|
|
||||||||
CUTTING EDGE |


*
Department of Immunobiology, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA; and
Center for Medical Genetics, Department of Cytogenetics and Molecular Genetics, Womens and Childrens Hospital, Adelaide, Australia
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, Ig
ß,
Fc
RI
, DAP12) that possess immunoreceptor tyrosine-based
activation motifs (D/ExxYxxL/I-X-68-YxxL/I)
that, once phosphorylated, can recruit Syk and ZAP-70
(1, 2, 3). The cytoplasmic domains of inhibitory receptors (KIR, CD22,
FcR
IIb) contain immunoreceptor tyrosine-based inhibitory motifs
(I/VxYxxL/V-2631-I/VxYxxL/V) that recruit
SH2-domain containing protein tyrosine phosphatase (SHP)-1, SHP-2, and
SHIP phosphatases (3, 4, 5, 6). Mouse (m) 2B4 is an Ig superfamily (IgSF) molecule capable of activating T and NK cells (7, 8). m2B4 exhibits homology to the adhesion molecules Ly9, CD48, CD58, and signaling lymphocytic activation molecule (SLAM; 810). A curious feature of m2B4 is the presence of four tyrosine-based motifs (TxYxxV/I) in its cytoplasmic domain (8). This motif is also present in SLAM (9) and may be involved in the recruitment of SHP-2, as well as the association between SLAM and SLAM-associated protein (SAP) (11), the defective protein in the inherited immunodeficiency XLP (11, 12, 13). We have cloned human (h) 2B4 and investigated its role as a signaling molecule.
| Materials and Methods |
|---|
|
|
|---|
Based on sequence information obtained from a partial cDNA with homology to m2B4 (Human Genome Sciences, Rockville, MD), a human spleen cDNA library (OriGene Technologies, Rockville, MD) was screened by PCR using as primers: 5', GGTGATCATCGTGATTCTAAGCGC; and 3', AGAACCTGCCAGCCAGTTCAC. The open reading frame of h2B4, minus the leader sequence, was amplified using: 5', GCATGCATCGATGGCAAAGGATGCCAGGGATC (ClaI site in italics); 3', GCATGCGCGGCCGCGAGAATTGCTGCAGCAACTAGG (NotI).
The amplified product was digested with ClaI/NotI and cloned into pMX-neo downstream of the Flag epitope and the CD8 leader sequence. hSAP was amplified from NK cell cDNA using: 5', GAAGAAGGATCCGCCATGGACGCAGTGGCTG (BamHI); 3', GCATTAGAATTCTGGGGCTTTCAGGCAGACATC (EcoRI).
The amplified product was digested with BamHI/EcoRI and subcloned into pMX-puro upstream of an in-frame sequence encoding the c-myc epitope. PCR conditions were 30 cycles of 1 min denaturation (94°C), 1 min annealing (55°C), and 45 s (SAP) or 1 min (2B4) extension (72°C).
Transfection
pMX-based constructs were packaged using the Phoenix cell line (14) and virus used to infect the mouse pre-B cell line, BaF3 (2). Infected BaF3 cells were drug-selected; h2B4 transfectants were isolated by cell sorting. Expression of h2B4 on the transfected cells was assessed by flow cytometry using anti-Flag (M2; Sigma, St. Louis, MO) or c1.7 mAb (Coulter, Hialeah, FL) (2).
Biochemical characterization of h2B4
Transfected BaF3 cells expressing Flag-h2B4 or Flag-h2B4 and SAP-myc were untreated or treated with 100 µM sodium pervanadate for 5 min at room temperature and then solubilized in lysis buffer (10 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, and enzyme inhibitors) (2). Flag-h2B4, SAP-myc, and SHP-2 were precipitated from lysates using anti-Flag, anti-myc (9E10; Upstate Biotechnology, Lake Placid, NY), or anti-SHP-2 Ab (Santa Cruz Biotechnology, Santa Cruz, CA) absorbed onto protein G or A beads (Pharmacia, Hercules, CA), electrophoresed under reducing conditions through SDS-polyacrylamide gels (Bio-Rad, Richmond, CA), and then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Membranes were probed with HRP-anti-phosphotyrosine (4G10; Upstate Biotechnology), anti-Flag (for Flag-h2B4), anti-myc (for SAP-myc), or rabbit anti-SHP-2 Abs. Bound Abs were detected with HRP-donkey anti-rabbit IgG and anti-mouse IgG antiserum (Amersham, Arlington Heights, IL). For biochemical characterization, cells were biotinylated or I125-labeled, lysed, and precipitated with anti-Flag or c1.7 mAb (2). Precipitates were untreated or digested with neuraminidase, O-glycosidase and/or N-glycanase. Precipitated proteins were analyzed by SDS-PAGE and Western blotting using HRP-streptavidin (Amersham), and membranes were developed using enhanced chemiluminescence (Pierce, Rockford, IL) or autoradiography.
