The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tangye, S. G.
Right arrow Articles by Phillips, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tangye, S. G.
Right arrow Articles by Phillips, J. H.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*UniGene
The Journal of Immunology, 1999, 162: 6981-6985.
Copyright © 1999 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Human 2B4, an Activating NK Cell Receptor, Recruits the Protein Tyrosine Phosphatase SHP-2 and the Adaptor Signaling Protein SAP1

Stuart G. Tangye*, Sasha Lazetic*, Erica Woollatt{dagger}, Grant R. Sutherland{dagger}, Lewis L. Lanier* and Joseph H. Phillips2,*

* Department of Immunobiology, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA; and {dagger} Center for Medical Genetics, Department of Cytogenetics and Molecular Genetics, Women’s and Children’s Hospital, Adelaide, Australia


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
The genetic defect in X-linked lymphoproliferative syndrome (XLP) is the Src homology 2 domain-containing protein SAP. SAP constitutively associates with the cell surface molecule, signaling lymphocytic activation molecule (SLAM), and competes with SH2-domain containing protein tyrosine phosphatase-2 (SHP-2) for recruitment to SLAM. SLAM exhibits homology with the mouse cell surface receptor 2B4. The human homologue of 2B4 has now been identified. It is recognized by the c1.7 mAb, a mAb capable of activating human NK cells. Human 2B4 became tyrosine phosphorylated following pervanadate-treatment of transfected cells and recruited SHP-2. SAP was also recruited to 2B4 in activated cells. Importantly, the 2B4-SAP interaction prevented the association between 2B4 and SHP-2. These results suggest that the phenotype of XLP may result from perturbed signaling not only through SLAM, but also other cell surface molecules that utilize SAP as a signaling adaptor protein.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Cell surface receptors regulate activation via the recruitment of different signaling molecules. Activating receptors (TCR, surface Ig, CD16, killer cell Ig-like receptors (KIR)3) noncovalently associate with signal-transducing proteins (CD3{zeta}, Ig{alpha}ß, Fc{epsilon}RI{gamma}, DAP12) that possess immunoreceptor tyrosine-based activation motifs (D/ExxYxxL/I-X-6–8-YxxL/I) that, once phosphorylated, can recruit Syk and ZAP-70 (1, 2, 3). The cytoplasmic domains of inhibitory receptors (KIR, CD22, FcR{gamma}IIb) contain immunoreceptor tyrosine-based inhibitory motifs (I/VxYxxL/V-26–31-I/VxYxxL/V) that recruit SH2-domain containing protein tyrosine phosphatase (SHP)-1, SHP-2, and SHIP phosphatases (3, 4, 5, 6).

Mouse (m) 2B4 is an Ig superfamily (IgSF) molecule capable of activating T and NK cells (7, 8). m2B4 exhibits homology to the adhesion molecules Ly9, CD48, CD58, and signaling lymphocytic activation molecule (SLAM; 8–10). A curious feature of m2B4 is the presence of four tyrosine-based motifs (TxYxxV/I) in its cytoplasmic domain (8). This motif is also present in SLAM (9) and may be involved in the recruitment of SHP-2, as well as the association between SLAM and SLAM-associated protein (SAP) (11), the defective protein in the inherited immunodeficiency XLP (11, 12, 13). We have cloned human (h) 2B4 and investigated its role as a signaling molecule.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cloning Human 2B4 and Human SAP

Based on sequence information obtained from a partial cDNA with homology to m2B4 (Human Genome Sciences, Rockville, MD), a human spleen cDNA library (OriGene Technologies, Rockville, MD) was screened by PCR using as primers: 5', GGTGATCATCGTGATTCTAAGCGC; and 3', AGAACCTGCCAGCCAGTTCAC. The open reading frame of h2B4, minus the leader sequence, was amplified using: 5', GCATGCATCGATGGCAAAGGATGCCAGGGATC (ClaI site in italics); 3', GCATGCGCGGCCGCGAGAATTGCTGCAGCAACTAGG (NotI).

