| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Virology, National Public Health Institute, Helsinki, Finland; and
Fujisaki Institute, Hayashibara Biochemical Laboratories, Okayama, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß, and
TNF- gene expression and protein production in human primary
monocytes and GM-CSF-differentiated macrophages during influenza A and
Sendai virus infections. Virus-infected monocytes released only small
amounts of IL-1ß or IL-18 protein, whereas 7- and 14-day-old
GM-CSF-differentiated macrophages readily produced these cytokines.
Constitutive expression of proIL-18 was seen in monocytes and
macrophages, and the expression of it was enhanced during
monocyte/macrophage differentiation. Expression of IL-18 mRNA was
clearly induced only by Sendai virus, whereas both influenza A and
Sendai viruses induced IL-1ß mRNA expression. Since caspase-1 is
known to cleave proIL-1ß and proIL-18 into their mature, active
forms, we analyzed the effect of a specific caspase-1 inhibitor on
virus-induced IL-1ß and IL-18 production. The release of IL-1ß and
IL-18, but not that of IFN-/ß or TNF-, was clearly blocked by
the inhibitor. Our results suggest that the cellular differentiation is
a crucial factor that affects the capacity of monocytes/macrophages to
produce IL-1ß and IL-18 in response to virus infections. Furthermore,
the virus-induced activation of caspase-1 is required for the efficient
production of biologically active IL-1ß and
IL-18. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
for IL-12 (2)
and IFN- production (3) is also more pronounced in macrophages than
in monocytes. The differentiation of monocytes into macrophages may
also result in enhanced production of IL-1ß (4, 5).
In addition to IFN-/ß, IL-1ß, and IL-12, activated macrophages
produce IL-18 in response to microbial infections (6, 7, 8). IL-18
(IFN--inducing factor) is a recently identified cytokine with
multiple biological functions. IL-18 promotes cell-mediated immunity by
activating NK and Th1-type cells (9, 10). IL-18 also induces IFN-,
GM-CSF, and IL-2R expression in T cells (6, 7, 11) and decreases the
production of IL-10 (7). IL-18 acts synergistically with IL-12 and
IFN- in enhancing IFN- gene expression (6, 8, 11). Although IL-18
shares no significant sequence homology with any other cytokine, it is,
based on molecular modeling, structurally related to IL-1 family of
proteins (13). In addition, IL-1R-related protein functions as an
IL-18R (14). Precursor forms of IL-18 and IL-1ß lack a signal peptide
and they require cleavage by caspase-1 (IL-1ß-converting enzyme) for
their maturation, and hence for their biological activity (15, 16, 17, 18).
However, it is presently not known whether IL-18 gene expression and
protein secretion during microbial infections are regulated in a
similar way as that of IL-1ß.
To define the role of IL-18 in viral infections, we have analyzed the
gene expression and protein production of IL-18, IL-1ß, IFN-, and
TNF- in primary human monocytes and macrophages during influenza A
and Sendai virus infections. We demonstrate that both viruses enhance
the secretion of cytokines, and in the case of IL-1ß and IL-18, the
differentiation of monocytes into macrophages is an essential factor
for their production. Furthermore, we show that virus-induced IL-1ß
and IL-18 secretion from macrophages are dependent on caspase-1
activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human monocytes/macrophages were obtained from leukocyte-rich buffy coats of healthy blood donors (The Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). Cells in fresh, single buffy coats were fractionated by centrifugation on Ficoll-Paque gradient (Pharmacia Biotech, Uppsala, Sweden), and blood mononuclear cells (2 x 107 cells/well) were allowed to adhere onto six-well plates (Falcon Multiwell; Becton Dickinson, Franklin Lakes, NJ) for 1 h in serum-free RPMI 1640 medium supplemented with 20 mM HEPES, 2 mM glutamine, 0.6 µg/ml penicillin, and 60 µg/ml streptomycin. Plastic-adhered monocytes were washed with PBS, and the cells were grown in macrophage SFM medium (Life Technologies, Gaithersburg, MD) lacking GM-CSF. Alternatively, monocytes were differentiated into macrophages by culturing them in SFM medium supplemented with antibiotics and GM-CSF (10 ng/ml; Schering-Plough, Innishannon, Ireland). Medium in the macrophage plates was replaced every 2 days, and the cells were used in experiments at 7 or 14 days after cultivation. Monocytes were used at the next day after their isolation. In experiments in which the effect of GM-CSF-induced cell differentation was studied more closely, GM-CSF-containing cell culture medium was refreshed every day, and monocytes/macrophages were harvested after 1, 2, 3, 5, and 7 days of culturing. The isolated cells were identified as monocytes or macrophages by their typical morphology and CD14 expression (flow-cytometric analysis; anti-CD14 FITC mAb; Becton Dickinson, Mountain View, CA). The purity of monocyte and macrophage cultures was practically 100% based on flow-cytometric analysis (3, 19).