| Results and Discussion |
|---|
|
|
|---|
Human 2B4 cDNA is 2308 bp, containing a 1098-bp open-reading frame
encoding a type 1 transmembrane protein, and a 1210-bp 3'-untranslated
region. The mature peptide consists of a 20-aa leader sequence, 201-aa
extracellular domain, 24-aa transmembrane region, and 120-aa
cytoplasmic domain (Fig. 1
). Like m2B4,
h2B4 is an IgSF molecule, comprised of an N-terminal V-set Ig domain
and a membrane-proximal C2-set Ig domain. h2B4 exhibits
66%
identity to m2B4 (Fig. 1
). The cytoplasmic domain of h2B4 contains four
TxYxxV/I motifs that aligned with identical motifs present in m2B4
(Fig. 1
). h2B4 also exhibits homology with SLAM, hCD48, hLy9, and CD84
(2035%; data not shown). The h2B4 gene was localized to
chromosome 1q22 (data not shown). Several other IgSF molecules also map
to human chromo-some 1q2224, including SLAM (15), CD84
(16), CD48 (17), and Ly9 (18).
|
Immunoprecipitation revealed that Flag-h2B4 was
86 kDa (Fig. 2
). There are eight potential
N-linked glycosylation sites in the extracellular domain of
h2B4 (Fig. 1
) and the predicted core size is
40 kDa. Treatment with
neuraminidase and O-glycosidase resulted in a slight
reduction in migration (
80 kDa). Following treatment with
N-glycanase, the m.w. of Flag-h2B4 was reduced to
50 kDa.
Removal of both N- and O-linked sugars resulted
in the protein migrating as
48 kDa (Fig. 2
). m2B4 is 66 kDa,
significantly less that h2B4. This difference is likely due to
differential glycosylation because the core sizes of m2B4 and h2B4 are
similar (8).
|
m2B4 is expressed on all NK and some T cells, and
2B4+ cells mediate non-MHC-restricted
cytotoxicity (7). The c1.7 mAb reacts with all human NK cells and
50% of CD8+ T cells;
c1.7+ cells mediate non-MHC-restricted killing by
NK and T cells (19). Therefore, we tested whether c1.7 recognized h2B4.
Both anti-Flag and c1.7 mAb reacted with Flag-h2B4 BaF3
transfectants (Fig. 3
a). The
molecule recognized by c1.7 was reported to be 38 kDa (19), while
Flag-h2B4 was
86 kDa. To address this discrepancy, Flag-h2B4 was
precipitated from Flag-h2B4 BaF3 cells with anti-Flag or c1.7 mAb.
Both mAb precipitated a protein of
86 kDa (Fig. 3
b). c1.7
mAb also precipitated an
86 kDa protein from
I125-labeled human NKL cells, confirming that the
m.w. of native h2B4 is
86 kDa (Fig. 3
c). c1.7 mAb is not
efficient at precipitating h2B4 (Fig. 3
b), precluding
extensive biochemical analysis of h2B4 from normal human cells.
However, we could confirm that ligating h2B4 on NK cells induced
killing of FcR-bearing target cells in a redirected cytotoxicity assay,
demonstrating that h2B4 is an activating molecule (data not shown).
Thus, identifying h2B4 as the molecule recognized by c1.7 mAb revealed
that the biological function of 2B4 is conserved across species. An
inhibitory isoform of mouse 2B4 has recently been described (20). It is
presently unknown whether such an isoform of h2B4 exists.
|
A tyrosine-phosphorylated protein of
86 kDa could
be detected in anti-Flag mAb precipitates of pervanadate-treated,
but not untreated, Flag-h2B4 BaF3 cell lysates. Reprobing these blots
with anti-Flag mAb revealed that this phosphoprotein is Flag-h2B4
(Fig. 4
, a and b).