The amplified product was digested with ClaI/NotI and cloned into pMX-neo downstream of the Flag epitope and the CD8 leader sequence. hSAP was amplified from NK cell cDNA using: 5', GAAGAAGGATCCGCCATGGACGCAGTGGCTG (BamHI); 3', GCATTAGAATTCTGGGGCTTTCAGGCAGACATC (EcoRI).

The amplified product was digested with BamHI/EcoRI and subcloned into pMX-puro upstream of an in-frame sequence encoding the c-myc epitope. PCR conditions were 30 cycles of 1 min denaturation (94°C), 1 min annealing (55°C), and 45 s (SAP) or 1 min (2B4) extension (72°C).

Transfection

pMX-based constructs were packaged using the Phoenix cell line (14) and virus used to infect the mouse pre-B cell line, BaF3 (2). Infected BaF3 cells were drug-selected; h2B4 transfectants were isolated by cell sorting. Expression of h2B4 on the transfected cells was assessed by flow cytometry using anti-Flag (M2; Sigma, St. Louis, MO) or c1.7 mAb (Coulter, Hialeah, FL) (2).

Biochemical characterization of h2B4

Transfected BaF3 cells expressing Flag-h2B4 or Flag-h2B4 and SAP-myc were untreated or treated with 100 µM sodium pervanadate for 5 min at room temperature and then solubilized in lysis buffer (10 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, and enzyme inhibitors) (2). Flag-h2B4, SAP-myc, and SHP-2 were precipitated from lysates using anti-Flag, anti-myc (9E10; Upstate Biotechnology, Lake Placid, NY), or anti-SHP-2 Ab (Santa Cruz Biotechnology, Santa Cruz, CA) absorbed onto protein G or A beads (Pharmacia, Hercules, CA), electrophoresed under reducing conditions through SDS-polyacrylamide gels (Bio-Rad, Richmond, CA), and then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Membranes were probed with HRP-anti-phosphotyrosine (4G10; Upstate Biotechnology), anti-Flag (for Flag-h2B4), anti-myc (for SAP-myc), or rabbit anti-SHP-2 Abs. Bound Abs were detected with HRP-donkey anti-rabbit IgG and anti-mouse IgG antiserum (Amersham, Arlington Heights, IL). For biochemical characterization, cells were biotinylated or I125-labeled, lysed, and precipitated with anti-Flag or c1.7 mAb (2). Precipitates were untreated or digested with neuraminidase, O-glycosidase and/or N-glycanase. Precipitated proteins were analyzed by SDS-PAGE and Western blotting using HRP-streptavidin (Amersham), and membranes were developed using enhanced chemiluminescence (Pierce, Rockford, IL) or autoradiography.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
Cloning h2B4

Human 2B4 cDNA is 2308 bp, containing a 1098-bp open-reading frame encoding a type 1 transmembrane protein, and a 1210-bp 3'-untranslated region. The mature peptide consists of a 20-aa leader sequence, 201-aa extracellular domain, 24-aa transmembrane region, and 120-aa cytoplasmic domain (Fig. 1Go). Like m2B4, h2B4 is an IgSF molecule, comprised of an N-terminal V-set Ig domain and a membrane-proximal C2-set Ig domain. h2B4 exhibits ~66% identity to m2B4 (Fig. 1Go). The cytoplasmic domain of h2B4 contains four TxYxxV/I motifs that aligned with identical motifs present in m2B4 (Fig. 1Go). h2B4 also exhibits homology with SLAM, hCD48, hLy9, and CD84 (20–35%; data not shown). The h2B4 gene was localized to chromosome 1q22 (data not shown). Several other IgSF molecules also map to human chromo-some 1q22–24, including SLAM (15), CD84 (16), CD48 (17), and Ly9 (18).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. Alignment of human and mouse 2B4. Leader and transmembrane domains are underlined. N-linked glycosylation sites are indicated (•). Tyrosine-based signaling motifs are boxed. Conserved cysteine residues are shown in bold type. Spaces (-) have been included in the alignment to allow optimal comparison between m2B4 and h2B4. The nucleotide sequence of h2B4 has been deposited as GenBank accession number AF 145782.

