The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heine, H.
Right arrow Articles by Golenbock, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heine, H.
Right arrow Articles by Golenbock, D. T.
The Journal of Immunology, 1999, 162: 6971-6975.
Copyright © 1999 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: Cells That Carry A Null Allele for Toll-Like Receptor 2 Are Capable of Responding to Endotoxin1

Holger Heine*, Carsten J. Kirschning{dagger}, Egil Lien*, Brian G. Monks*, Mike Rothe{dagger} and Douglas T. Golenbock2,*

* Maxwell Finland Laboratory for Infectious Diseases, Boston University School of Medicine and Boston Medical Center, Boston, MA 02118; and {dagger} Tularik, South San Francisco, CA 98080


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Toll-like receptor (TLR) 2 and TLR4 have been implicated in the responses of cells to LPS (endotoxin). CD14-transfected Chinese hamster ovary (CHO)-K1 fibroblasts (CHO/CD14) are exquisitely sensitive to endotoxin. Sequence analysis of CHO-TLR2, compared with human and mouse TLR2, revealed a single base pair deletion. This frameshift mutation resulted in an alternative stop codon, encoding a protein devoid of transmembrane and intracellular domains. CHO-TLR2 cDNA failed to enable LPS signaling upon transient transfection into human epithelial kidney 293 cells. Site-directed mutagenesis of CHO-TLR2 enabled expression of a presumed full-length hamster TLR2 that conferred LPS responsiveness in human epithelial kidney 293 cells. Genomic TLR2 DNA from primary hamster macrophages also contained the frameshift mutation found in CHO fibroblasts. Nevertheless, hamster peritoneal macrophages were found to respond normally to LPS, as evidenced by the induction of cytokines. These results imply that expression of TLR2 is sufficient but not essential for mammalian responses to endotoxin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The responses of macrophages to bacterial products underlie the pathogenesis of many acute and chronic illnesses. One macrophage receptor that appears to play a central role in innate immune responses is CD14, a GPI-linked protein (1) that is also present as a functional soluble receptor (sCD14) in serum (2, 3). CD14 binds the lipid A portion of bacterial LPS and mediates a signaling cascade that results in the production of proinflammatory cytokines (4, 5, 6, 7). Despite the known function for CD14, this receptor has no transmembrane or cytoplasmic regions. Multiple lines of evidence suggested that CD14 is by itself incapable of transmembrane signal transduction (8, 9, 10).

Toll is a type I transmembrane receptor that was first identified in Drosophila melanogaster for its role in larval development (11). Toll activation in adult flies results in the activation of a NF-{kappa}B homologue known as dorsal and the subsequent production of antimicrobial peptides (reviewed in 12). At least five mammalian toll-like receptors (TLRs)3 have recently been described (13). The known role of Toll in a primitive immune system, as well as the homology with a mammalian proinflammatory receptor (14), made TLRs excellent candidates for a CD14-associated transmembrane signal transducer. Thus, when Yang (15) and Kirschning (16) independently observed that transfection of human TLR2 into human epithelial kidney (HEK) 293 cells rendered these otherwise LPS nonresponsive cells responsive to LPS, it appeared that the CD14-associated LPS signal transducer had finally been identified.

Almost simultaneously, an alternative TLR was proposed as a candidate for the CD14-associated signal transducer. Poltorak and colleagues mapped the Lps gene, which had been previously shown to be responsible for the LPS nonresponder phenotype in C3H/HeJ mice (17), to TLR4 (18). Sequence analysis of TLR4 from the C3H/HeJ mouse demonstrated a single point mutation at aa 712 (pro to his), which was proposed to change the function of the receptor (18) by suppressing TLR-mediated LPS-induced signals. The central role of TLR4 as the LPS signal transducer was strengthened by the observation that the LPS-resistant 10ScCr mouse was a null mutant for TLR4 (18, 19). However, to date, there is little functional data demonstrating how TLR4 might function as a receptor, nor whether it can function as a dominant negative suppressor, nor whether it signals cells by forming a complex with TLR2. Furthermore, the discovery of TLR2 has not been complemented by studies in genetically targeted mutant mice (knockout animals), an approach that often clarifies the in vivo significance of in vitro findings. Thus, the relative contribution of TLR2 to LPS responses seemed uncertain.

