transcripts for both MIP-1
and MIP-1ß,
and up-regulation of these transcripts was sustained for at least
12 h following culture initiation.
|
and IFN-
have been reported to exert effects
on cytokine production by PMN. Thus, TNF-
possesses the ability to
induce MIP-1
and IL-8, while IFN-
appears capable of both
inhibitory and stimulatory activity dependent upon the time of analysis
(32, 33, 34). Accordingly, PMN were cultured with STAg or media in the
presence of recombinant TNF-
or IFN-
, and 3 h later cells
were harvested and the induction of gene transcripts was examined. Fig. 4
alone provided a potent stimulus for increased
expression of MIP-1
and MIP-1ß gene transcripts. The inclusion of
STAg with TNF-
did not appear to further augment the expression of
the chemokines. We found a different pattern when examining the effect
of exogenous IFN-
. In this case, the cytokine alone did not induce
up-regulation of MIP-1
or MIP-1ß transcripts. STAg-driven
expression of the chemokines appeared slightly augmented when
exogenous IFN-
was included in the cultures (Fig. 4
|
alone provided a strong stimulus for MIP-1, we wished
to determine whether the expression of this chemokine was driven by
TNF-
, itself induced early during STAg stimulation. As shown in Fig. 5
, 62%
inhibition; MIP-1ß, 78% inhibition, as estimated from densitometric
analysis of scanned gel images). In contrast, normal control serum had
no inhibitory effect on STAg-induced chemokine production. We conclude
that the T. gondii-induced chemokine response is, in part,
driven through TNF-
production. Nevertheless, we cannot exclude the
possibility that the parasite directly stimulates neutrophil production
of MIP-1
and MIP-1ß.
|
| Discussion |
|---|
|
|
|---|
and IL-12. The production of the latter cytokine
occurred within 2 h in vitro, and while it is possible that this
rapid appearance results from exocytosis of preformed cytokine, RT-PCR
analysis indicates that at least some of the IL-12 produced is the
result of de novo gene transcription (data not shown). Interestingly,
the kinetics of TNF-
and IL-12 production induced by the parasite
appear distinct from the response elicited by LPS. Thus, T.
gondii was a more potent stimulus for neutrophil IL-12 than was
LPS, and conversely, LPS was a much stronger stimulus for TNF-
production than was tachyzoite lysate. These disparate responses
suggest that LPS and STAg induced PMN triggering follow distinct
molecular pathways, a conclusion that is supported by findings in mouse
systems indicating that LPS nonresponsive strains remain responsive to
T. gondii-triggered type 1 inflammatory cytokine production
(24, 27). The ability of neutrophils to serve as a cytokine source, in combination with their large numbers in peripheral blood and the ability to rapidly migrate to a focus of infection, suggest that PMN may be a key cell type in cytokine-initiated immune system triggering. The capacity of neutrophils to serve such an immunoregulatory role is underscored by findings in C. albicans-infected mice (11). In the latter experimental system, neutrophils produce IL-12 or IL-10 depending upon whether the animals are undergoing self-healing (Th1-associated) or progressive (Th2-associated) disease, respectively (12, 35). The depletion of granulocytes in Candida-infected mice undergoing infection with a normally self-healing yeast strain leads to the development of a Th2 response and progressive disease. Thus, by virtue of their ability to produce two key immunomodulatory cytokines, neutrophils exert a major impact in determining whether or not the host survives C. albicans infection.
We do not yet know if PMN play such a critical immunoregulatory role during early T. gondii infection. The ability of the host to survive T. gondii infection is critically dependent upon IL-12 and subsequent Th1 development (16, 27, 36, 37, 38, 39). Studies in mice indicate that neutrophil depletion increases the susceptibility to acute toxoplasmosis (22, 23), and while the reasons for this are unclear, it is plausible that early neutrophil IL-12 production contributes to the protective activity of these cells. Nevertheless, monocytes/macrophages and dendritic cells are also capable of T. gondii-induced IL-12 synthesis, and it is probable that all three cell types are active in IL-12 production during the first contact of Toxoplasma with the innate immune system.
The stimulation of human neutrophils with T. gondii also
resulted in the rapid induction of MIP-1 mRNA, and the up-regulation of
transcripts was sustained for at least 12 h. The ability of
neutrophils to produce MIP-1 proteins has been previously reported (13, 14, 33), although chemokine expression induced by Toxoplasma
itself is relatively little studied. In this regard, the mouse CXC
chemokines MuMig and Crg-2 are induced in dependence upon IFN-
during T. gondii infection, although the functional
consequences resulting from the expression of these T cell
chemoattractants are not known (40).