 
Biochemical characterization of h2B4

Immunoprecipitation revealed that Flag-h2B4 was ~86 kDa (Fig. 2Go). There are eight potential N-linked glycosylation sites in the extracellular domain of h2B4 (Fig. 1Go) and the predicted core size is ~40 kDa. Treatment with neuraminidase and O-glycosidase resulted in a slight reduction in migration (~80 kDa). Following treatment with N-glycanase, the m.w. of Flag-h2B4 was reduced to ~50 kDa. Removal of both N- and O-linked sugars resulted in the protein migrating as ~48 kDa (Fig. 2Go). m2B4 is 66 kDa, significantly less that h2B4. This difference is likely due to differential glycosylation because the core sizes of m2B4 and h2B4 are similar (8).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 2. Biochemical characterization of human 2B4. Flag-h2B4 was precipitated with anti-Flag mAb from biotinylated Flag-h2B4 BaF3 cells. Precipitates were untreated, or treated as indicated and analyzed as described in Materials and Methods.

 
Human 2B4 is recognized by the c1.7 mAb

m2B4 is expressed on all NK and some T cells, and 2B4+ cells mediate non-MHC-restricted cytotoxicity (7). The c1.7 mAb reacts with all human NK cells and ~50% of CD8+ T cells; c1.7+ cells mediate non-MHC-restricted killing by NK and T cells (19). Therefore, we tested whether c1.7 recognized h2B4. Both anti-Flag and c1.7 mAb reacted with Flag-h2B4 BaF3 transfectants (Fig. 3Goa). The molecule recognized by c1.7 was reported to be 38 kDa (19), while Flag-h2B4 was ~86 kDa. To address this discrepancy, Flag-h2B4 was precipitated from Flag-h2B4 BaF3 cells with anti-Flag or c1.7 mAb. Both mAb precipitated a protein of ~86 kDa (Fig. 3Gob). c1.7 mAb also precipitated an ~86 kDa protein from I125-labeled human NKL cells, confirming that the m.w. of native h2B4 is ~86 kDa (Fig. 3Goc). c1.7 mAb is not efficient at precipitating h2B4 (Fig. 3Gob), precluding extensive biochemical analysis of h2B4 from normal human cells. However, we could confirm that ligating h2B4 on NK cells induced killing of FcR-bearing target cells in a redirected cytotoxicity assay, demonstrating that h2B4 is an activating molecule (data not shown). Thus, identifying h2B4 as the molecule recognized by c1.7 mAb revealed that the biological function of 2B4 is conserved across species. An inhibitory isoform of mouse 2B4 has recently been described (20). It is presently unknown whether such an isoform of h2B4 exists.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 3. Human 2B4 is recognized by the c1.7 mAb. a, Flag-h2B4 BaF3 cells were incubated with either anti-Flag mAb or c1.7 mAb or with an isotype control mAb (cIg), followed by PE-anti-mouse Ig antiserum. b, Flag-h2B4 BaF3 cells were precipitated with control Ig (cIg), anti-Flag mAb, or c1.7 mAb, and analyzed as described for Fig. 2Go. c, The human NKL cell line was labeled with I125, lysed, and precipitated with control Ig (cIg) or c1.7 mAb.

 
Human 2B4 is phosphorylated following activation and recruits SHP-2

A tyrosine-phosphorylated protein of ~86 kDa could be detected in anti-Flag mAb precipitates of pervanadate-treated, but not untreated, Flag-h2B4 BaF3 cell lysates. Reprobing these blots with anti-Flag mAb revealed that this phosphoprotein is Flag-h2B4 (Fig. 4Go, a and b). An unknown phosphoprotein of ~25 kDa (pp25) was also present in anti-Flag mAb precipitates of stimulated cells (Fig. 4Goa). The tyrosine-based motifs in the cytoplasmic domain of h2B4 are similar to motifs that recruit SH2 domain-containing phosphatases (3). Therefore, the anti-Flag mAb precipitates were assessed for the presence of SHP-1 and SHP-2. Phosphorylated, but not unphosphorylated, Flag-h2B4 recruited SHP-2 (Fig. 4Goc). This association was specific for SHP-2 because SHP-1 was not recruited to phosphorylated Flag-h2B4 (data not shown).