To define the LPS signal transduction pathway, we have focused on CD14-transfected Chinese hamster ovary (CHO)-K1 fibroblasts, which are exquisitely responsive to LPS (20) and relatively easy to manipulate genetically. Recently, we reported that we had successfully generated two mutant LPS nonresponder complementation groups derived from CHO/CD14 (21) and sought to determine whether either group contained mutations for TLR2 or TLR4. Surprisingly, wild-type CHO/CD14 cells did not contain a functional TLR2. Instead, sequencing revealed a frameshift mutation due to a dropped base in the N terminus, resulting in the introduction of a stop codon at aa 504. This mutation was not unique for CHO tumor cells, as LPS-responsive peritoneal macrophages from Chinese hamsters encoded the same mutant transcript, suggesting that hamsters do not express TLR2. We conclude that TLR2 is dispensable for LPS-initiated signal transduction.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell culture and Chinese hamster macrophages

Unless otherwise stated, all reagents were purchased from Sigma (St. Louis, MO). Protein-free ReLPS (Salmonella minnesota, strain R595) was a gift of Dr. N. Qureshi (Middleton Veterans Administration Hospital, Madison, WI). CHO/CD14 were engineered and grown as described (20). HEK 293 cells were maintained at Tularik, as described (22). Eight- to 10-wk-old female Chinese hamsters (Cytogen Research and Development, Boston, MA) were injected with sterile 3% thioglycollate solution. After 3 or 5 days, peritoneal exudate cells were collected by lavage with 10 ml RPMI 1640. After overnight incubation, adherent cells were stimulated with 10 ng LPS/ml in RPMI 1640 containing 10% FBS (Summit Biotechnology, Greeley, CO) for the indicated time points, and total RNA and genomic DNA were subsequently isolated (TriReagent; Molecular Research Center, Cincinnati, OH).

Cloning of CHO and mouse TLR2

A complementary DNA library was constructed from CHO/CD14 cells using the ZAP Express cDNA Gigapack III Gold cloning kit (Stratagene, La Jolla, CA). The RAW 264.7 cDNA library, generated with the same cloning kit, was a gift of Drs. N. Nagan and R.A. Zoeller (Boston University, Boston, MA).

The sequence of a mouse TLR2 expressed sequence tags clone (GenBank accession no. aa863729) was used to design PCR primers to generate a CHO-specific TLR2 PCR fragment of 169 bp from CHO cDNA. The screening of the cDNA libraries was performed according to the manufacturer’s instructions using either the 32P-labeled CHO-specific TLR2 DNA probe or the random-primed mouse EST clone. The GenBank accession numbers for CHO and mouse TLR2 are AF113614 and AF124741, respectively.

Expression plasmids

The human TLR2-Flag (pTLR2hu-F) and the pELAM-luc reporter plasmids have been previously described (16). Epitope-tag hamster TLR2 (pTLR2ham-F) was constructed by inserting PCR-generated full-length cDNA fragments lacking the N-terminal signal sequence (aa 1–18) into the mammalian expression vector pFLAG-CMV-1 (Sigma). Site-directed mutagenesis (QuikChange; Stratagene) was used to introduce an additional base A at position 1758 into the pTLR2ham-F plasmid (pTLR2ham-F/1758(+A)). The fidelity of the PCR, as well as the site-directed mutagenesis, was confirmed by sequence analysis.

NF–{kappa}B reporter assay

The NF–{kappa}B reporter assay in HEK 293 cells was performed as described (16). Each experiment was repeated at least twice.