An unknown phosphoprotein of
25 kDa (pp25) was also present in
anti-Flag mAb precipitates of stimulated cells (Fig. 4
a). The tyrosine-based motifs in the cytoplasmic domain of
h2B4 are similar to motifs that recruit SH2 domain-containing
phosphatases (3). Therefore, the anti-Flag mAb precipitates were
assessed for the presence of SHP-1 and SHP-2.
Phosphorylated, but not unphosphorylated,
Flag-h2B4 recruited SHP-2 (Fig. 4
c). This association was
specific for SHP-2 because SHP-1 was not recruited to
phosphorylated Flag-h2B4 (data not shown).
|
The cytoplasmic domain of SLAM constitutively associates with the
adaptor protein SAP, and SAP competes with SHP-2 for binding to
phosphorylated SLAM (11). Due to the homology between SLAM
and h2B4, we generated BaF3 cells expressing Flag-h2B4 and
SAP-myc to test whether h2B4 also interacts with SAP.
Flag-h2B4 was phosphorylated in the absence or presence of
SAP-myc following pervanadate treatment (Fig. 4
a). In Flag-h2B4/SAP-myc transfectants,
phosphorylated Flag-h2B4 recruited not only SHP-2 (Fig. 4
c) but also SAP-myc, as evidenced by an
20-kDa protein reactive with anti-myc mAb (Fig. 4
d). In contrast to SLAM (11), SAP-myc did not
appear to constitutively associate with Flag-h2B4, as shown by the
absence of SAP-myc in anti-Flag mAb precipitates of
unstimulated transfectants (Fig. 4
d). Thus, the h2B4-SAP
interaction was phosphorylation-dependent. To determine
whether both SHP-2 and SAP-myc could simultaneously bind the
same Flag-h2B4 molecule, Flag-h2B4/SAP-myc BaF3 cell lysates
were precipitated with anti-Flag, anti-myc, or
anti-SHP-2 Ab. Anti-Flag mAb precipitates from stimulated cells
contained phosphorylated Flag-h2B4, SHP-2, and
SAP-myc (Fig. 5
). In contrast,
SHP-2 was absent from anti-myc mAb precipitates (Figs. 5
c). Similarly, SAP-myc was not present in
anti-SHP-2 precipitates (Fig. 5
d). Thus, Flag-h2B4,
SHP-2, and SAP-myc do not form a trimolecular complex.
Rather, following phosphorylation, Flag-h2B4 can
recruit either SAP-myc or SHP-2. The presence of both SHP-2
and SAP-myc in anti-Flag mAb precipitates is likely due
to limiting amounts of SAP-myc that cannot completely
prevent binding of SHP-2 to overexpressed Flag-h2B4. The absence of
SHP-2 and SAP-myc from anti-myc and
anti-SHP-2 precipitates, respectively, suggests that, similar to
SLAM, SHP-2, and SAP-myc may interact with the same
tyrosine-based motif present in Flag-h2B4.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joseph Phillips, DNAX Research Institute, 901 California Ave, Palo Alto, CA 94304. E-mail address: ![]()
3 Abbreviations used in this paper: KIR, killer cell Ig-like receptors; aa, amino acid; SLAM, signaling lymphocytic activation molecule; SAP, SLAM-associated protein; SHP-2, SH2-domain containing protein tyrosine phosphatase-2; XLP, X-linked lymphoproliferative syndrome; IgSF, Ig superfamily; h, human; m, mouse ![]()
Received for publication March 2, 1999. Accepted for publication April 20, 1999.