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 4. Human 2B4 is phosphorylated following activation and recruits SHP-2 and SAP. Flag-h2B4 BaF3 and Flag-h2B4/SAP-myc BaF3 cells were either unstimulated (-) or stimulated (+) for 5 min with sodium pervanadate, then lysed in 1% Nonidet P-40 lysis buffer. Lysates were precipitated with control Ig or anti-Flag mAb. Precipitated proteins were analyzed by SDS-PAGE and Western blot analysis using Ab specific for: a, proteins phosphorylated on tyrosines (anti-pTyr); b, Flag-h2B4 (anti-Flag); c, SHP-2 (anti-SHP-2); and d, SAP-myc (anti-myc). p2B4, phosphorylated Flag-h2B4.

 
Phosphorylated h2B4 also recruits SAP

The cytoplasmic domain of SLAM constitutively associates with the adaptor protein SAP, and SAP competes with SHP-2 for binding to phosphorylated SLAM (11). Due to the homology between SLAM and h2B4, we generated BaF3 cells expressing Flag-h2B4 and SAP-myc to test whether h2B4 also interacts with SAP. Flag-h2B4 was phosphorylated in the absence or presence of SAP-myc following pervanadate treatment (Fig. 4Goa). In Flag-h2B4/SAP-myc transfectants, phosphorylated Flag-h2B4 recruited not only SHP-2 (Fig. 4Goc) but also SAP-myc, as evidenced by an ~20-kDa protein reactive with anti-myc mAb (Fig. 4God). In contrast to SLAM (11), SAP-myc did not appear to constitutively associate with Flag-h2B4, as shown by the absence of SAP-myc in anti-Flag mAb precipitates of unstimulated transfectants (Fig. 4God). Thus, the h2B4-SAP interaction was phosphorylation-dependent. To determine whether both SHP-2 and SAP-myc could simultaneously bind the same Flag-h2B4 molecule, Flag-h2B4/SAP-myc BaF3 cell lysates were precipitated with anti-Flag, anti-myc, or anti-SHP-2 Ab. Anti-Flag mAb precipitates from stimulated cells contained phosphorylated Flag-h2B4, SHP-2, and SAP-myc (Fig. 5Go). In contrast, SHP-2 was absent from anti-myc mAb precipitates (Figs. 5Goc). Similarly, SAP-myc was not present in anti-SHP-2 precipitates (Fig. 5God). Thus, Flag-h2B4, SHP-2, and SAP-myc do not form a trimolecular complex. Rather, following phosphorylation, Flag-h2B4 can recruit either SAP-myc or SHP-2. The presence of both SHP-2 and SAP-myc in anti-Flag mAb precipitates is likely due to limiting amounts of SAP-myc that cannot completely prevent binding of SHP-2 to overexpressed Flag-h2B4. The absence of SHP-2 and SAP-myc from anti-myc and anti-SHP-2 precipitates, respectively, suggests that, similar to SLAM, SHP-2, and SAP-myc may interact with the same tyrosine-based motif present in Flag-h2B4.



View larger version (56K):
[in this window]
[in a new window]
  		FIGURE 5. Association of SAP with h2B4 prevents recruitment of SHP-2. Flag-h2B4/SAP-myc BaF3 cells were either unstimulated (-) or stimulated (+) for 5 min with sodium pervanadate, then lysed in 1% Nonidet P-40 lysis buffer. Flag-h2B4, SAP-myc, or SHP-2 were precipitated with specific Ab; precipitated proteins were analyzed as described for Fig. 4Go.

 
h2B4 is a novel glycoprotein recognized by a mAb that activates human NK and CD8+ T cells. Following phosphorylation, h2B4 recruited SHP-2 and SAP. Importantly, binding of SAP to h2B4 prevented its association with SHP-2. If the signals delivered by h2B4 and SLAM are mediated via SHP-2 (21) the recruitment of SAP could regulate this response by displacing SHP-2 from h2B4 and SLAM. In XLP, such regulation is absent. It is possible that NK and CD8+ T cells from XLP patients would exhibit altered signaling through h2B4. This may contribute to the dysregulated activation of cytotoxic lymphocytes that is characteristic of this immunodeficiency (22). Although SAP was identified by its ability to associate with SLAM (11), XLP may result from an inability to efficiently regulate signals delivered through other cell surface molecules that also utilize SAP as a signaling adaptor protein.


   Acknowledgments
 
We thank Dr. Jim Cupp, Eleni Callas, and Dixie Pollakoff for cell sorting; Debbie Liggett for oligonucleotide synthesis; Dan Gorman and the DNAX sequencing facility for DNA sequencing; Garry Nolan (Stanford University) for providing Phoenix cells; and Maribel Andonian and Gary Burget for graphics.


   Footnotes
 
1 This work is supported by grants from the J.H. & J.D. Gunn Medical Research Foundation, and National Health and Medical Research Council of Australia (to E.W. and G.R.S.). DNAX is supported by the Schering-Plough Corporation. Back

2 Address correspondence and reprint requests to Dr. Joseph Phillips, DNAX Research Institute, 901 California Ave, Palo Alto, CA 94304. E-mail address: Back

3 Abbreviations used in this paper: KIR, killer cell Ig-like receptors; aa, amino acid; SLAM, signaling lymphocytic activation molecule; SAP, SLAM-associated protein; SHP-2, SH2-domain containing protein tyrosine phosphatase-2; XLP, X-linked lymphoproliferative syndrome; IgSF, Ig superfamily; h, human; m, mouse Back

Received for publication March 2, 1999. Accepted for publication April 20, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Alberola-Ila, J., S. Takaki, J. D. Kerner, R. M. Perlmutter. 1997. Differential signaling by lymphocyte Ag receptors. Annu. Rev. Immunol. 15:125.[Medline]
  2. Lanier, L. L., B. C. Corliss, J. Wu, C. Leong, J. H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391:703.[Medline]
  3. Lanier, L. L.. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359.[Medline]
  4. Doody, G. M., L. B. Justement, C. C. Delibrias, R. J. Matthews, J. Lin, M. L. Thomas, D. T. Fearon. 1995. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science 269:242.[Abstract/Free Full Text]
  5. Ono, M., H. Okada, S. Bolland, S. Yanagi, T. Kurosaki, J. V. Ravetch. 1997. Deletion of SHIP or SHP-1 reveals two distinct pathways for inhibitory signaling. Cell 90:293.[Medline]
  6. Gupta, N., A. M. Scharenberg, D. N. Burshtyn, N. Wagtmann, M. N. Lioubin, L. R. Rohrschneider, J. P. Kinet, E. O. Long. 1997. Negative signaling pathways of the killer cell inhibitory receptor and Fc{gamma}RIIb1 require distinct phosphatases. J. Exp. Med. 186:473.[Abstract/Free Full Text]
  7. Garni-Wagner, B. A., A. Purohit, P. A. Mathew, M. Bennett, V. Kumar. 1993. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer and T cells. J. Immunol. 151:60.[Abstract]
  8. Mathew, P. A., B. A. Garni-Wagner, K. Land, A. Takashima, E. Stoneman, M. Bennett, V. Kumar. 1993. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells. J. Immunol. 151:5328.[Abstract]
  9. Cocks, B. G., C-C. J. Chang, J. M. Carballido, H. Yssel, J. E. de Vries, G. Aversa. 1995. A novel receptor involved in T-cell activation. Nature 376:260.[Medline]
  10. Davis, S. J., P. A. van der Merwe. 1996. The structure and ligand interactions of CD2: implications for T-cell function. Immunol. Today 17:177.[Medline]
  11. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L. Notarangelo, R. Geha, M. G. Roncarolo, et al 1998. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature 395:462.[Medline]
  12. Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, J. M. Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, et al 1998. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH2-domain encoding gene. Nat. Genet. 20:129.[Medline]
  13. Nichols, K. E., D. P. Harkin, S. Levitz, M. Krainer, K. A. Kolquist, C. Genovese, A. Bernard, M. Ferguson, L. Zuo, E. Snyder, et al 1998. Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome. Proc. Natl. Acad. Sci. USA 95:13765.[Abstract/Free Full Text]
  14. Kinsella, T. M., G. P. Nolan. 1996. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene Ther. 7:1405.[Medline]
  15. Aversa, G., J. Carballido, J. Punnonen, C. C. Chang, T. Hauser, B. G. Cocks, J. E. de Vries. 1997. SLAM and its role in T cell activation and Th cell responses. Immunol. Cell. Biol. 75:202.[Medline]
  16. de la Fuente, M. A., P. Pizcueta, M. Nadal, J. Bosch, P. Engel. 1997. CD84 leukocyte antigen is a new member of the Ig superfamily. Blood 90:2398.[Abstract/Free Full Text]
  17. Staunton, D. E., R. C. Fisher, M. M. LeBeau, J. B. Lawrence, D. E. Barton, U. Francke, M. Dustin, D. A. Thorley-Lawson. 1989. Blast-1 possesses a glycosyl-phosphatidylinositol (GPI) membrane anchor, is related to LFA-3 and OX-45, and maps to chromosome 1q21–23. J. Exp. Med. 169:1087.[Abstract/Free Full Text]
  18. Sandrin, M. S., M. M. Henning, M. F. Lo, E. Baker, G. R. Sutherland, I. F. McKenzie. 1996. Isolation and characterization of cDNA clones for Humly9: the human homologue of mouse Ly9. Immunogenetics. 43:13.[Medline]
  19. Valiante, N. M., G. Trinchieri. 1993. Identification of a novel signal transduction surface molecule on human cytotoxic lymphocytes. J. Exp. Med. 178:1397.[Abstract/Free Full Text]
  20. Schatzle, J. D., S. Sheu, S. E. Stepp, P. A. Mathew, M. Bennett, V. Kumar. 1999. Characterization of inhibitory and stimulatory forms of the murine natural killer cell receptor 2B4. Proc. Natl. Acad. Sci. USA 96:3870.[Abstract/Free Full Text]
  21. Frearson, J. A, D. R. Alexander. 1996. Protein tyrosine phosphatases in T-cell development, apoptosis and signalling. Immunol. Today 17:385.[Medline]
  22. Sullivan, J. L., K. S. Byron, F. E. Brewster, S. M. Baker, H. D. Ochs. 1983. X-linked lymphoproliferative syndrome: natural history of the immunodeficiency. J. Clin. Invest. 71:1765.