RT-PCR

First, 1 µg of total RNA was reverse transcribed in a volume of 20 µl using Superscript II reverse transcriptase according to manufacturer’s protocol (Life Technologies, Grand Island, NY). Then, 2 µl of the resulting cDNA was used in a 25-µl PCR reaction as described (23). The PCR was conducted in an automatic thermal cycler (Hybaid, Franklin, MA) using primers for CHO-TLR2 (5'-GAGTGAGTGGTGCAAGTATGAAC and 5'-GGGCCACTCCAGGTAGGTCT), GAPDH (5'-GTCATCATCTCCGCCCCTTCTGC, 5'-GATGCCTGCTTCACCACCTTCTTG), multispecies IL-1ß (5'-GCATCCAGCTTCAAATCTCACA and 5'-AACCGCTTTTCCATCTTCTTCT), hamster IL-6, (5'-TTGGGAAATTTGCCTACTGAA, 5'AGGCATGACTATTTTATCTGGA), and multispecies TNF-{alpha}, (5'-GGGGCCACCACGCTCTTCTG and 5'-GGCAGGGGCTCTTGACGGC).Control PCR with total RNA preparations that were not subjected to reverse transcription revealed no genomic DNA contamination of the isolated RNA preparations (data not shown).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The recognition of the Toll receptor system is an extraordinary representation of a phylogenetically conserved cellular host defense system. Recent studies suggest that mammalian homologues of Toll appear to mediate the responses to diverse types of bacterial cell wall products including those from Gram-positive bacteria4 (28), spirochetes and mycobacteria (E. Lien et al., manuscript in preparation). Given the current knowledge about TLRs, it is difficult to understand how two similar receptors, such as TLR2 and TLR4, could apparently serve the same function. Additional genetic and biochemical evidence was certainly necessary. The approach of engineering a targeted deletion of either TLR2 or TLR4 into a mouse line, and characterizing the effect of a targeted lesion, was a reasonable priority.

The data presented herein appear to answer the question of whether TLR2 is essential for LPS-induced signal transduction, without the need to examine a knockout animal. The sensitive nature of LPS responses in CHO/CD14 cells has been well documented (e.g., Refs. 9, 20, and 24). Therefore, it is a reasonable assumption that if TLR2 were necessary for LPS signal transduction, CHO cells would express this gene product. A clone from a CHO/CD14 cell cDNA library was isolated using a CHO-TLR2-specific PCR fragment as a probe. The clone contained a 2813-bp cDNA fragment with 85% and 75% sequence identity to mouse and human TLR2 cDNA, respectively. Surprisingly, the sequence analysis of CHO-TLR2, when compared with TLR2 from humans and mice, revealed a frameshift mutation due to a dropped base at position 1758. This new frame introduced a stop codon 31 bases downstream from the mutation. Comparison of the deducted CHO-TLR2 protein sequence showed 80% identity to the mouse protein and 68% to the human protein (Fig. 1GoA).



View larger version (103K):
[in this window]
[in a new window]
 
FIGURE 1. Primary structure of Chinese hamster TLR2. A, Alignment of CHO, mouse (mo), and human (hu) TLR2 amino acid sequences. Identical residues are shaded. B, Sequence analysis of CHO and Chinese hamster TLR2 fragments, generated from different sources and using different polymerases. The location of the deletion is indicated by an arrow. The consensus sequence (Hamster TLR2) is compared with mouse and human TLR2. Identical amino acids are printed in bold. The protein sequence resulting from the frameshift is printed in italics. C, Graphic illustration of human and predicted hamster TLR2 primary structures.

 
To verify that the deletion at bp 1758 was not a peculiarity of the isolated cDNA clone, we used RT-PCR to sequence TLR2 transcripts derived from four unique CHO cell lines, including a CHO cell line obtained from another laboratory (provided by Drs. P. Tobias and R. Tapping, Scripps Research Institute, La Jolla, CA) using two different polymerases: pfu and Taq. In addition, we assessed the sequence of TLR2 transcripts from native Chinese hamster exudate macrophages. Finally, genomic DNA from Chinese hamsters was also used as a template for PCR and sequenced (Fig. 1GoB). In every case, the sequence showed the same frameshift mutation, clearly indicating that Chinese hamsters express a TLR2 mRNA that encodes for a truncated protein without transmembrane and intracellular signaling domains (Fig. 1GoC).