Virus stocks and infections
Human pathogenic influenza virus (strain A/Beijing/353/89 H3N2) originates from the National Institute of Medical Research (London, U.K.), and the murine Sendai virus (strain Cantell) is from the National Public Health Institute (Helsinki, Finland). Both viruses were cultured in embryonated hen eggs and stored at -70°C (20, 21). The hemagglutination titer of influenza A and Sendai viruses was 128 and 6000, respectively, as measured by standard methods (22, 23). In infection experiments, virus doses of 12.8 and 150 hemagglutination U/ml, respectively, were used. In each experiment, monocytes and macrophages of six blood donors were separately infected in 2 ml of medium (RPMI 1640 supplemented with 10% FCS) per well. After 1 h of virus adsorption, virus inoculum was removed by washing with PBS, and fresh medium was added. The cells and cell culture supernatants were collected at different time points after infection, and samples from different donors were pooled.
Biological assay for IFN-/ß
Cell culture supernatants were treated at pH 2 and assayed for
the presence of IFN-/ß in Hep2 cells by vesicular stomatitis virus
plaque reduction (24). The results are expressed as IU/ml, using an
international control IFN- preparation as a standard.
Cytokine ELISAs
The amounts of IL-1ß, IL-18, TNF-, and IFN- in culture
supernatants were determined by specific ELISAs. IL-1ß ELISA kit was
purchased from AMS Biotechnology AB (Täby, Sweden), IL-18 ELISA
from Fujisaki Institute, Hayashibara Biochemical Laboratories (Okayama,
Japan) (25), and TNF- and IFN- ELISAs from R&D Systems (Abingdon,
U.K.).
Caspase-1 inhibition
Seven- or 14-day macrophages were left untreated or pretreated
for 30 min with 10 or 50 µM caspase-1 inhibitor peptide Ac-YVAD-CHO
(Bachem, Bubendorf, Switzerland) and sequentially infected with
influenza A or Sendai virus in the presence of the inhibitor. The cell
culture supernatants were collected 24 h after virus infection,
and the amounts of IL-1ß, IL-18, IFN-, and TNF- in supernatants
were measured.
RNA isolation and Northern blot analysis
Total cellular RNA of monocytes and macrophages was isolated by
guanidium isothiocyanate lysis, followed by centrifugation through a
CsCl cushion (26, 27). The amount of RNA in samples was quantified
photometrically, and equal amounts of RNA (20 µg) were size
fractionated on 1% formaldehyde-agarose gels and transferred to
Hybond-N membranes (Amersham, Buckinghamshire, U.K.). Four identical
filters were hybridized with human TNF- (American Type Culture
Collection (ATCC), Manassas, VA), IL-1ß (DNAX Research Institute,
Palo Alto, CA), IL-18 (7), or caspase-1 (dbEST Id:103307) cDNA probes.
The probes were labeled with [-32P]dCTP (3000 Ci/mmol;
Amersham) by a random-primed DNA labeling kit purchased from Boehringer
Mannheim (Mannheim, Germany). Hybridizations were performed at 42°C
in a solution containing 50% formamide, 5x Denhardt’s solution, 5x
SSPE, and 0.5% SDS. Filters were washed twice with 1x SSC
supplemented with 0.1% SDS at room temperature and once at 60°C for
30 min. The filters were exposed to Kodak AR X-Omat films (Eastman
Kodak, Rochester, NY) at -70°C in intensifying screens. For
controlling equal RNA loading, rRNA bands were visualized by EtBr
staining.
Anti-IL-18 Ab for Western blotting
The coding sequence of proIL-18 was obtained from the plasmid pHUGFR50-1 (7) by PCR using Taq DNA polymerase (Promega, Madison, WI) and oligonucleotide-containing BamHI sites in the 5' chain (TCGCAGGATCCAAGATGGCTGCTGAACCAG) and in the 3' chain (TGAAAGGATCCTAGCTAGTCTTCGTTTTGA). The amplified fragment of proIL-18 was ligated into BamHI site of the pGEM-3zf(+) vector (Promega). After sequence analysis, the proIL-18 insert was subcloned into the pGEX-2T vector (Pharmacia Biotech). ProIL-18 was expressed in Escherichia coli B strain BL21(DE3) as a glutathione S-transferase fusion protein and purified in a preparative SDS-PAGE (Prep-Cell; Bio-Rad Laboratories, Richmond, CA). Purified fusion protein was used to immunize guinea pigs with three injections (20 µg/injection) at 0, 2, and 6 wk, and the animals were bled 1 wk after the last injection. By using recombinant E. coli proIL-18 and IL-18 (25) as controls, it was confirmed that the produced anti-IL-18 Ab recognizes both precursor and mature forms of IL-18 (data not shown).