The MIP-1 cytokines themselves are related CC-family chemokines that
display extensively overlapping biological activity (41). Both MIP-1
and MIP-1ß display chemotactic activity for macrophages, NK cells,
and dendritic cells (28, 30, 42, 43). The synthesis of MIP-1
and
MIP-1ß is associated with type 1 immune responses (44). Indeed, it
was recently reported that MIP-1
and MIP-1ß serve as
chemoattractants for Th1, but not Th2, cells (45, 46). Therefore, the
strong type 1 cytokine response induced by T. gondii would
predict the up-regulation of parasite-induced MIP-1 gene transcription,
which we report here. We are presently employing mouse model systems to
more closely examine the role of these chemokines during infection.
The role of IFN-
in neutrophil chemokine responses is complex (32, 47). Thus, the cytokine appears to display an inhibitory activity on
neutrophil MIP-1 expression, as measured by gene transcript induction
and protein expression. However, during extended incubation, IFN-
has the opposite effect, promoting neutrophil MIP-1 expression. IFN-
also appears to be a potent inhibitor of MIP-1
and MIP-1ß
expression by thioglycollate-elicited macrophages stimulated with
hyaluronan (48). In our experiments, the addition of IFN-
did not
inhibit chemokine transcript levels, and, indeed, their levels appeared
slightly augmented. Because STAg and LPS display distinct TNF-
induction patterns (e.g., Fig. 2
), it may also be that these chemokines
are regulated differently when triggered by alternate stimuli. We are
currently further examining the role of IFN-
on neutrophil chemokine
expression.
The cytokine TNF-
has previously been shown to induce the expression
of several neutrophil cytokines, including MIP-1
and IL-8 (15, 49).
We also found that TNF-
alone displayed potent MIP-1
- and
MIP-1ß-inducing activity in PMN. Our finding that STAg also induces
PMN TNF-
production raises the possibility that MIP-1 expression in
these cultures is an indirect activity of STAg resulting from
autocrine stimulation by TNF-
. Indeed, the addition of a
neutralizing anti-TNF-
antiserum blocked increases in MIP-1
and MIP-1ß gene transcript levels. Nevertheless, up-regulation of the
MIP-1 genes was never completely eliminated and it is, therefore,
possible that there remains a TNF-
-independent component to
STAg-induced MIP-1 gene induction. We are currently further examining
this issue.
Neutrophils are present in high numbers in the peripheral blood and in response to infection rapidly exit the circulation and accumulate at sites of tissue damage or infection. The finding that PMN are capable of producing several major inflammatory cytokines in response to T. gondii suggests that neutrophils may be important in directing early cell trafficking and cytokine-producing activities during infection with this microbial pathogen. Thus, a scenario that we favor is that PMN initially migrate to a focus of infection, where they are stimulated by the parasite to produce chemokines that subsequently serve an instrumental role in recruiting cells such as monocytes and dendritic cells during early infection. The activation of these cells, in turn, could be accomplished by the combined stimuli of parasites and neutrophil-derived cytokines.
| Footnotes |
|---|
2 A.J.M. and S.K.B. made equal contributions to this study. ![]()
3 Address correspondence and reprint requests to Dr. E. Denkers, Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401. E-mail address: ![]()
4 Abbreviations used in this paper: PMN, polymorphonuclear leukocyte; MIP, macrophage-inflammatory protein; STAg, soluble tachyzoite Ag. ![]()
5 S.K.B., Y.Z., and E.Y.D. Mouse neutrophils are a source of high level, IFN-
-independent IL-12 during Toxoplasma gondii infection. Submitted for publication. ![]()
Received for publication December 23, 1998. Accepted for publication March 31, 1999.
| References |
|---|
|
|
|---|
. Proc. Natl. Acad. Sci. USA 87:6758.
in response to lipopolysaccharide. J. Immunol. 150:5556.[Abstract]
. J. Exp. Med. 178:63.
by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115.
synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
and MIP-1ß. Eur. J. Immunol. 25:64.[Medline]
and MIP-1ß. Science 260:355.