The sequence of hamster TLR2 indicated that the expressed protein was not likely to be a functional LPS receptor. We wanted to test this hypothesis and used a tissue culture system for analyzing LPS signaling components in HEK 293 cells, as described (16). Transient expression of a Flag-tagged human TLR2 expression plasmid (pTLR2hum-F) strongly activated a cotransfected NF–{kappa}B-dependent luciferase reporter gene construct when cells were exposed to 1 µg of LPS/ml (Fig. 2Go). Similarly, transient transfection with a mouse TLR2 expression plasmid (pTLR2mo) followed by LPS exposure resulted in induced luciferase activity. In contrast, neither the hamster TLR2 (pTLR2ham) nor the Flag-tagged hamster TLR2 (pTLR2ham-F) constructs conferred responsiveness to LPS (Fig. 2Go).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. LPS-induces NF-{kappa}B-activation through mouse and human, but not hamster, TLR2. HEK 293 cells were transfected with 1 µg of the indicated TLR2 plasmids or a control plasmid (pRK) together with ELAM-1 luciferase reporter plasmid as described (16). After 24 hours, 1 µg of LPS/ml was added to monolayers. After a subsequent incubation of 6 h, induced luciferase activity was determined. White bars represent cells that were untreated, and solid bars are cells stimulated with LPS.

 
Sequence analysis of hamster-derived TLR2 predicted that insertion of the proper base pair into the cDNA would result in expression of a full-length TLR2 protein identical in length to mouse or human TLR2. We thus "repaired" the hamster TLR2 by adding a single base A at position 1758 through site-directed mutagenesis and tested the new construct (pTLR2ham-F/1758(+A)) in HEK 293 cells. The "repaired" construct now was able to confer responsiveness to LPS similar to human and mouse TLR2 (Fig. 3Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. "Repair" of hamster TLR2 restores activity as an LPS signal transducer. HEK 293 cells were cotransfected as in Fig. 2Go with epitope tagged hamster TLR2 (pTLR2ham-F), a "repaired" version of the cDNA (pTLR2ham-F/1758(+A)), which encodes for a full-length protein, or an empty vector together with pELAM-luc. After allowing 24 h for protein expression to occur, responses to a 6-h incubation in 1 µg of LPS/ml were determined by assessing induced luciferase activity. White bars represent cells that were untreated, and solid bars are cells stimulated with LPS.

 
In view of our observation that hamster TLR2 was nonfunctional and that the identical mutant mRNA was expressed in native hamster cells and CHO tumor cells, we investigated if TLR2-null peritoneal macrophages from Chinese hamster would show impaired responses when stimulated with LPS. Macrophages from mice typically respond to exposure to nanogram per milliliter concentrations of LPS by up-regulating the expression of cytokine genes (6). Therefore, hamster peritoneal macrophages were stimulated for 0, 1, or 4 h with 10 ng of LPS/ml. We then used RT-PCR to analyze the LPS-induced levels of IL-1ß, IL-6, and TNF-{alpha} mRNA. Unstimulated cells expressed almost undetectable levels of IL-1ß mRNA and low levels of IL-6 and TNF-{alpha} (Fig. 4Go). Stimulation with LPS induced up-regulation of IL-1ß, IL-6, and TNF-{alpha} mRNA, indicating that hamsters are in fact normally responsive to LPS compared with other mammalian species.



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 4. LPS induces cytokine gene expression in TLR2-null Chinese hamster peritoneal macrophages. Chinese hamster peritoneal macrophages were stimulated with 10 ng of LPS/ml for the indicated times. Expression of GAPDH (upper left), IL-1ß (upper right), IL-6 (bottom left), and TNF-{alpha} (bottom right) was analyzed by RT-PCR.