Western blot analysis
Western blot samples from virus-infected monocytes and macrophages were separated (30 µg of protein/lane) on 8%, 10%, 12%, or 15% SDS-PAGE with the Laemmli buffer system (28). Proteins separated on gels were transferred onto Immobilon-P membranes (Millipore, Bedford, MA) with an Isophor electrotransfer apparatus (Hoeffer Scientific Instruments, San Francisco, CA) at 200 mA for 2 h. The membranes were blocked with PBS containing 5% nonfat milk. The blots were stained for 1 h at room temperature with primary Abs, rabbit anti-influenza A nucleoprotein (1:1000) (20) or rabbit anti-parainfluenza 1 (1:500) (29), following secondary staining (1 h at room temperature) with peroxidase-conjugated goat anti-rabbit IgG (Bio-Rad). Alternatively, the blots were sequentially stained with guinea pig anti-human IL-18 or rabbit anti-human caspase-1 (Santa Cruz Biotechnology, Santa Cruz, CA), goat anti-guinea pig IgG F(ab')2-biotin-SP (Jackson ImmunoResearch, West Growe, PA) or anti-rabbit IgG F(ab')2-biotin-SP (Jackson ImmunoResearch), and streptavidin-peroxidase conjugate (Jackson ImmunoResearch). The protein bands in filters were visualized by the ECL chemoluminescence system (Amersham).
IL-18 bioassay
The biological activity of macrophage-derived IL-18 was measured
by IFN- production in KG-1 cells (ATCC CCL-246) (30). Cell culture
supernatants from virus-infected monocytes and 7- or 14-day macrophages
were incubated with KG-1 cells (3 x 106 cells/ml) in
24-well cell culture plates (Falcon Multiwell; Becton Dickinson). After
24-h incubation, KG-1 cell supernatants were collected, and the amount
of IFN- in supernatants was determined by ELISA. A possible
synergistic action of IL-18 and other virus-induced cytokines was
tested by adding known quantities of human rIL-18 (Hayashibara
Biochemical Laboratories, Okayama, Japan) to the caspase-1
inhibitor-treated, virus-infected macrophage supernatants and comparing
their activity to generate IFN- with that of IL-18 alone.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have demonstrated previously that virus infection induces
cytokine secretion in human 7-day-old macrophages (8, 19). Now we have
studied the kinetics and mechanism of cytokine secretion in influenza A
and Sendai virus-infected human monocytes and mature 7- or 14-day
macrophages. Cytokines secreted by virus-infected cells were measured
either by specific ELISAs (IL-1ß, IL-18, and TNF-) or by a
biological assay (IFN-/ß). Fig. 1
shows that only 14-day macrophages were able to secrete significant
amounts of IL-1ß and IL-18 proteins in response to influenza A or
Sendai virus infections. Sendai virus was a stronger inducer of IL-1ß
production compared with influenza A virus, whereas in the case of
IL-18 secretion the situation was the opposite. After 24 h of
Sendai virus infection, 14-day macrophages released up to 1400 pg/ml of
IL-1ß and less than 200 pg/ml of IL-18. Influenza A-infected
macrophages, however, produced only 300 pg/ml of IL-ß and as much as
800 pg/ml of IL-18. Quite opposite to 14-day macrophages, 7-day
macrophages and especially monocytes were poor producers of IL-1ß and
IL-18 protein. In contrast to IL-1ß and IL-18, monocytes and
macrophages readily produced IFN- and TNF- in response to both
virus infections (Fig. 2). Sendai virus
was a more potent inducer of IFN-/ß and TNF- protein secretion
than influenza A virus in all three cell types (Fig. 2).
|
|
A). Sendai virus proteins
started to accumulate at 3 h after infection, and the production
of viral proteins was similar in monocytes and macrophages (Fig. 3B). Flow-cytometric analysis confirmed that 95–99% of the
cells were infected with the virus doses used in the experiments (data
not shown). Consequently, both monocytes and differentiated macrophages
were prone to influenza and Sendai virus infections, and viral protein
expression preceded the release of cytokines (compare with Figs. 1
, 2, and 3).
|
The preceding data imply that the stage of monocyte/macrophage
differentiation affects their capacity to produce cytokines. Therefore,
we studied the effect of GM-CSF-induced differentiation on cytokine
mRNA expression in monocytes and macrophages. Monocytes were
differentiated into macrophages in the presence of GM-CSF, and total
cellular RNA was isolated after 1, 2, 3, 5, and 7 days of culturing.
Likewise, RNA was collected from cells that were grown for 1 and 3 days
without a GM-CSF stimulation. Monocytes that were stimulated for 1 day
with GM-CSF expressed higher levels of IL-1ß mRNA than unstimulated
monocytes (Fig. 4A). This
suggests that GM-CSF can directly enhance the expression of IL-1ß
gene. However, IL-1ß mRNA levels declined when monocytes
differentiated into macrophages in the presence of GM-CSF, and mRNAs
finally became undetectable after 7-day culturing. In contrast, the
intensity of two IL-18 mRNA bands, which were already seen in
monocytes, decreased only slightly during the GM-CSF-induced
differentiation (Fig. 4A). A third, short form of IL-18 mRNA
emerged after culturing the cells for 3 days with GM-CSF. It is likely
that all three bands represent different forms of IL-18 mRNAs, since
hybridizations were done under stringent conditions.
|
A). ProIL-18 protein production is induced when monocytes differentiate into macrophages
Monocytes expressed basally IL-18 mRNA, and the prolonged
culturing of them resulted in the emergence of a new IL-18 mRNA species
(Fig. 4A). Therefore, we studied intracellular IL-18 protein
expression during monocyte/macrophage differentiation by Western
blotting. Monocytes expressed basally 24-kDa proIL-18 protein, and the
expression gradually increased as monocytes differentiated into
macrophages (Fig. 4B). Macrophages showed high expression
level of proIL-18, but the expression of mature, 18-kDa form of IL-18
was undetectable. Hence, it is likely that GM-CSF-induced
differentiation alone is not sufficient to stimulate the production of
mature IL-18. Caspase-1 was expressed in its 45-kDa proform both
in monocytes and macrophages. As the monocytic differentiation
proceeded, 30-kDa intermediate form of caspase-1 also became
detectable, but mature caspase-1 was not seen (Fig. 4B).
Kinetics of TNF-, IL-1ß, IL-18, and caspase-1 gene expression
in virus-infected monocytes and macrophages
To study virus-induced transcriptional activation of cytokine
genes in monocytes and macrophages, we conducted Northern blot analyses
of RNAs isolated from virus-infected cells. In freshly isolated
monocytes, TNF- and IL-1ß mRNA expression was induced by both
influenza A and Sendai viruses (Fig. 5).
In influenza A virus-infected monocytes, IL-1ß and TNF- mRNA
expression was induced rapidly, and the highest mRNA levels were
detected at 3 h after infection (Fig. 5). Sendai virus induced,
compared with influenza A virus, much stronger IL-1ß and TNF- mRNA
expression, which peaked at 6 h after infection (Fig. 5). Similar
results were seen in 7-day (Fig. 6) and
14-day macrophages (data not shown). Sendai virus infection was also
able to enhance IL-18 mRNA expression in monocytes as well as in
macrophages, whereas such induction was not seen in influenza
A-infected cells (Figs. 5 and 6). Consistent with the differentiation
data (Fig. 4A), monocytes expressed two and
macrophages three IL-18-specific mRNA species. Caspase-1 mRNA
expression was enhanced during viral infections both in monocytes (Fig. 5) and macrophages (Fig. 6).
|
|
In vitro analyses have shown that caspase-1 processes proIL-1ß
and proIL-18 into their mature active forms (15, 16, 17, 18). To test whether
caspase-1 activation is involved in the release of IL-1ß and IL-18
during virus infection, we used a caspase-1-specific inhibitor, peptide
Ac-YVAD-CHO. Fourteen-day-old macrophages were infected with influenza
A or Sendai viruses in the presence or absence of the inhibitor.
Virus-induced IL-1ß and IL-18 protein production was dose dependently
inhibited by the caspase-1 inhibitor, whereas the release of
IFN-/ß and TNF- remained unaffected (Fig. 7).
|
We confirmed the biological activity of the virus-induced IL-18 by
analyzing its ability to enhance IFN- production in KG-1 cells.
IL-18-containing supernatants from the Sendai and influenza A
virus-infected macrophages induced IFN- production in KG-1 cells,
whereas supernatants from caspase-1 inhibitor-treated and
virus-infected cells showed marginal IFN--inducing activity (Fig. 8). This is an indication of biological
activity of IL-18, since the inhibitor reduced IL-18 production in
macrophages (Fig. 7). Supernatants from Sendai virus-infected
macrophages induced more IFN- than those of influenza A-infected
cells, even though Sendai virus was a weaker inducer of IL-18 release
in macrophages (Fig. 1). This suggests that during Sendai virus
infection, macrophages release other factor(s) that may act
synergistically with IL-18 to enhance IFN- production. The possible
synergy was studied by adding IL-18 into macrophage supernatants.
Supernatants from caspase-1 inhibitor-treated and virus-infected cells
together with exogenous IL-18 induced much stronger IFN- production
than same IL-18 amount alone (Fig. 8). In fact, exogenous IL-18
restored the IFN--inducing activity that virus-infected macrophages
have without caspase-1 inhibitor treatment, indicating that IL-18’s
mode of action is synergistic with other virus-induced factors.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and IFN regulatory factors (19, 31, 32, 33, 34). Activated transcription factors turn on the transcription of
several cytokine genes. Most cytokines are transcriptionally regulated,
but certain cytokines, such as IL-1ß, are regulated also at a
posttranscriptional level. IL-1ß mRNA expression is induced in viral
infections (35; this work, Figs. 5 and 6), but transcriptional
activation alone is not sufficient for efficient production of
functional IL-1ß protein. IL-1ß is synthesized as an inactive
precursor protein that requires cleavage by caspase-1 to become a
biologically active molecule (15, 16). Similarly to IL-1ß, activated
caspase-1 cleaves proIL-18 to its mature, active form (17, 18).
However, unlike IL-1ß, IL-18 mRNA is constitutively expressed in
several cell types (6, 7, 36, 37, 38, 39). This implies that there may be a
major difference in the regulation of IL-1ß and IL-18 production.