modulates the expression of neutrophil-derived chemokines. J. Invest. Med. 43:58.[Medline]
inhibits the lipopolysaccharide-induced macrophage inhibitory protein-1
gene transcription in human neutrophils. Immunol. Lett. 49:79.[Medline]
mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. J. Immunol. 157:4045.[Abstract]
with patterns of tissue expression that suggest nonredundant roles in vivo. J. Immunol. 157:4511.[Abstract]
and MIP-1ß, and RANTES is associated with a type 1 immune response. J. Immunol. 157:3598.[Abstract]
interferon. Cell. Immunol. 157:448.[Medline]
induced interleukin 12 production: a potential mechanism for the anti-inflammatory activities of tumor necrosis factor. Proc. Natl. Acad. Sci. USA 95:13806.This article has been cited by other articles:
![]() |
R. Sporri, N. Joller, H. Hilbi, and A. Oxenius A Novel Role for Neutrophils As Critical Activators of NK Cells J. Immunol., November 15, 2008; 181(10): 7121 - 7130. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Flores, R. Saavedra, R. Bautista, R. Viedma, E. P. Tenorio, L. Leng, Y. Sanchez, I. Juarez, A. A. Satoskar, A. S. Shenoy, et al. Macrophage migration inhibitory factor (MIF) is critical for the host resistance against Toxoplasma gondii FASEB J, October 1, 2008; 22(10): 3661 - 3671. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. McFarlane, C. Perez, M. Charmoy, C. Allenbach, K. C. Carter, J. Alexander, and F. Tacchini-Cottier Neutrophils Contribute to Development of a Protective Immune Response during Onset of Infection with Leishmania donovani Infect. Immun., February 1, 2008; 76(2): 532 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Masek, J. Fiore, M. Leitges, S.-F. Yan, B. D. Freedman, and C. A. Hunter Host cell Ca2+ and protein kinase C regulate innate recognition of Toxoplasma gondii J. Cell Sci., November 1, 2006; 119(21): 4565 - 4573. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bennouna, W. Sukhumavasi, and E. Y. Denkers Toxoplasma gondii Inhibits Toll-Like Receptor 4 Ligand-Induced Mobilization of Intracellular Tumor Necrosis Factor Alpha to the Surface of Mouse Peritoneal Neutrophils Infect. Immun., July 1, 2006; 74(7): 4274 - 4281. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Allenbach, C. Zufferey, C. Perez, P. Launois, C. Mueller, and F. Tacchini-Cottier Macrophages Induce Neutrophil Apoptosis through Membrane TNF, a Process Amplified by Leishmania major. J. Immunol., June 1, 2006; 176(11): 6656 - 6664. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Uddin, H. H. Garcia, R. H. Gilman, A. E. Gonzalez, and J. S. Friedland Monocyte-Astrocyte Networks and the Regulation of Chemokine Secretion in Neurocysticercosis J. Immunol., September 1, 2005; 175(5): 3273 - 3281. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Robben, M. LaRegina, W. A. Kuziel, and L. D. Sibley Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis J. Exp. Med., June 6, 2005; 201(11): 1761 - 1769. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bennouna and E. Y. Denkers Microbial Antigen Triggers Rapid Mobilization of TNF-{alpha} to the Surface of Mouse Neutrophils Transforming Them into Inducers of High-Level Dendritic Cell TNF-{alpha} Production J. Immunol., April 15, 2005; 174(8): 4845 - 4851. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Del Rio, B. A. Butcher, S. Bennouna, S. Hieny, A. Sher, and E. Y. Denkers Toxoplasma gondii Triggers Myeloid Differentiation Factor 88-Dependent IL-12 and Chemokine Ligand 2 (Monocyte Chemoattractant Protein 1) Responses Using Distinct Parasite Molecules and Host Receptors J. Immunol., June 1, 2004; 172(11): 6954 - 6960. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Oktenli, L. Doganci, T. Ozgurtas, R.E. Araz, M. Tanyuksel, U. Musabak, S.Y. Sanisoglu, Z. Yesilova, M.K. Erbil, and A. Inal Transient hypogonadotrophic hypogonadism in males with acute toxoplasmosis: suppressive effect of interleukin-1{beta} on the secretion of GnRH Hum. Reprod., April 1, 2004; 19(4): 859 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Robben, D. G. Mordue, S. M. Truscott, K. Takeda, S. Akira, and L. D. Sibley Production of IL-12 by Macrophages Infected with Toxoplasma gondii Depends on the Parasite Genotype J. Immunol., March 15, 2004; 172(6): 3686 - 3694. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Gavrilescu, B. A. Butcher, L. Del Rio, G. A. Taylor, and E. Y. Denkers STAT1 Is Essential for Antimicrobial Effector Function but Dispensable for Gamma Interferon Production during Toxoplasma gondii Infection Infect. Immun., March 1, 2004; 72(3): 1257 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schroder, P. J. Hertzog, T. Ravasi, and D. A. Hume Interferon-{gamma}: an overview of signals, mechanisms and functions J. Leukoc. Biol., February 1, 2004; 75(2): 163 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bennouna, S. K. Bliss, T. J. Curiel, and E. Y. Denkers Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection J. Immunol., December 1, 2003; 171(11): 6052 - 6058. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Debierre-Grockiego, N. Azzouz, J. Schmidt, J.-F. Dubremetz, H. Geyer, R. Geyer, R. Weingart, R. R. Schmidt, and R. T. Schwarz Roles of Glycosylphosphatidylinositols of Toxoplasma gondii: INDUCTION OF TUMOR NECROSIS FACTOR-{alpha} PRODUCTION IN MACROPHAGES J. Biol. Chem., August 29, 2003; 278(35): 32987 - 32993. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Taube, A. Dakhama, Y.-H. Rha, K. Takeda, A. Joetham, J.-W. Park, A. Balhorn, T. Takai, K. R. Poch, J. A. Nick, et al. Transient Neutrophil Infiltration After Allergen Challenge Is Dependent on Specific Antibodies and Fc{gamma}III Receptors J. Immunol., April 15, 2003; 170(8): 4301 - 4309. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Channon, K. A. Miselis, L. A. Minns, C. Dutta, and L. H. Kasper Toxoplasma gondii Induces Granulocyte Colony-Stimulating Factor and Granulocyte-Macrophage Colony-Stimulating Factor Secretion by Human Fibroblasts: Implications for Neutrophil Apoptosis Infect. Immun., November 1, 2002; 70(11): 6048 - 6057. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Butcher and E. Y. Denkers Mechanism of Entry Determines the Ability of Toxoplasma gondii To Inhibit Macrophage Proinflammatory Cytokine Production Infect. Immun., September 1, 2002; 70(9): 5216 - 5224. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. N. Ellis and B. L. Beaman Murine polymorphonuclear neutrophils produce interferon-{gamma} in response to pulmonary infection with Nocardia asteroides J. Leukoc. Biol., August 1, 2002; 72(2): 373 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venuprasad, P. P. Banerjee, S. Chattopadhyay, S. Sharma, S. Pal, P. B. Parab, D. Mitra, and B. Saha Human Neutrophil-Expressed CD28 Interacts with Macrophage B7 to Induce Phosphatidylinositol 3-Kinase-Dependent IFN-{gamma} Secretion and Restriction of Leishmania Growth J. Immunol., July 15, 2002; 169(2): 920 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Leemans, M. J. B. M. Vervoordeldonk, S. Florquin, K. P. van Kessel, and T. van der Poll Differential Role of Interleukin-6 in Lung Inflammation Induced by Lipoteichoic Acid and Peptidoglycan from Staphylococcus aureus Am. J. Respir. Crit. Care Med., May 15, 2002; 165(10): 1445 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Del Rio, S. Bennouna, J. Salinas, and E. Y. Denkers CXCR2 Deficiency Confers Impaired Neutrophil Recruitment and Increased Susceptibility During Toxoplasma gondii Infection J. Immunol., December 1, 2001; 167(11): 6503 - 6509. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. I. Terrazas, K. L. Walsh, D. Piskorska, E. McGuire, and D. A. Harn Jr. The Schistosome Oligosaccharide Lacto-N-neotetraose Expands Gr1+ Cells That Secrete Anti-inflammatory Cytokines and Inhibit Proliferation of Naive CD4+ Cells: A Potential Mechanism for Immune Polarization in Helminth Infections J. Immunol., November 1, 2001; 167(9): 5294 - 5303. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Mordue, F. Monroy, M. La Regina, C. A. Dinarello, and L. D. Sibley Acute Toxoplasmosis Leads to Lethal Overproduction of Th1 Cytokines J. Immunol., October 15, 2001; 167(8): 4574 - 4584. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Butcher, L. Kim, P. F. Johnson, and E. Y. Denkers Toxoplasma gondii Tachyzoites Inhibit Proinflammatory Cytokine Induction in Infected Macrophages by Preventing Nuclear Translocation of the Transcription Factor NF-{kappa}B J. Immunol., August 15, 2001; 167(4): 2193 - 2201. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Bliss, L. C. Gavrilescu, A. Alcaraz, and E. Y. Denkers Neutrophil Depletion during Toxoplasma gondii Infection Leads to Impaired Immunity and Lethal Systemic Pathology Infect. Immun., August 1, 2001; 69(8): 4898 - 4905. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Hall, E. Diaconu, and E. Pearlman A Dominant Role for Fc{{gamma}} Receptors in Antibody-Dependent Corneal Inflammation J. Immunol., July 15, 2001; 167(2): 919 - 925. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tateda, T. A. Moore, M. W. Newstead, W. C. Tsai, X. Zeng, J. C. Deng, G. Chen, R. Reddy, K. Yamaguchi, and T. J. Standiford Chemokine-Dependent Neutrophil Recruitment in a Murine Model of Legionella Pneumonia: Potential Role of Neutrophils as Immunoregulatory Cells Infect. Immun., April 1, 2001; 69(4): 2017 - 2024. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Hall, E. Diaconu, R. Patel, and E. Pearlman CXC Chemokine Receptor 2 But Not C-C Chemokine Receptor 1 Expression Is Essential for Neutrophil Recruitment to the Cornea in Helminth-Mediated Keratitis (River Blindness) J. Immunol., March 15, 2001; 166(6): 4035 - 4041. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Khan, P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, and G. R. Yeaman Mice Lacking the Chemokine Receptor CCR1 Show Increased Susceptibility to Toxoplasma gondii Infection J. Immunol., February 1, 2001; 166(3): 1930 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Lapinet, P. Scapini, F. Calzetti, O. Perez, and M. A. Cassatella Gene Expression and Production of Tumor Necrosis Factor Alpha, Interleukin-1beta (IL-1beta ), IL-8, Macrophage Inflammatory Protein 1alpha (MIP-1alpha ), MIP-1beta , and Gamma Interferon-Inducible Protein 10 by Human Neutrophils Stimulated with Group B Meningococcal Outer Membrane Vesicles Infect. Immun., December 1, 2000; 68(12): 6917 - 6923. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Smith, Y. Zhang, W. D. Grafton, S. R. Jennings, and D. J. O'Callaghan Severe Murine Lung Immunopathology Elicited by the Pathogenic Equine Herpesvirus 1 Strain RacL11 Correlates with Early Production of Macrophage Inflammatory Proteins 1alpha , 1beta , and 2 and Tumor Necrosis Factor Alpha J. Virol., November 1, 2000; 74(21): 10034 - 10040. [Abstract] [Full Text] |
||||
![]() |
S. K. Bliss, B. A. Butcher, and E. Y. Denkers Rapid Recruitment of Neutrophils Containing Prestored IL-12 During Microbial Infection J. Immunol., October 15, 2000; 165(8): 4515 - 4521. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Tacchini-Cottier, C. Zweifel, Y. Belkaid, C. Mukankundiye, M. Vasei, P. Launois, G. Milon, and J. A. Louis An Immunomodulatory Function for Neutrophils During the Induction of a CD4+ Th2 Response in BALB/c Mice Infected with Leishmania major J. Immunol., September 1, 2000; 165(5): 2628 - 2636. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Brandt, G. Woerly, A. B. Younes, S. Loiseau, and M. Capron IL-4 production by human polymorphonuclear neutrophils J. Leukoc. Biol., July 1, 2000; 68(1): 125 - 130. [Abstract] [Full Text] |
||||
![]() |
M. C. Bosco, A. Rapisarda, S. Massazza, G. Melillo, H. Young, and L. Varesio The Tryptophan Catabolite Picolinic Acid Selectively Induces the Chemokines Macrophage Inflammatory Protein-1{alpha} and -1{beta} in Macrophages J. Immunol., March 15, 2000; 164(6): 3283 - 3291. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pedrosa, B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, and A. M. Cooper Neutrophils Play a Protective Nonphagocytic Role in Systemic Mycobacterium tuberculosis Infection of Mice Infect. Immun., February 1, 2000; 68(2): 577 - 583. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |