| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
CUTTING EDGE |
*
Department of Immunobiology, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA; and
Center for Medical Genetics, Department of Cytogenetics and Molecular Genetics, Women’s and Children’s Hospital, Adelaide, Australia
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
, Ig
ß,
Fc
RI
, DAP12) that possess immunoreceptor tyrosine-based
activation motifs (D/ExxYxxL/I-X-6–8-YxxL/I)
that, once phosphorylated, can recruit Syk and ZAP-70
(1, 2, 3). The cytoplasmic domains of inhibitory receptors (KIR, CD22,
FcRIIb) contain immunoreceptor tyrosine-based inhibitory motifs
(I/VxYxxL/V-26–31-I/VxYxxL/V) that recruit
SH2-domain containing protein tyrosine phosphatase (SHP)-1, SHP-2, and
SHIP phosphatases (3, 4, 5, 6). Mouse (m) 2B4 is an Ig superfamily (IgSF) molecule capable of activating T and NK cells (7, 8). m2B4 exhibits homology to the adhesion molecules Ly9, CD48, CD58, and signaling lymphocytic activation molecule (SLAM; 8–10). A curious feature of m2B4 is the presence of four tyrosine-based motifs (TxYxxV/I) in its cytoplasmic domain (8). This motif is also present in SLAM (9) and may be involved in the recruitment of SHP-2, as well as the association between SLAM and SLAM-associated protein (SAP) (11), the defective protein in the inherited immunodeficiency XLP (11, 12, 13). We have cloned human (h) 2B4 and investigated its role as a signaling molecule.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Based on sequence information obtained from a partial cDNA with homology to m2B4 (Human Genome Sciences, Rockville, MD), a human spleen cDNA library (OriGene Technologies, Rockville, MD) was screened by PCR using as primers: 5', GGTGATCATCGTGATTCTAAGCGC; and 3', AGAACCTGCCAGCCAGTTCAC. The open reading frame of h2B4, minus the leader sequence, was amplified using: 5', GCATGCATCGATGGCAAAGGATGCCAGGGATC (ClaI site in italics); 3', GCATGCGCGGCCGCGAGAATTGCTGCAGCAACTAGG (NotI).
The amplified product was digested with ClaI/NotI and cloned into pMX-neo downstream of the Flag epitope and the CD8 leader sequence. hSAP was amplified from NK cell cDNA using: 5', GAAGAAGGATCCGCCATGGACGCAGTGGCTG (BamHI); 3', GCATTAGAATTCTGGGGCTTTCAGGCAGACATC (EcoRI).
The amplified product was digested with BamHI/EcoRI and subcloned into pMX-puro upstream of an in-frame sequence encoding the c-myc epitope. PCR conditions were 30 cycles of 1 min denaturation (94°C), 1 min annealing (55°C), and 45 s (SAP) or 1 min (2B4) extension (72°C).
Transfection
pMX-based constructs were packaged using the Phoenix cell line (14) and virus used to infect the mouse pre-B cell line, BaF3 (2). Infected BaF3 cells were drug-selected; h2B4 transfectants were isolated by cell sorting. Expression of h2B4 on the transfected cells was assessed by flow cytometry using anti-Flag (M2; Sigma, St. Louis, MO) or c1.7 mAb (Coulter, Hialeah, FL) (2).
Biochemical characterization of h2B4
Transfected BaF3 cells expressing Flag-h2B4 or Flag-h2B4 and SAP-myc were untreated or treated with 100 µM sodium pervanadate for 5 min at room temperature and then solubilized in lysis buffer (10 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, and enzyme inhibitors) (2). Flag-h2B4, SAP-myc, and SHP-2 were precipitated from lysates using anti-Flag, anti-myc (9E10; Upstate Biotechnology, Lake Placid, NY), or anti-SHP-2 Ab (Santa Cruz Biotechnology, Santa Cruz, CA) absorbed onto protein G or A beads (Pharmacia, Hercules, CA), electrophoresed under reducing conditions through SDS-polyacrylamide gels (Bio-Rad, Richmond, CA), and then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Membranes were probed with HRP-anti-phosphotyrosine (4G10; Upstate Biotechnology), anti-Flag (for Flag-h2B4), anti-myc (for SAP-myc), or rabbit anti-SHP-2 Abs. Bound Abs were detected with HRP-donkey anti-rabbit IgG and anti-mouse IgG antiserum (Amersham, Arlington Heights, IL). For biochemical characterization, cells were biotinylated or I125-labeled, lysed, and precipitated with anti-Flag or c1.7 mAb (2). Precipitates were untreated or digested with neuraminidase, O-glycosidase and/or N-glycanase. Precipitated proteins were analyzed by SDS-PAGE and Western blotting using HRP-streptavidin (Amersham), and membranes were developed using enhanced chemiluminescence (Pierce, Rockford, IL) or autoradiography.
|
Results and Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Human 2B4 cDNA is 2308 bp, containing a 1098-bp open-reading frame
encoding a type 1 transmembrane protein, and a 1210-bp 3'-untranslated
region. The mature peptide consists of a 20-aa leader sequence, 201-aa
extracellular domain, 24-aa transmembrane region, and 120-aa
cytoplasmic domain (Fig. 1
). Like m2B4,
h2B4 is an IgSF molecule, comprised of an N-terminal V-set Ig domain
and a membrane-proximal C2-set Ig domain. h2B4 exhibits 
66%
identity to m2B4 (Fig. 1). The cytoplasmic domain of h2B4 contains four
TxYxxV/I motifs that aligned with identical motifs present in m2B4
(Fig. 1). h2B4 also exhibits homology with SLAM, hCD48, hLy9, and CD84
(20–35%; data not shown). The h2B4 gene was localized to
chromosome 1q22 (data not shown). Several other IgSF molecules also map
to human chromo-some 1q22–24, including SLAM (15), CD84
(16), CD48 (17), and Ly9 (18).
|
Immunoprecipitation revealed that Flag-h2B4 was 86 kDa (Fig. 2). There are eight potential
N-linked glycosylation sites in the extracellular domain of
h2B4 (Fig. 1
) and the predicted core size is 40 kDa. Treatment with
neuraminidase and O-glycosidase resulted in a slight
reduction in migration (80 kDa). Following treatment with
N-glycanase, the m.w. of Flag-h2B4 was reduced to 50 kDa.
Removal of both N- and O-linked sugars resulted
in the protein migrating as 48 kDa (Fig. 2). m2B4 is 66 kDa,
significantly less that h2B4. This difference is likely due to
differential glycosylation because the core sizes of m2B4 and h2B4 are
similar (8).
|
m2B4 is expressed on all NK and some T cells, and
2B4+ cells mediate non-MHC-restricted
cytotoxicity (7). The c1.7 mAb reacts with all human NK cells and
50% of CD8+ T cells;
c1.7+ cells mediate non-MHC-restricted killing by
NK and T cells (19). Therefore, we tested whether c1.7 recognized h2B4.
Both anti-Flag and c1.7 mAb reacted with Flag-h2B4 BaF3
transfectants (Fig. 3a). The
molecule recognized by c1.7 was reported to be 38 kDa (19), while
Flag-h2B4 was 86 kDa. To address this discrepancy, Flag-h2B4 was
precipitated from Flag-h2B4 BaF3 cells with anti-Flag or c1.7 mAb.
Both mAb precipitated a protein of 86 kDa (Fig. 3b). c1.7
mAb also precipitated an 86 kDa protein from
I125-labeled human NKL cells, confirming that the
m.w. of native h2B4 is 86 kDa (Fig. 3c). c1.7 mAb is not
efficient at precipitating h2B4 (Fig. 3b), precluding
extensive biochemical analysis of h2B4 from normal human cells.
However, we could confirm that ligating h2B4 on NK cells induced
killing of FcR-bearing target cells in a redirected cytotoxicity assay,
demonstrating that h2B4 is an activating molecule (data not shown).
Thus, identifying h2B4 as the molecule recognized by c1.7 mAb revealed
that the biological function of 2B4 is conserved across species. An
inhibitory isoform of mouse 2B4 has recently been described (20). It is
presently unknown whether such an isoform of h2B4 exists.
|
A tyrosine-phosphorylated protein of 86 kDa could
be detected in anti-Flag mAb precipitates of pervanadate-treated,
but not untreated, Flag-h2B4 BaF3 cell lysates. Reprobing these blots
with anti-Flag mAb revealed that this phosphoprotein is Flag-h2B4
(Fig. 4, a and b).
An unknown phosphoprotein of 25 kDa (pp25) was also present in
anti-Flag mAb precipitates of stimulated cells (Fig. 4a). The tyrosine-based motifs in the cytoplasmic domain of
h2B4 are similar to motifs that recruit SH2 domain-containing
phosphatases (3). Therefore, the anti-Flag mAb precipitates were
assessed for the presence of SHP-1 and SHP-2.
Phosphorylated, but not unphosphorylated,
Flag-h2B4 recruited SHP-2 (Fig. 4c). This association was
specific for SHP-2 because SHP-1 was not recruited to
phosphorylated Flag-h2B4 (data not shown).
|
The cytoplasmic domain of SLAM constitutively associates with the
adaptor protein SAP, and SAP competes with SHP-2 for binding to
phosphorylated SLAM (11). Due to the homology between SLAM
and h2B4, we generated BaF3 cells expressing Flag-h2B4 and
SAP-myc to test whether h2B4 also interacts with SAP.
Flag-h2B4 was phosphorylated in the absence or presence of
SAP-myc following pervanadate treatment (Fig. 4a). In Flag-h2B4/SAP-myc transfectants,
phosphorylated Flag-h2B4 recruited not only SHP-2 (Fig. 4c) but also SAP-myc, as evidenced by an
20-kDa protein reactive with anti-myc mAb (Fig. 4d). In contrast to SLAM (11), SAP-myc did not
appear to constitutively associate with Flag-h2B4, as shown by the
absence of SAP-myc in anti-Flag mAb precipitates of
unstimulated transfectants (Fig. 4d). Thus, the h2B4-SAP
interaction was phosphorylation-dependent. To determine
whether both SHP-2 and SAP-myc could simultaneously bind the
same Flag-h2B4 molecule, Flag-h2B4/SAP-myc BaF3 cell lysates
were precipitated with anti-Flag, anti-myc, or
anti-SHP-2 Ab. Anti-Flag mAb precipitates from stimulated cells
contained phosphorylated Flag-h2B4, SHP-2, and
SAP-myc (Fig. 5). In contrast,
SHP-2 was absent from anti-myc mAb precipitates (Figs. 5c). Similarly, SAP-myc was not present in
anti-SHP-2 precipitates (Fig. 5d). Thus, Flag-h2B4,
SHP-2, and SAP-myc do not form a trimolecular complex.
Rather, following phosphorylation, Flag-h2B4 can
recruit either SAP-myc or SHP-2. The presence of both SHP-2
and SAP-myc in anti-Flag mAb precipitates is likely due
to limiting amounts of SAP-myc that cannot completely
prevent binding of SHP-2 to overexpressed Flag-h2B4. The absence of
SHP-2 and SAP-myc from anti-myc and
anti-SHP-2 precipitates, respectively, suggests that, similar to
SLAM, SHP-2, and SAP-myc may interact with the same
tyrosine-based motif present in Flag-h2B4.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joseph Phillips, DNAX Research Institute, 901 California Ave, Palo Alto, CA 94304. E-mail address:
3 Abbreviations used in this paper: KIR, killer cell Ig-like receptors; aa, amino acid; SLAM, signaling lymphocytic activation molecule; SAP, SLAM-associated protein; SHP-2, SH2-domain containing protein tyrosine phosphatase-2; XLP, X-linked lymphoproliferative syndrome; IgSF, Ig superfamily; h, human; m, mouse
Received for publication March 2, 1999. Accepted for publication April 20, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
RIIb1 require distinct phosphatases. J. Exp. Med. 186:473.This article has been cited by other articles:
|
|
 |
|
  L. K. Chlewicki, C. A. Velikovsky, V. Balakrishnan, R. A. Mariuzza, and V. Kumar Molecular Basis of the Dual Functions of 2B4 (CD244) J. Immunol., June 15, 2008; 180(12): 8159 - 8167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Wahle, K. H. T. Paraiso, R. D. Kendig, H. R. Lawrence, L. Chen, J. Wu, and W. G. Kerr Inappropriate Recruitment and Activity by the Src Homology Region 2 Domain-Containing Phosphatase 1 (SHP1) Is Responsible for Receptor Dominance in the SHIP-Deficient NK Cell J. Immunol., December 15, 2007; 179(12): 8009 - 8015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Lee, S. O. Mathew, S. V. Vaidya, P. R. Kumaresan, and P. A. Mathew CS1 (CRACC, CD319) Induces Proliferation and Autocrine Cytokine Expression on Human B Lymphocytes J. Immunol., October 1, 2007; 179(7): 4672 - 4678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. G. Clarkson, S. J. Simmonds, M. J. Puklavec, and M. H. Brown Direct and Indirect Interactions of the Cytoplasmic Region of CD244 (2B4) in Mice and Humans with FYN Kinase J. Biol. Chem., August 31, 2007; 282(35): 25385 - 25394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Roda-Navarro and H. T. Reyburn Intercellular protein transfer at the NK cell immune synapse: mechanisms and physiological significance FASEB J, June 1, 2007; 21(8): 1636 - 1646. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Wilson, R. M. Presti, I. Tassi, E. T. Overton, M. Cella, and M. Colonna FcRL6, a new ITIM-bearing receptor on cytolytic cells, is broadly expressed by lymphocytes following HIV-1 infection Blood, May 1, 2007; 109(9): 3786 - 3793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Orr, N. M. Morgan, J. Elliott, J. F. Burrows, C. J. Scott, D. W. McVicar, and J. A. Johnston CD33 responses are blocked by SOCS3 through accelerated proteasomal-mediated turnover Blood, February 1, 2007; 109(3): 1061 - 1068. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase J. Immunol., January 15, 2007; 178(2): 817 - 828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease Blood, November 1, 2006; 108(9): 3085 - 3093. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Gu, S. G. Tangye, X. Sun, Y. Luo, Z. Lin, and J. Wu The X-linked lymphoproliferative disease gene product SAP associates with PAK-interacting exchange factor and participates in T cell activation PNAS, September 26, 2006; 103(39): 14447 - 14452. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Eissmann and C. Watzl Molecular Analysis of NTB-A Signaling: A Role for EAT-2 in NTB-A-Mediated Activation of Human NK Cells. J. Immunol., September 1, 2006; 177(5): 3170 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Hare, C. S. Ma, F. Alvaro, K. E. Nichols, and S. G. Tangye Missense mutations in SH2D1A identified in patients with X-linked lymphoproliferative disease differentially affect the expression and function of SAP Int. Immunol., July 1, 2006; 18(7): 1055 - 1065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-M. Lee, J. P. Forman, M. E. McNerney, S. Stepp, S. Kuppireddi, D. Guzior, Y. E. Latchman, M. H. Sayegh, H. Yagita, C.-K. Park, et al. Requirement of homotypic NK-cell interactions through 2B4(CD244)/CD48 in the generation of NK effector functions Blood, April 15, 2006; 107(8): 3181 - 3188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Bhat, P. Eissmann, J. Endt, S. Hoffmann, and C. Watzl Fine-tuning of immune responses by SLAM-related receptors J. Leukoc. Biol., March 1, 2006; 79(3): 417 - 424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Gao, P. Schwartzberg, J. A. Wilder, B. R. Blazar, and D. Yuan B Cell Induction of IL-13 Expression in NK Cells: Role of CD244 and SLAM-Associated Protein. J. Immunol., March 1, 2006; 176(5): 2758 - 2764. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Williams and D. H. Crawford Epstein-Barr virus: the impact of scientific advances on clinical practice Blood, February 1, 2006; 107(3): 862 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Komori, H. Furukawa, S. Mori, M. R. Ito, M. Terada, M.-C. Zhang, N. Ishii, N. Sakuma, M. Nose, and M. Ono A Signal Adaptor SLAM-Associated Protein Regulates Spontaneous Autoimmunity and Fas-Dependent Lymphoproliferation in MRL-Faslpr Lupus Mice J. Immunol., January 1, 2006; 176(1): 395 - 400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Tassi and M. Colonna The Cytotoxicity Receptor CRACC (CS-1) Recruits EAT-2 and Activates the PI3K and Phospholipase C{gamma} Signaling Pathways in Human NK Cells J. Immunol., December 15, 2005; 175(12): 7996 - 8002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Saborit-Villarroya, J. M. Del Valle, X. Romero, E. Esplugues, P. Lauzurica, P. Engel, and M. Martin The Adaptor Protein 3BP2 Binds Human CD244 and Links this Receptor to Vav Signaling, ERK Activation, and NK Cell Killing J. Immunol., October 1, 2005; 175(7): 4226 - 4235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Al-Alem, C. Li, N. Forey, F. Relouzat, M.-C. Fondaneche, S. V. Tavtigian, Z.-Q. Wang, S. Latour, and L. Yin Impaired Ig class switch in mice deficient for the X-linked lymphoproliferative disease gene Sap Blood, September 15, 2005; 106(6): 2069 - 2075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Arase, A. Takeuchi, M. Unno, S. Hirano, T. Yokosuka, H. Arase, and T. Saito Heterotypic interaction of CRTAM with Necl2 induces cell adhesion on activated NK cells and CD8+ T cells Int. Immunol., September 1, 2005; 17(9): 1227 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. O. Mathew, P. R. Kumaresan, J. K. Lee, V. T. Huynh, and P. A. Mathew Mutational Analysis of the Human 2B4 (CD244)/CD48 Interaction: Lys68 and Glu70 in the V Domain of 2B4 Are Critical for CD48 Binding and Functional Activation of NK Cells J. Immunol., July 15, 2005; 175(2): 1005 - 1013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Bloch-Queyrat, M.-C. Fondaneche, R. Chen, L. Yin, F. Relouzat, A. Veillette, A. Fischer, and S. Latour Regulation of natural cytotoxicity by the adaptor SAP and the Src-related kinase Fyn J. Exp. Med., July 5, 2005; 202(1): 181 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Eissmann, L. Beauchamp, J. Wooters, J. C. Tilton, E. O. Long, and C. Watzl Molecular basis for positive and negative signaling by the natural killer cell receptor 2B4 (CD244) Blood, June 15, 2005; 105(12): 4722 - 4729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yamada, S. Shimada, M. Morikawa, K. Iwabuchi, R. Kishi, K. Onoe, and H. Minakami Divergence of natural killer cell receptor and related molecule in the decidua from sporadic miscarriage with normal chromosome karyotype Mol. Hum. Reprod., June 1, 2005; 11(6): 451 - 457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Dupre, G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A. Aiuti, and M.-G. Roncarolo SAP controls the cytolytic activity of CD8+ T cells against EBV-infected cells Blood, June 1, 2005; 105(11): 4383 - 4389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, J. M. Del Valle, I. Saborit, and P. Engel Identification of Grb2 As a Novel Binding Partner of the Signaling Lymphocytic Activation Molecule-Associated Protein Binding Receptor CD229 J. Immunol., May 15, 2005; 174(10): 5977 - 5986. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Aoukaty and R. Tan Role for Glycogen Synthase Kinase-3 in NK Cell Cytotoxicity and X-Linked Lymphoproliferative Disease J. Immunol., April 15, 2005; 174(8): 4551 - 4558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Chung, A. Aoukaty, J. Dutz, C. Terhorst, and R. Tan Cutting Edge: Signaling Lymphocytic Activation Molecule-Associated Protein Controls NKT Cell Functions J. Immunol., March 15, 2005; 174(6): 3153 - 3157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Vaidya, S. E. Stepp, M. E. McNerney, J.-K. Lee, M. Bennett, K.-M. Lee, C. L. Stewart, V. Kumar, and P. A. Mathew Targeted Disruption of the 2B4 Gene in Mice Reveals an In Vivo Role of 2B4 (CD244) in the Rejection of B16 Melanoma Cells J. Immunol., January 15, 2005; 174(2): 800 - 807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Mikhalap, L. M. Shlapatska, O. V. Yurchenko, M. Y. Yurchenko, G. G. Berdova, K. E. Nichols, E. A. Clark, and S. P. Sidorenko The adaptor protein SH2D1A regulates signaling through CD150 (SLAM) in B cells Blood, December 15, 2004; 104(13): 4063 - 4070. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Roda-Navarro, M. Mittelbrunn, M. Ortega, D. Howie, C. Terhorst, F. Sanchez-Madrid, and E. Fernandez-Ruiz Dynamic Redistribution of the Activating 2B4/SAP Complex at the Cytotoxic NK Cell Immune Synapse J. Immunol., September 15, 2004; 173(6): 3640 - 3646. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chtanova, S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Th1/Th2 Effector Cells That Provide Help for B Cells J. Immunol., July 1, 2004; 173(1): 68 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Chen, F. Relouzat, R. Roncagalli, A. Aoukaty, R. Tan, S. Latour, and A. Veillette Molecular Dissection of 2B4 Signaling: Implications for Signal Transduction by SLAM-Related Receptors Mol. Cell. Biol., June 15, 2004; 24(12): 5144 - 5156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-i. Yusa, T. L. Catina, and K. S. Campbell KIR2DL5 Can Inhibit Human NK Cell Activation Via Recruitment of Src Homology Region 2-Containing Protein Tyrosine Phosphatase-2 (SHP-2) J. Immunol., June 15, 2004; 172(12): 7385 - 7392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Sharifi, J. C. Sinclair, K. C. Gilmour, P. D. Arkwright, C. Kinnon, A. J. Thrasher, and H. B. Gaspar SAP mediates specific cytotoxic T-cell functions in X-linked lymphoproliferative disease Blood, May 15, 2004; 103(10): 3821 - 3827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Veillette SLAM Family Receptors Regulate Immunity with and without SAP-related Adaptors J. Exp. Med., May 3, 2004; 199(9): 1175 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-M. Lee, M. E. McNerney, S. E. Stepp, P. A. Mathew, J. D. Schatzle, M. Bennett, and V. Kumar 2B4 Acts As a Non-Major Histocompatibility Complex Binding Inhibitory Receptor on Mouse Natural Killer Cells J. Exp. Med., May 3, 2004; 199(9): 1245 - 1254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Simarro, A. Lanyi, D. Howie, F. Poy, J. Bruggeman, M. Choi, J. Sumegi, M. J. Eck, and C. Terhorst SAP increases FynT kinase activity and is required for phosphorylation of SLAM and Ly9 Int. Immunol., May 1, 2004; 16(5): 727 - 736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Tangye, K. E. Nichols, N. J. Hare, and B. C. M. van de Weerdt Functional Requirements for Interactions Between CD84 and Src Homology 2 Domain-Containing Proteins and Their Contribution to Human T Cell Activation J. Immunol., September 1, 2003; 171(5): 2485 - 2495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-M. Lee, S. Bhawan, T. Majima, H. Wei, M. I. Nishimura, H. Yagita, and V. Kumar Cutting Edge: The NK Cell Receptor 2B4 Augments Antigen-Specific T Cell Cytotoxicity Through CD48 Ligation on Neighboring T Cells J. Immunol., May 15, 2003; 170(10): 4881 - 4885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Del Valle, P. Engel, and M. Martin The Cell Surface Expression of SAP-binding Receptor CD229 Is Regulated via Its Interaction with Clathrin-associated Adaptor Complex 2 (AP-2) J. Biol. Chem., May 2, 2003; 278(19): 17430 - 17437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Li, C. Iosef, C. Y. H. Jia, V. K. M. Han, and S. S.-C. Li Dual Functional Roles for the X-linked Lymphoproliferative Syndrome Gene Product SAP/SH2D1A in Signaling through the Signaling Lymphocyte Activation Molecule (SLAM) Family of Immune Receptors J. Biol. Chem., January 31, 2003; 278(6): 3852 - 3859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Watzl and E. O. Long Natural Killer Cell Inhibitory Receptors Block Actin Cytoskeleton-dependent Recruitment of 2B4 (CD244) to Lipid Rafts J. Exp. Med., January 6, 2003; 197(1): 77 - 85. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Howie, S. Okamoto, S. Rietdijk, K. Clarke, N. Wang, C. Gullo, J. P. Bruggeman, S. Manning, A. J. Coyle, E. Greenfield, et al. The role of SAP in murine CD150 (SLAM)-mediated T-cell proliferation and interferon gamma production Blood, September 26, 2002; 100(8): 2899 - 2907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Terrazzano, D. Zanzi, C. Palomba, E. Carbone, S. Grimaldi, S. Pisanti, S. Fontana, S. Zappacosta, and G. Ruggiero Differential involvement of CD40, CD80, and major histocompatibility complex class I molecules in cytotoxicity induction and interferon-{gamma} production by human natural killer effectors J. Leukoc. Biol., August 1, 2002; 72(2): 305 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Klem, P. C. Verrett, V. Kumar, and J. D. Schatzle 2B4 Is Constitutively Associated with Linker for the Activation of T Cells in Glycolipid-Enriched Microdomains: Properties Required for 2B4 Lytic Function J. Immunol., July 1, 2002; 169(1): 55 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Aoukaty and R. Tan Association of the X-linked Lymphoproliferative Disease Gene Product SAP/SH2D1A with 2B4, a Natural Killer Cell-activating Molecule, Is Dependent on Phosphoinositide 3-Kinase J. Biol. Chem., April 5, 2002; 277(15): 13331 - 13337. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. E. Speiser, M. Colonna, M. Ayyoub, M. Cella, M. J. Pittet, P. Batard, D. Valmori, P. Guillaume, D. Lienard, J.-C. Cerottini, et al. The Activatory Receptor 2B4 Is Expressed In Vivo by Human CD8+ Effector {alpha}{beta} T Cells J. Immunol., December 1, 2001; 167(11): 6165 - 6170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Chuang, P. R. Kumaresan, and P. A. Mathew 2B4 (CD244)-Mediated Activation of Cytotoxicity and IFN-{gamma} Release in Human NK Cells Involves Distinct Pathways J. Immunol., December 1, 2001; 167(11): 6210 - 6216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bouchon, M. Cella, H. L. Grierson, J. I. Cohen, and M. Colonna Cutting Edge: Activation of NK Cell-Mediated Cytotoxicity by a SAP-Independent Receptor of the CD2 Family J. Immunol., November 15, 2001; 167(10): 5517 - 5521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, X. Romero, M. A. de la Fuente, V. Tovar, N. Zapater, E. Esplugues, P. Pizcueta, J. Bosch, and P. Engel CD84 Functions as a Homophilic Adhesion Molecule and Enhances IFN-{gamma} Secretion: Adhesion Is Mediated by Ig-Like Domain 1 J. Immunol., October 1, 2001; 167(7): 3668 - 3676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nakamura, J. Zarycki, J. L. Sullivan, and J. U. Jung Abnormal T Cell Receptor Signal Transduction of CD4 Th Cells in X-Linked Lymphoproliferative Syndrome J. Immunol., September 1, 2001; 167(5): 2657 - 2665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Morra, O. Silander, S. Calpe, M. Choi, H. Oettgen, L. Myers, A. Etzioni, R. Buckley, and C. Terhorst Alterations of the X-linked lymphoproliferative disease gene SH2D1A in common variable immunodeficiency syndrome Blood, September 1, 2001; 98(5): 1321 - 