To characterize in more detail the regulation of IL-1ß and IL-18 gene
expression and protein production during viral infections, we used an
in vitro monocyte/macrophage infection model. The model provides the
means to study the cytokine response of human blood monocytic cells
during their distinct differentiation stages. Indeed, in this study, it
is shown that the cytokine production profile of the cells changes as
they differentiate from monocytes into macrophages. Monocytes were
extremely poor producers of IL-1ß and IL-18 proteins, whereas
macrophages efficiently secreted these cytokines in response to
influenza A and Sendai virus infections (Fig. 1). In contrast to
IL-1ß and IL-18, both monocytes and differentiated macrophages
readily produced IFN-/ß and TNF- (Fig. 2). The observed high
IFN-/ß and TNF- production levels from both monocytes and
macrophages are consistent with other studies (3, 8, 19, 35, 40), while
IL-1ß responses are significantly higher than reported earlier in
virus-infected monocytic cells (35). In that study, however, the poorly
responding cells were monocytes rather than mature macrophages. Our
data indicate that the terminal differentiation of monocytes into
macrophages is necessary for a high IL-1ß and IL-18 protein
production in response to virus infection.
Different capacity of monocytes and macrophages to produce IL-1ß and
IL-18 is not likely due to their different susceptibility to virus
infections. In fact, both cell types were infected by influenza A and
Sendai viruses with indistinguishable efficiency and kinetics (Fig. 3).
Furthermore, Sendai virus infection induced a clear IL-1ß and IL-18
mRNA expression both in monocytes and macrophages (Figs. 5 and 6),
although only macrophages effectively secreted IL-1ß and IL-18.
Caspase-1 mRNA expression, too, was induced as well in monocytes as
macrophages during virus infection (Figs. 5 and 6). This suggests that
in macrophages there are additional regulatory mechanisms for IL-1ß
and IL-18 secretion that are absent or not turned on in virus-infected
monocytes.
Dissimilar activation of caspase-1 in monocytes and macrophages during
virus infection would partly explain their different capacity to
produce IL-1ß and IL-18. The production of IL-1ß and IL-18 proteins
was evidently dependent on the activation of caspase-1 pathway, since
caspase-1-specific inhibitor clearly and dose dependently blocked
virus-induced IL-1ß and IL-18 secretion from macrophages (Fig. 7).
The molecular mechanisms of caspase-1 activation in virus infections
are still unknown, and this definitely warrants further investigation.
Although the production of IL-1ß and IL-18 was similarly inhibited by
caspase-1 inhibitor, they are apparently regulated in a different way
during virus infections. IL-1ß mRNA was not constitutively expressed
in monocytic cells, while IL-18 mRNA showed basal expression both in
monocytes and macrophages (Figs. 5 and 6). Therefore, effective IL-1ß
secretion requires both activation of IL-1ß gene transcription and
subsequent proteolytic cleavage of newly synthesized proIL-1ß by
caspase-1. IL-18 mRNA expression, in contrast to IL-1ß, was
accompanied by a basal expression of the precursor protein. Thus, virus
infection could induce the expression of mature IL-18 protein by
increasing cleavage of proIL-18, and transcriptional activation of
IL-18 would not be necessary. Interestingly, the basal proIL-18 protein
expression was higher in macrophages than in monocytes (Fig. 4B). The preexisting higher proIL-18 level in mature
macrophages could explain their enhanced IL-18 secretion during virus
infections. However, it is conceivable that the efficient secretion of
mature IL-18 is also due to augmented caspase-1 activation in
macrophages. Basal caspase-1 mRNA expression increased when monocytes
differentiated into macrophages (Fig. 4A), but the mature
form of caspase-1 protein was not detectable (Fig. 4B).
Thus, it is possible that mature macrophages are more sensitive to
virus-induced caspase-1 activation than undifferentiated monocytes.
However, the amount of activated endogenous caspase-1 may be one of the
limiting factors in IL-1ß and IL-18 secretion.
IL-18, which macrophages released during virus infections, proved to be
biologically active. Supernatants from virus-infected macrophages
enhanced IFN- production in KG-1 cells, while supernatants from
caspase-1 inhibitor-treated and virus-infected macrophages showed
marginal IFN--inducing activity (Fig. 8). This confirms that the
induction of IFN- in KG-1 cells is due to biological activity of
IL-18, since in the inhibitor-treated and virus-infected macrophages
IL-18 production was significantly reduced (Fig. 7). In addition, IL-18
acts synergistically with other virus-induced factor(s) because
IL-18-containing supernatants from virus-infected macrophages induce
more IFN- from KG-1 cells than corresponding amount of pure IL-18
(Fig. 8).
In this study, we show that viral infection is able to induce the production of biologically active IL-18 in human macrophages. Virus-induced IL-18 release was, similarly to that of IL-1ß, dependent on proteolytic cleavage of its proform by caspase-1. The production of IL-18 and IL-1ß also depended on the stage of monocytic differentiation, since only mature macrophages could efficiently secrete these cytokines. The capability of macrophages to produce IL-18 emphasizes their importance in cell-mediated immunity. Studies with IL-18-deficient mice have shown that IL-18 is essential for the development of Th1-type immune response and NK cell activity (41). Consequently, our results imply that macrophage-derived IL-18 has a crucial role in host’s defense against viral infections.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jaana Pirhonen, Department of Virology, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail address:
Received for publication October 27, 1998. Accepted for publication March 22, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and M-CSF. J. Leukocyte Biol. 50:35.[Abstract]
enhances production of IFN- in human macrophages but not in monocytes. J. Interferon Cytokine Res. 16:461.[Medline]
interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
-inducing factor, expression in Escherichia coli and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
/ß and IL-18 synergistically enhance IFN- gene expression in human T cells. J. Immunol. 160:6032. inducing factor. J. Leukocyte Biol. 63:658.[Abstract]
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon- production. Eur. J. Immunol. 26:1647.[Medline]
-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
inducing factor mediated by interleukin-1ß converting enzyme. Science 275:206.-inducing factor and regulators LPS-induced IFN- production. Nature 336:619.