This article has been cited by other articles:


Home page
 J. Immunol.Home page
L. K. Chlewicki, C. A. Velikovsky, V. Balakrishnan, R. A. Mariuzza, and V. Kumar
Molecular Basis of the Dual Functions of 2B4 (CD244)
J. Immunol., June 15, 2008; 180(12): 8159 - 8167.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. A. Wahle, K. H. T. Paraiso, R. D. Kendig, H. R. Lawrence, L. Chen, J. Wu, and W. G. Kerr
Inappropriate Recruitment and Activity by the Src Homology Region 2 Domain-Containing Phosphatase 1 (SHP1) Is Responsible for Receptor Dominance in the SHIP-Deficient NK Cell
J. Immunol., December 15, 2007; 179(12): 8009 - 8015.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. K. Lee, S. O. Mathew, S. V. Vaidya, P. R. Kumaresan, and P. A. Mathew
CS1 (CRACC, CD319) Induces Proliferation and Autocrine Cytokine Expression on Human B Lymphocytes
J. Immunol., October 1, 2007; 179(7): 4672 - 4678.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. G. Clarkson, S. J. Simmonds, M. J. Puklavec, and M. H. Brown
Direct and Indirect Interactions of the Cytoplasmic Region of CD244 (2B4) in Mice and Humans with FYN Kinase
J. Biol. Chem., August 31, 2007; 282(35): 25385 - 25394.
[Abstract] [Full Text] [PDF]

Home page
 Ann. N. Y. Acad. Sci.Home page
S. SAWADA, M. TAKEI, T. ISHIWATA, H. SHIRAIWA, H. INOMATA, and T. NOZAKI
SLAM-Associated Protein Solves a Mystery of Autoimmunity
Ann. N.Y. Acad. Sci., August 1, 2007; 1109(1): 19 - 30.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
P. Roda-Navarro and H. T. Reyburn
Intercellular protein transfer at the NK cell immune synapse: mechanisms and physiological significance
FASEB J, June 1, 2007; 21(8): 1636 - 1646.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
T. J. Wilson, R. M. Presti, I. Tassi, E. T. Overton, M. Cella, and M. Colonna
FcRL6, a new ITIM-bearing receptor on cytolytic cells, is broadly expressed by lymphocytes following HIV-1 infection
Blood, May 1, 2007; 109(9): 3786 - 3793.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. J. Orr, N. M. Morgan, J. Elliott, J. F. Burrows, C. J. Scott, D. W. McVicar, and J. A. Johnston
CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover
Blood, February 1, 2007; 109(3): 1061 - 1068.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty
SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase
J. Immunol., January 15, 2007; 178(2): 817 - 828.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed
Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease
Blood, November 1, 2006; 108(9): 3085 - 3093.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Gu, S. G. Tangye, X. Sun, Y. Luo, Z. Lin, and J. Wu
The X-linked lymphoproliferative disease gene product SAP associates with PAK-interacting exchange factor and participates in T cell activation
PNAS, September 26, 2006; 103(39): 14447 - 14452.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. Eissmann and C. Watzl
Molecular Analysis of NTB-A Signaling: A Role for EAT-2 in NTB-A-Mediated Activation of Human NK Cells.
J. Immunol., September 1, 2006; 177(5): 3170 - 3177.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
N. J. Hare, C. S. Ma, F. Alvaro, K. E. Nichols, and S. G. Tangye
Missense mutations in SH2D1A identified in patients with X-linked lymphoproliferative disease differentially affect the expression and function of SAP
Int. Immunol., July 1, 2006; 18(7): 1055 - 1065.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
K.-M. Lee, J. P. Forman, M. E. McNerney, S. Stepp, S. Kuppireddi, D. Guzior, Y. E. Latchman, M. H. Sayegh, H. Yagita, C.-K. Park, et al.
Requirement of homotypic NK-cell interactions through 2B4(CD244)/CD48 in the generation of NK effector functions
Blood, April 15, 2006; 107(8): 3181 - 3188.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
R. Bhat, P. Eissmann, J. Endt, S. Hoffmann, and C. Watzl
Fine-tuning of immune responses by SLAM-related receptors
J. Leukoc. Biol., March 1, 2006; 79(3): 417 - 424.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Gao, P. Schwartzberg, J. A. Wilder, B. R. Blazar, and D. Yuan
B Cell Induction of IL-13 Expression in NK Cells: Role of CD244 and SLAM-Associated Protein.
J. Immunol., March 1, 2006; 176(5): 2758 - 2764.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
H. Williams and D. H. Crawford
Epstein-Barr virus: the impact of scientific advances on clinical practice
Blood, February 1, 2006; 107(3): 862 - 869.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Komori, H. Furukawa, S. Mori, M. R. Ito, M. Terada, M.-C. Zhang, N. Ishii, N. Sakuma, M. Nose, and M. Ono
A Signal Adaptor SLAM-Associated Protein Regulates Spontaneous Autoimmunity and Fas-Dependent Lymphoproliferation in MRL-Faslpr Lupus Mice
J. Immunol., January 1, 2006; 176(1): 395 - 400.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Tassi and M. Colonna
The Cytotoxicity Receptor CRACC (CS-1) Recruits EAT-2 and Activates the PI3K and Phospholipase C{gamma} Signaling Pathways in Human NK Cells
J. Immunol., December 15, 2005; 175(12): 7996 - 8002.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Saborit-Villarroya, J. M. Del Valle, X. Romero, E. Esplugues, P. Lauzurica, P. Engel, and M. Martin
The Adaptor Protein 3BP2 Binds Human CD244 and Links this Receptor to Vav Signaling, ERK Activation, and NK Cell Killing
J. Immunol., October 1, 2005; 175(7): 4226 - 4235.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
U. Al-Alem, C. Li, N. Forey, F. Relouzat, M.-C. Fondaneche, S. V. Tavtigian, Z.-Q. Wang, S. Latour, and L. Yin