1325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Sumazaki, H. Kanegane, M. Osaki, T. Fukushima, M. Tsuchida, H. Matsukura, K. Shinozaki, H. Kimura, A. Matsui, and T. Miyawaki SH2D1A mutations in Japanese males with severe Epstein-Barr virus-associated illnesses Blood, August 15, 2001; 98(4): 1268 - 1270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Bottino, M. Falco, S. Parolini, E. Marcenaro, R. Augugliaro, S. Sivori, E. Landi, R. Biassoni, L. D. Notarangelo, L. Moretta, et al. NTB-A, a Novel SH2D1A-associated Surface Molecule Contributing to the Inability of Natural Killer Cells to Kill Epstein-Barr Virus-infected B Cells in X-linked Lymphoproliferative Disease J. Exp. Med., July 30, 2001; 194(3): 235 - 246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sayos, M. Martin, A. Chen, M. Simarro, D. Howie, M. Morra, P. Engel, and C. Terhorst Cell surface receptors Ly-9 and CD84 recruit the X-linked lymphoproliferative disease gene product SAP Blood, June 15, 2001; 97(12): 3867 - 3874. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Czar, E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen, A. Sher, C. S. Duckett, R. Ahmed, et al. Altered lymphocyte responses and cytokine production in mice deficient in the X-linked lymphoproliferative disease gene SH2D1A/DSHP/SAP PNAS, June 7, 2001; (2001) 131193098. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. de la Fuente, V. Tovar, N. Villamor, N. Zapater, P. Pizcueta, E. Campo, J. Bosch, and P. Engel Molecular characterization and expression of a novel human leukocyte cell-surface marker homologous to mouse Ly-9 Blood, June 1, 2001; 97(11): 3513 - 3520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Chuang, H.-T. K. Pham, P. R. Kumaresan, and P. A. Mathew A Prominent Role for Activator Protein-1 in the Transcription of the Human 2B4 (CD244) Gene in NK Cells J. Immunol., May 15, 2001; 166(10): 6188 - 6195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Shlapatska, S. V. Mikhalap, A. G. Berdova, O. M. Zelensky, T. J. Yun, K. E. Nichols, E. A. Clark, and S. P. Sidorenko CD150 Association with Either the SH2-Containing Inositol Phosphatase or the SH2-Containing Protein Tyrosine Phosphatase Is Regulated by the Adaptor Protein SH2D1A J. Immunol., May 1, 2001; 166(9): 5480 - 5487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takei, T. Ishiwata, K. Mitamura, S. Fujiwara, K. Sasaki, T. Nishi, T. Kuga, T. Ookubo, T. Horie, J. Ryu, et al. Decreased expression of signaling lymphocytic-activation molecule-associated protein (SAP) transcripts in T cells from patients with rheumatoid arthritis Int. Immunol., April 1, 2001; 13(4): 559 - 565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Dutz, L. Benoit, X. Wang, D. J. Demetrick, A. Junker, D. de Sa, and R. Tan Lymphocytic vasculitis in X-linked lymphoproliferative disease Blood, January 1, 2001; 97(1): 95 - 100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sayos, K. B. Nguyen, C. Wu, S. E. Stepp, D. Howie, J. D. Schatzle, V. Kumar, C. A. Biron, and C. Terhorst Potential pathways for regulation of NK and T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4 Int. Immunol., December 1, 2000; 12(12): 1749 - 1757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sumegi, D. Huang, A. Lanyi, J. D. Davis, T. A. Seemayer, A. Maeda, G. Klein, M. Seri, H. Wakiguchi, D. T. Purtilo, et al. Correlation of mutations of the SH2D1A gene and Epstein-Barr virus infection with clinical phenotype and outcome in X-linked lymphoproliferative disease Blood, November 1, 2000; 96(9): 3118 - 3125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Watzl, C. C. Stebbins, and E. O. Long Cutting Edge: NK Cell Inhibitory Receptors Prevent Tyrosine Phosphorylation of the Activation Receptor 2B4 (CD244) J. Immunol., October 1, 2000; 165(7): 3545 - 3548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Benoit, X. Wang, H. F. Pabst, J. Dutz, and R. Tan Cutting Edge: Defective NK Cell Activation in X-Linked Lymphoproliferative Disease J. Immunol., October 1, 2000; 165(7): 3549 - 3553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Tangye, J. H. Phillips, L. L. Lanier, and K. E. Nichols Cutting Edge: Functional Requirement for SAP in 2B4-Mediated Activation of Human Natural Killer Cells as Revealed by the X-Linked Lymphoproliferative Syndrome J. Immunol., September 15, 2000; 165(6): 2932 - 2936. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. I. Cohen Epstein-Barr Virus Infection N. Engl. J. Med., August 17, 2000; 343(7): 481 - 492. [Full Text] [PDF]
|
|
|
|
|
|
N. Fournier, L. Chalus, I. Durand, E. Garcia, J.-J. Pin, T. Churakova, S. Patel, C. Zlot, D. Gorman, S. Zurawski, et al. FDF03, a Novel Inhibitory Receptor of the Immunoglobulin Superfamily, Is Expressed by Human Dendritic and Myeloid Cells J. Immunol., August 1, 2000; 165(3): 1197 - 1209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Parolini, C. Bottino, M. Falco, R. Augugliaro, S. Giliani, R. Franceschini, H. D. Ochs, H. Wolf, J.-Y. Bonnefoy, R. Biassoni, et al. X-linked Lymphoproliferative Disease: 2B4 Molecules Displaying Inhibitory Rather Than Activating Function Are Responsible for the Inability of Natural Killer Cells to Kill Epstein-Barr Virus-infected Cells J. Exp. Med., July 31, 2000; 192(3): 337 - 346. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. L. Lanier Turning On Natural Killer Cells J. Exp. Med., April 10, 2000; 191(8): 1259 - 1262. [Full Text] [PDF]
|
|
|
|
 |
|
 B. Damania, J.-K. Choi, and J. U. Jung Signaling Activities of Gammaherpesvirus Membrane Proteins J. Virol., February 15, 2000; 74(4): 1593 - 1601. [Full Text]
|
|
|
|
|
|
D. D. Mousseau, D. Banville, D. L'Abbe, P. Bouchard, and S.-H. Shen PILRalpha , a Novel Immunoreceptor Tyrosine-based Inhibitory Motif-bearing Protein, Recruits SHP-1 upon Tyrosine Phosphorylation and Is Paired with the Truncated Counterpart PILRbeta J. Biol. Chem., February 11, 2000; 275(6): 4467 - 4474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Castro, T. M. Hauser, B. G. Cocks, J. Abrams, S. Zurawski, T. Churakova, F. Zonin, D. Robinson, S. G. Tangye, G. Aversa, et al. Molecular and Functional Characterization of Mouse Signaling Lymphocytic Activation Molecule (SLAM): Differential Expression and Responsiveness in Th1 and Th2 Cells J. Immunol., December 1, 1999; 163(11): 5860 - 5870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. Greenberg and S. R. Riddell Deficient Cellular Immunity--Finding and Fixing the Defects Science, July 23, 1999; 285(5427): 546 - 551. [Abstract] [Full Text]
|
|
|
|
|
|
T. Angata and A. Varki Cloning, Characterization, and Phylogenetic Analysis of Siglec-9, a New Member of the CD33-related Group of Siglecs. EVIDENCE FOR CO-EVOLUTION WITH SIALIC ACID SYNTHESIS PATHWAYS J. Biol. Chem., July 14, 2000; 275(29): 22127 - 22135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mavaddat, D. W. Mason, P. D. Atkinson, E. J. Evans, R. J. C. Gilbert, D. I. Stuart, J. A. Fennelly, A. N. Barclay, S. J. Davis, and M. H. Brown Signaling Lymphocytic Activation Molecule (CDw150) Is Homophilic but Self-associates with Very Low Affinity J. Biol. Chem., September 1, 2000; 275(36): 28100 - 28109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ulyanova, D. D. Shah, and M. L. Thomas Molecular Cloning of MIS, a Myeloid Inhibitory Siglec, That Binds Protein-tyrosine Phosphatases SHP-1 and SHP-2 J. Biol. Chem., April 20, 2001; 276(17): 14451 - 14458. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Morra, M. Simarro-Grande, M. Martin, A. S.-I. Chen, A. Lanyi, O. Silander, S. Calpe, J. Davis, T. Pawson, M. J. Eck, et al. Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients J. Biol. Chem., September 21, 2001; 276(39): 36809 - 36816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yu, C.-M. Lai, M. Maoui, D. Banville, and S.-H. Shen Identification and Characterization of S2V, a Novel Putative Siglec That Contains Two V Set Ig-like Domains and Recruits Protein-tyrosine Phosphatases SHPs J. Biol. Chem., June 22, 2001; 276(26): 23816 - 23824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. S. Sylla, K. Murphy, E. Cahir-McFarland, W. S. Lane, G. Mosialos, and E. Kieff The X-linked lymphoproliferative syndrome gene product SH2D1A associates with p62dok (Dok1) and activates NF-kappa B PNAS, June 20, 2000; 97(13): 7470 - 7475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Czar, E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen, A. Sher, C. S. Duckett, R. Ahmed, et al. Altered lymphocyte responses and cytokine production in mice deficient in the X-linked lymphoproliferative disease gene SH2D1A/DSHP/SAP PNAS, June 19, 2001; 98(13): 7449 - 7454. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