/ß, MxA, 2',5'-oligoadenylate synthetase, and HLA gene expression in influenza A-infected human lung epithelial cells. J. Immunol. 158:2363.[Abstract]
, IFN-, MxA, and IFN regulatory factor 1 genes in influenza A-infected human peripheral blood mononuclear cells. J. Immunol. 154:2764.[Abstract]
interferon in uninduced human leukocyte suspensions. J. Interferon Res. 11:231.[Medline]
-inducing factor (IGIF) monoclonal antibodies and their application in the measurement of human IL-18 by ELISA. J. Immunol. Methods 206:107.[Medline]
-inducing factor using human myelomonocytic KG-1 cells. J. Immunol. Methods 209:187.[Medline]
B. J. Virol. 69:1480.[Abstract]
inducing factor in the adrenal cortex. J. Biol. Chem. 272:2035. inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon- to inhibit osteoclast formation. J. Exp. Med. 156:4274.
B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Medline]
inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:298.[Abstract]
production in influenza A virus-infected macrophages and potentiating effect of lipopolysaccharides. J. Immunol. 145:1921.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  P. Kankkunen, J. Rintahaka, A. Aalto, M. Leino, M.-L. Majuri, H. Alenius, H. Wolff, and S. Matikainen Trichothecene Mycotoxins Activate Inflammatory Response in Human Macrophages J. Immunol., May 15, 2009; 182(10): 6418 - 6425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ohman, J. Rintahaka, N. Kalkkinen, S. Matikainen, and T. A. Nyman Actin and RIG-I/MAVS Signaling Components Translocate to Mitochondria upon Influenza A Virus Infection of Human Primary Macrophages J. Immunol., May 1, 2009; 182(9): 5682 - 5692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Mikkelsen, S. B. Jensen, S. Chiliveru, J. Melchjorsen, I. Julkunen, M. Gaestel, J. S. C. Arthur, R. A. Flavell, S. Ghosh, and S. R. Paludan RIG-I-mediated Activation of p38 MAPK Is Essential for Viral Induction of Interferon and Activation of Dendritic Cells: DEPENDENCE ON TRAF2 AND TAK1 J. Biol. Chem., April 17, 2009; 284(16): 10774 - 10782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ichinohe, H. K. Lee, Y. Ogura, R. Flavell, and A. Iwasaki Inflammasome recognition of influenza virus is essential for adaptive immune responses J. Exp. Med., January 16, 2009; 206(1): 79 - 87. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Wang and Q. Tong Transcription factor PU.1 is expressed in white adipose and inhibits adipocyte differentiation Am J Physiol Cell Physiol, July 1, 2008; 295(1): C213 - C220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Y. Lam, J. W. Tang, A. C. M. Yeung, L. C. M. Chiu, J. J. Y. Sung, and P. K. S. Chan Avian Influenza Virus A/HK/483/97(H5N1) NS1 Protein Induces Apoptosis in Human Airway Epithelial Cells J. Virol., March 15, 2008; 82(6): 2741 - 2751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Rintahaka, D. Wiik, P. E. Kovanen, H. Alenius, and S. Matikainen Cytosolic Antiviral RNA Recognition Pathway Activates Caspases 1 and 3 J. Immunol., February 1, 2008; 180(3): 1749 - 1757. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Neff-LaFord, S. Teske, T. P. Bushnell, and B. P. Lawrence Aryl Hydrocarbon Receptor Activation during Influenza Virus Infection Unveils a Novel Pathway of IFN-{gamma} Production by Phagocytic Cells J. Immunol., July 1, 2007; 179(1): 247 - 255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-D. Kanneganti, M. Body-Malapel, A. Amer, J.-H. Park, J. Whitfield, L. Franchi, Z. F. Taraporewala, D. Miller, J. T. Patton, N. Inohara, et al. Critical Role for Cryopyrin/Nalp3 in Activation of Caspase-1 in Response to Viral Infection and Double-stranded RNA J. Biol. Chem., December 1, 2006; 281(48): 36560 - 36568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Laza-Stanca, L. A. Stanciu, S. D. Message, M. R. Edwards, J. E. Gern, and S. L. Johnston Rhinovirus Replication in Human Macrophages Induces NF-{kappa}B-Dependent Tumor Necrosis Factor Alpha Production. J. Virol., August 1, 2006; 80(16): 8248 - 8258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ank, H. West, C. Bartholdy, K. Eriksson, A. R. Thomsen, and S. R. Paludan Lambda Interferon (IFN-{lambda}), a Type III IFN, Is Induced by Viruses and IFNs and Displays Potent Antiviral Activity against Select Virus Infections In Vivo J. Virol., May 1, 2006; 80(9): 4501 - 4509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Melchjorsen, J. Siren, I. Julkunen, S. R. Paludan, and S. Matikainen Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-{kappa}B and IRF-3. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1099 - 1108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al. Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression. J. Virol., April 1, 2006; 80(7): 3515 - 3522. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ziegler, S. Matikainen, E. Ronkko, P. Osterlund, M. Sillanpaa, J. Siren, R. Fagerlund, M. Immonen, K. Melen, and I. Julkunen Severe Acute Respiratory Syndrome Coronavirus Fails To Activate Cytokine-Mediated Innate Immune Responses in Cultured Human Monocyte-Derived Dendritic Cells J. Virol., November 1, 2005; 79(21): 13800 - 13805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Melchjorsen, S. B. Jensen, L. Malmgaard, S. B. Rasmussen, F. Weber, A. G. Bowie, S. Matikainen, and S. R. Paludan Activation of Innate Defense against a Paramyxovirus Is Mediated by RIG-I and TLR7 and TLR8 in a Cell-Type-Specific Manner J. Virol., October 15, 2005; 79(20): 12944 - 12951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. E. Pietila, V. Veckman, P. Kyllonen, K. Lahteenmaki, T. K. Korhonen, and I. Julkunen Activation, cytokine production, and intracellular survival of bacteria in Salmonella-infected human monocyte-derived macrophages and dendritic cells J. Leukoc. Biol., October 1, 2005; 78(4): 909 - 920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells J. Virol., August 1, 2005; 79(15): 9608 - 9617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Holtzman, J. W. Tyner, E. Y. Kim, M. S. Lo, A. C. Patel, L. P. Shornick, E. Agapov, and Y. Zhang Acute and Chronic Airway Responses to Viral Infection: Implications for Asthma and Chronic Obstructive Pulmonary Disease Proceedings of the ATS, August 1, 2005; 2(2): 132 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Caligiuri, S. Kaveri, and A. Nicoletti When Interleukin-18 Conducts, the Preludio Sounds the Same no Matter Who Plays Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 655 - 657. [Full Text] [PDF]
|
|
|
|
|
|
J. Siren, J. Pirhonen, I. Julkunen, and S. Matikainen IFN-{alpha} Regulates TLR-Dependent Gene Expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 J. Immunol., February 15, 2005; 174(4): 1932 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stasakova, B. Ferko, C. Kittel, S. Sereinig, J. Romanova, H. Katinger, and A. Egorov Influenza A mutant viruses with altered NS1 protein function provoke caspase-1 activation in primary human macrophages, resulting in fast apoptosis and release of high levels of interleukins 1{beta} and 18 J. Gen. Virol., January 1, 2005; 86(1): 185 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Siren, T. Sareneva, J. Pirhonen, M. Strengell, V. Veckman, I. Julkunen, and S. Matikainen Cytokine and contact-dependent activation of natural killer cells by influenza A or Sendai virus-infected macrophages J. Gen. Virol., August 1, 2004; 85(8): 2357 - 2364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Veckman, M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, and I. Julkunen Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce maturation and production of Th1-type cytokines and chemokines in human monocyte-derived dendritic cells J. Leukoc. Biol., May 1, 2004; 75(5): 764 - 771. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. Ng, C. W.K. Lam, A. M. Li, C. K. Wong, F. W.T. Cheng, T. F. Leung, E. K.L. Hon, I. H.S. Chan, C. K. Li, K. S.C. Fung, et al. Inflammatory Cytokine Profile in Children With Severe Acute Respiratory Syndrome Pediatrics, January 1, 2004; 113(1): e7 - 14. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Azam, D. Novick, P. Bufler, D.-Y. Yoon, M. Rubinstein, C. A. Dinarello, and S. H. Kim Identification of a Critical Ig-Like Domain in IL-18 Receptor {alpha} and Characterization of a Functional IL-18 Receptor Complex J. Immunol., December 15, 2003; 171(12): 6574 - 6580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. W. A. Brydon, H. Smith, and C. Sweet Influenza A virus-induced apoptosis in bronchiolar epithelial (NCI-H292) cells limits pro-inflammatory cytokine release J. Gen. Virol., September 1, 2003; 84(9): 2389 - 2400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Veckman, M. Miettinen, S. Matikainen, R. Lande, E. Giacomini, E. M. Coccia, and I. Julkunen Lactobacilli and streptococci induce inflammatory chemokine production in human macrophages that stimulates Th1 cell chemotaxis J. Leukoc. Biol., September 1, 2003; 74(3): 395 - 402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Melaine, A. Ruffault, N. Dejucq-Rainsford, and B. Jegou Experimental inoculation of the adult rat testis with Sendai virus: effect on testicular morphology and leukocyte population Hum. Reprod., August 1, 2003; 18(8): 1574 - 1579. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strengell, S. Matikainen, J. Siren, A. Lehtonen, D. Foster, I. Julkunen, and T. Sareneva IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-{gamma} Production in Human NK and T Cells J. Immunol., June 1, 2003; 170(11): 5464 - 5469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fairweather, S. Yusung, S. Frisancho, M. Barrett, S. Gatewood, R. Steele, and N. R. Rose IL-12 Receptor {beta}1 and Toll-Like Receptor 4 Increase IL-1{beta}- and IL-18-Associated Myocarditis and Coxsackievirus Replication J. Immunol., May 1, 2003; 170(9): 4731 - 4737. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Pirhonen, S. Matikainen, and I. Julkunen Regulation of Virus-Induced IL-12 and IL-23 Expression in Human Macrophages J. Immunol., November 15, 2002; 169(10): 5673 - 5678. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ahmad, S. T. A. Sindhu, E. Toma, R. Morisset, and A. Ahmad Elevated Levels of Circulating Interleukin-18 in Human Immunodeficiency Virus-Infected Individuals: Role of Peripheral Blood Mononuclear Cells and Implications for AIDS Pathogenesis J. Virol., November 13, 2002; 76(24): 12448 - 12456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Le Goffic, T. Mouchel, F. Aubry, J.-J. Patard, A. Ruffault, B. Jegou, and M. Samson Production of the Chemokines Monocyte Chemotactic Protein-1, Regulated on Activation Normal T Cell Expressed and Secreted Protein, Growth-Related Oncogene, and Interferon-{gamma}-Inducible Protein-10 Is Induced by the Sendai Virus in Human and Rat Testicular Cells Endocrinology, April 1, 2002; 143(4): 1434 - 1440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Seo and R. G. Webster Tumor Necrosis Factor Alpha Exerts Powerful Anti-Influenza Virus Effects in Lung Epithelial Cells J. Virol., February 1, 2002; 76(3): 1071 - 1076. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mayne, C. Cheadle, S. S. Soldan, C. Cermelli, Y. Yamano, N. Akhyani, J. E. Nagel, D. D. Taub, K. G. Becker, and S. Jacobson Gene Expression Profile of Herpesvirus-Infected T Cells Obtained Using Immunomicroarrays: Induction of Proinflammatory Mechanisms J. Virol., December 1, 2001; 75(23): 11641 - 11650. [Abstract] [Full Text]
|
|
|
|
|
|
S. L. Swain Interleukin 18: Tipping the Balance towards a T Helper Cell 1 Response J. Exp. Med., August 6, 2001; 194(3): f11 - f14. [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Lee, Y.-S. Cho, M.-C. Cho, J.-H. Shim, K.-A. Lee, K.-K. Ko, Y. K. Choe, S.-N. Park, T. Hoshino, S. Kim, et al. Both E6 and E7 Oncoproteins of Human Papillomavirus 16 Inhibit IL-18-Induced IFN-{{gamma}} Production in Human Peripheral Blood Mononuclear and NK Cells J. Immunol., July 1, 2001; 167(1): 497 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Vankayalapati, B. Wizel, D. L. Lakey, Y. Zhang, K. A. Coffee, D. E. Griffith, and P. F. Barnes T Cells Enhance Production of IL-18 by Monocytes in Response to an Intracellular Pathogen J. Immunol., June 1, 2001; 166(11): 6749 - 6753. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Mogensen and S. R. Paludan Molecular Pathways in Virus-Induced Cytokine Production Microbiol. Mol. Biol. Rev., March 1, 2001; 65(1): 131 - 150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Cai, R. Kastelein, and C. A. Hunter Interleukin-18 (IL-18) Enhances Innate IL-12-Mediated Resistance to Toxoplasma gondii Infect. Immun., December 1, 2000; 68(12): 6932 - 6938. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Pien, A. R. Satoskar, K. Takeda, S. Akira, and C. A. Biron Cutting Edge: Selective IL-18 Requirements for Induction of Compartmental IFN-{gamma} Responses During Viral Infection J. Immunol., November 1, 2000; 165(9): 4787 - 4791. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-M. Kim, J. Y. Im, S. H. Han, H. S. Kang, and I. Choi IFN-{gamma} Up-Regulates IL-18 Gene Expression Via IFN Consensus Sequence-Binding Protein and Activator Protein-1 Elements in Macrophages J. Immunol., September 15, 2000; 165(6): 3198 - 3205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sareneva, I. Julkunen, and S. Matikainen IFN-{alpha} and IL-12 Induce IL-18 Receptor Gene Expression in Human NK and T Cells J. Immunol., August 15, 2000; 165(4): 1933 - 1938. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Monack, D. Hersh, N. Ghori, D. Bouley, A. Zychlinsky, and S. Falkow Salmonella Exploits Caspase-1 to Colonize Peyer's Patches in a Murine Typhoid Model J. Exp. Med., July 17, 2000; 192(2): 249 - 258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C. Reading, J. L. Miller, and E. M. Anders Involvement of the Mannose Receptor in Infection of Macrophages by Influenza Virus J. Virol., June 1, 2000; 74(11): 5190 - 5197. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