| References |
|---|
|
|
|---|
RIIb1 require distinct phosphatases. J. Exp. Med. 186:473.This article has been cited by other articles:
![]() |
L. K. Chlewicki, C. A. Velikovsky, V. Balakrishnan, R. A. Mariuzza, and V. Kumar Molecular Basis of the Dual Functions of 2B4 (CD244) J. Immunol., June 15, 2008; 180(12): 8159 - 8167. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Wahle, K. H. T. Paraiso, R. D. Kendig, H. R. Lawrence, L. Chen, J. Wu, and W. G. Kerr Inappropriate Recruitment and Activity by the Src Homology Region 2 Domain-Containing Phosphatase 1 (SHP1) Is Responsible for Receptor Dominance in the SHIP-Deficient NK Cell J. Immunol., December 15, 2007; 179(12): 8009 - 8015. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Lee, S. O. Mathew, S. V. Vaidya, P. R. Kumaresan, and P. A. Mathew CS1 (CRACC, CD319) Induces Proliferation and Autocrine Cytokine Expression on Human B Lymphocytes J. Immunol., October 1, 2007; 179(7): 4672 - 4678. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Clarkson, S. J. Simmonds, M. J. Puklavec, and M. H. Brown Direct and Indirect Interactions of the Cytoplasmic Region of CD244 (2B4) in Mice and Humans with FYN Kinase J. Biol. Chem., August 31, 2007; 282(35): 25385 - 25394. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. SAWADA, M. TAKEI, T. ISHIWATA, H. SHIRAIWA, H. INOMATA, and T. NOZAKI SLAM-Associated Protein Solves a Mystery of Autoimmunity Ann. N.Y. Acad. Sci., August 1, 2007; 1109(1): 19 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Roda-Navarro and H. T. Reyburn Intercellular protein transfer at the NK cell immune synapse: mechanisms and physiological significance FASEB J, June 1, 2007; 21(8): 1636 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Wilson, R. M. Presti, I. Tassi, E. T. Overton, M. Cella, and M. Colonna FcRL6, a new ITIM-bearing receptor on cytolytic cells, is broadly expressed by lymphocytes following HIV-1 infection Blood, May 1, 2007; 109(9): 3786 - 3793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Orr, N. M. Morgan, J. Elliott, J. F. Burrows, C. J. Scott, D. W. McVicar, and J. A. Johnston CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover Blood, February 1, 2007; 109(3): 1061 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase J. Immunol., January 15, 2007; 178(2): 817 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease Blood, November 1, 2006; 108(9): 3085 - 3093. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gu, S. G. Tangye, X. Sun, Y. Luo, Z. Lin, and J. Wu The X-linked lymphoproliferative disease gene product SAP associates with PAK-interacting exchange factor and participates in T cell activation PNAS, September 26, 2006; 103(39): 14447 - 14452. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Eissmann and C. Watzl Molecular Analysis of NTB-A Signaling: A Role for EAT-2 in NTB-A-Mediated Activation of Human NK Cells. J. Immunol., September 1, 2006; 177(5): 3170 - 3177. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Hare, C. S. Ma, F. Alvaro, K. E. Nichols, and S. G. Tangye Missense mutations in SH2D1A identified in patients with X-linked lymphoproliferative disease differentially affect the expression and function of SAP Int. Immunol., July 1, 2006; 18(7): 1055 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-M. Lee, J. P. Forman, M. E. McNerney, S. Stepp, S. Kuppireddi, D. Guzior, Y. E. Latchman, M. H. Sayegh, H. Yagita, C.-K. Park, et al. Requirement of homotypic NK-cell interactions through 2B4(CD244)/CD48 in the generation of NK effector functions Blood, April 15, 2006; 107(8): 3181 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bhat, P. Eissmann, J. Endt, S. Hoffmann, and C. Watzl Fine-tuning of immune responses by SLAM-related receptors J. Leukoc. Biol., March 1, 2006; 79(3): 417 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gao, P. Schwartzberg, J. A. Wilder, B. R. Blazar, and D. Yuan B Cell Induction of IL-13 Expression in NK Cells: Role of CD244 and SLAM-Associated Protein. J. Immunol., March 1, 2006; 176(5): 2758 - 2764. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Williams and D. H. Crawford Epstein-Barr virus: the impact of scientific advances on clinical practice Blood, February 1, 2006; 107(3): 862 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Komori, H. Furukawa, S. Mori, M. R. Ito, M. Terada, M.-C. Zhang, N. Ishii, N. Sakuma, M. Nose, and M. Ono A Signal Adaptor SLAM-Associated Protein Regulates Spontaneous Autoimmunity and Fas-Dependent Lymphoproliferation in MRL-Faslpr Lupus Mice J. Immunol., January 1, 2006; 176(1): 395 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tassi and M. Colonna The Cytotoxicity Receptor CRACC (CS-1) Recruits EAT-2 and Activates the PI3K and Phospholipase C{gamma} Signaling Pathways in Human NK Cells J. Immunol., December 15, 2005; 175(12): 7996 - 8002. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Saborit-Villarroya, J. M. Del Valle, X. Romero, E. Esplugues, P. Lauzurica, P. Engel, and M. Martin The Adaptor Protein 3BP2 Binds Human CD244 and Links this Receptor to Vav Signaling, ERK Activation, and NK Cell Killing J. Immunol., October 1, 2005; 175(7): 4226 - 4235. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Al-Alem, C. Li, N. Forey, F. Relouzat, M.-C. Fondaneche, S. V. Tavtigian, Z.-Q. Wang, S. Latour, and L. Yin Impaired Ig class switch in mice deficient for the X-linked lymphoproliferative disease gene Sap Blood, September 15, 2005; 106(6): 2069 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Arase, A. Takeuchi, M. Unno, S. Hirano, T. Yokosuka, H. Arase, and T. Saito Heterotypic interaction of CRTAM with Necl2 induces cell adhesion on activated NK cells and CD8+ T cells Int. Immunol., September 1, 2005; 17(9): 1227 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Mathew, P. R. Kumaresan, J. K. Lee, V. T. Huynh, and P. A. Mathew Mutational Analysis of the Human 2B4 (CD244)/CD48 Interaction: Lys68 and Glu70 in the V Domain of 2B4 Are Critical for CD48 Binding and Functional Activation of NK Cells J. Immunol., July 15, 2005; 175(2): 1005 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bloch-Queyrat, M.-C. Fondaneche, R. Chen, L. Yin, F. Relouzat, A. Veillette, A. Fischer, and S. Latour Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn J. Exp. Med., July 5, 2005; 202(1): 181 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Eissmann, L. Beauchamp, J. Wooters, J. C. Tilton, E. O. Long, and C. Watzl Molecular basis for positive and negative signaling by the natural killer cell receptor 2B4 (CD244) Blood, June 15, 2005; 105(12): 4722 - 4729. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamada, S. Shimada, M. Morikawa, K. Iwabuchi, R. Kishi, K. Onoe, and H. Minakami Divergence of natural killer cell receptor and related molecule in the decidua from sporadic miscarriage with normal chromosome karyotype Mol. Hum. Reprod., June 1, 2005; 11(6): 451 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dupre, G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A. Aiuti, and M.-G. Roncarolo SAP controls the cytolytic activity of CD8+ T cells against EBV-infected cells Blood, June 1, 2005; 105(11): 4383 - 4389. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Martin, J. M. Del Valle, I. Saborit, and P. Engel Identification of Grb2 As a Novel Binding Partner of the Signaling Lymphocytic Activation Molecule-Associated Protein Binding Receptor CD229 J. Immunol., May 15, 2005; 174(10): 5977 - 5986. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aoukaty and R. Tan Role for Glycogen Synthase Kinase-3 in NK Cell Cytotoxicity and X-Linked Lymphoproliferative Disease J. Immunol., April 15, 2005; 174(8): 4551 - 4558. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chung, A. Aoukaty, J. Dutz, C. Terhorst, and R. Tan Cutting Edge: Signaling Lymphocytic Activation Molecule-Associated Protein Controls NKT Cell Functions J. Immunol., March 15, 2005; 174(6): 3153 - 3157. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Vaidya, S. E. Stepp, M. E. McNerney, J.-K. Lee, M. Bennett, K.-M. Lee, C. L. Stewart, V. Kumar, and P. A. Mathew Targeted Disruption of the 2B4 Gene in Mice Reveals an In Vivo Role of 2B4 (CD244) in the Rejection of B16 Melanoma Cells J. Immunol., January 15, 2005; 174(2): 800 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Mikhalap, L. M. Shlapatska, O. V. Yurchenko, M. Y. Yurchenko, G. G. Berdova, K. E. Nichols, E. A. Clark, and S. P. Sidorenko The adaptor protein SH2D1A regulates signaling through CD150 (SLAM) in B cells Blood, December 15, 2004; 104(13): 4063 - 4070. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Roda-Navarro, M. Mittelbrunn, M. Ortega, D. Howie, C. Terhorst, F. Sanchez-Madrid, and E. Fernandez-Ruiz Dynamic Redistribution of the Activating 2B4/SAP Complex at the Cytotoxic NK Cell Immune Synapse J. Immunol., September 15, 2004; 173(6): 3640 - 3646. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Chtanova, S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Th1/Th2 Effector Cells That Provide Help for B Cells J. Immunol., July 1, 2004; 173(1): 68 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chen, F. Relouzat, R. Roncagalli, A. Aoukaty, R. Tan, S. Latour, and A. Veillette Molecular Dissection of 2B4 Signaling: Implications for Signal Transduction by SLAM-Related Receptors Mol. Cell. Biol., June 15, 2004; 24(12): 5144 - 5156. [Abstract] [Full Text] [PDF] |
||||