Impaired Ig class switch in mice deficient for the X-linked lymphoproliferative disease gene Sap
Blood, September 15, 2005; 106(6): 2069 - 2075.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
N. Arase, A. Takeuchi, M. Unno, S. Hirano, T. Yokosuka, H. Arase, and T. Saito
Heterotypic interaction of CRTAM with Necl2 induces cell adhesion on activated NK cells and CD8+ T cells
Int. Immunol., September 1, 2005; 17(9): 1227 - 1237.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. O. Mathew, P. R. Kumaresan, J. K. Lee, V. T. Huynh, and P. A. Mathew
Mutational Analysis of the Human 2B4 (CD244)/CD48 Interaction: Lys68 and Glu70 in the V Domain of 2B4 Are Critical for CD48 Binding and Functional Activation of NK Cells
J. Immunol., July 15, 2005; 175(2): 1005 - 1013.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
C. Bloch-Queyrat, M.-C. Fondaneche, R. Chen, L. Yin, F. Relouzat, A. Veillette, A. Fischer, and S. Latour
Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn
J. Exp. Med., July 5, 2005; 202(1): 181 - 192.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. Eissmann, L. Beauchamp, J. Wooters, J. C. Tilton, E. O. Long, and C. Watzl
Molecular basis for positive and negative signaling by the natural killer cell receptor 2B4 (CD244)
Blood, June 15, 2005; 105(12): 4722 - 4729.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
H. Yamada, S. Shimada, M. Morikawa, K. Iwabuchi, R. Kishi, K. Onoe, and H. Minakami
Divergence of natural killer cell receptor and related molecule in the decidua from sporadic miscarriage with normal chromosome karyotype
Mol. Hum. Reprod., June 1, 2005; 11(6): 451 - 457.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. Dupre, G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A. Aiuti, and M.-G. Roncarolo
SAP controls the cytolytic activity of CD8+ T cells against EBV-infected cells
Blood, June 1, 2005; 105(11): 4383 - 4389.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Martin, J. M. Del Valle, I. Saborit, and P. Engel
Identification of Grb2 As a Novel Binding Partner of the Signaling Lymphocytic Activation Molecule-Associated Protein Binding Receptor CD229
J. Immunol., May 15, 2005; 174(10): 5977 - 5986.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Aoukaty and R. Tan
Role for Glycogen Synthase Kinase-3 in NK Cell Cytotoxicity and X-Linked Lymphoproliferative Disease
J. Immunol., April 15, 2005; 174(8): 4551 - 4558.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Chung, A. Aoukaty, J. Dutz, C. Terhorst, and R. Tan
Cutting Edge: Signaling Lymphocytic Activation Molecule-Associated Protein Controls NKT Cell Functions
J. Immunol., March 15, 2005; 174(6): 3153 - 3157.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. V. Vaidya, S. E. Stepp, M. E. McNerney, J.-K. Lee, M. Bennett, K.-M. Lee, C. L. Stewart, V. Kumar, and P. A. Mathew
Targeted Disruption of the 2B4 Gene in Mice Reveals an In Vivo Role of 2B4 (CD244) in the Rejection of B16 Melanoma Cells
J. Immunol., January 15, 2005; 174(2): 800 - 807.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. V. Mikhalap, L. M. Shlapatska, O. V. Yurchenko, M. Y. Yurchenko, G. G. Berdova, K. E. Nichols, E. A. Clark, and S. P. Sidorenko
The adaptor protein SH2D1A regulates signaling through CD150 (SLAM) in B cells
Blood, December 15, 2004; 104(13): 4063 - 4070.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. Roda-Navarro, M. Mittelbrunn, M. Ortega, D. Howie, C. Terhorst, F. Sanchez-Madrid, and E. Fernandez-Ruiz
Dynamic Redistribution of the Activating 2B4/SAP Complex at the Cytotoxic NK Cell Immune Synapse
J. Immunol., September 15, 2004; 173(6): 3640 - 3646.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Chtanova, S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay
T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Th1/Th2 Effector Cells That Provide Help for B Cells
J. Immunol., July 1, 2004; 173(1): 68 - 78.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
R. Chen, F. Relouzat, R. Roncagalli, A. Aoukaty, R. Tan, S. Latour, and A. Veillette
Molecular Dissection of 2B4 Signaling: Implications for Signal Transduction by SLAM-Related Receptors
Mol. Cell. Biol., June 15, 2004; 24(12): 5144 - 5156.
[Abstract] [Full Text] [PDF]