 
One possible interpretation of the data presented here, in light of the findings of Poltorak et al. (18), is that different species of animals may use different Toll proteins to respond to LPS. The findings in LPS nonresponder mice strongly argue for an absolute requirement of TLR4 expression for mice to respond to LPS; we have also cloned TLR4 from the hamster, and it appears to be normal (H.H., unpublished observations), suggesting that this gene may in fact be used by hamsters as well for LPS signal transduction. As of today, no similar data on naturally occurring mutants is available to determine whether either TLR2 or TLR4 is essential for LPS responses in man, although an LPS nonresponder human patient has been reported (25). Several reports over the past decade have described species-specific effects of lipid A analogues. For example, the tetraacyl bis-phosphate precursor of lipid A, lipid IVa (also known as compound 406), is a potent LPS antagonist when tested with human macrophages and an LPS mimetic when tested with mouse or hamster macrophages (8, 26, 27). In contrast, Rhodobacter sphaeroides lipid A is an LPS antagonist in human and mouse cells, but not in hamster cells (9). This complex pharmacology of the LPS antagonists has been attributed to species-specific differences in the primary structure of the LPS receptor (9). If different species of animals use different Toll molecules as signal transducers, then the pharmacology of these analogues should be defined by the species of Toll protein that is predominantly expressed. TLRs 2 and 4 have now been cloned from human, mouse, and hamster. Additional experiments with these genes are necessary to reveal which TLR is truly dominant for LPS signal transduction.

We conclude that Chinese hamsters contain a nonfunctional version of TLR2 and that TLR2 does not appear to be necessary for LPS responses, though its expression imparts responsiveness to LPS in a CD14-dependent manner (16). How the existence of multiple LPS receptors impacts upon the biology of responses to LPS is unclear. However, with the identification of the TLRs as receptors for LPS and other bacterial products, the tools to define the signal transduction apparatus are clearly at hand, and we anticipate rapid progress in understanding LPS signaling in the near future. In this way, targeted therapy for sepsis and other LPS-mediated diseases can be designed.


    Footnotes
 
1 D.T.G. and H.H. are supported by National Institutes of Health Grants GM54060 and AI38515. E.L. is supported by The Norwegian Cancer Society and The Research Council of Norway. Back

2 Address correspondence and reprint requests to Dr. Douglas Golenbock, The Maxwell Finland Laboratory for Infectious Diseases, 774 Albany Street, Boston, MA 02118, E-mail address: Back

3 Abbreviations used in this paper: TLR, toll-like receptor; CHO, Chinese hamster ovary fibroblast; HEK, human epithelial kidney. Back

4 R. Schwandner, R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2. Submitted for publication. Back

Received for publication March 25, 1999. Accepted for publication April 20, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Haziot, A., E. Chen, E. Ferrero, M. G. Low, R. Silber, S. M. Goyert. 1988. The monocytic differentiation antigen, CD14, is anchored to the cell by a phosphatidylinositol linkage. J. Immunol. 141:547.[Abstract]
  2. Bazil, V., V. Horejsi, M. Baudys, H. Kristofova, J. L. Strominger, W. Kostka, I. Hilgert. 1986. Biochemical characterization of a soluble form of the 53-kDa monocyte surface antigen. Eur. J. Immunol. 16:1583.[Medline]
  3. Frey, E. A., D. S. Miller, T. G. Jahr, A. Sundan, V. Bazil, T. Espevik, B. B. Finlay, S. D. Wright. 1992. Soluble CD14 participates in the response of cells to lipopolysaccharide. J. Exp. Med. 176:1665.[Abstract/Free Full Text]
  4. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, J. C. Mathison. 1990. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science 249:1431.[Abstract/Free Full Text]
  5. Morrison, D. C., J. L. Ryan. 1987. Endotoxins and disease mechanisms. Annu. Rev. Med. 38:417.[Medline]
  6. Vogel, S. N., M. M. Hogan. 1990. Role of cytokines in endotoxin-mediated host responses. J. J. Oppenheim, and E. M. Shevach, eds. Immunophysiology: The Role of Cells and Cytokines in Immunity and Inflammation 238. Oxford University Press, Oxford.
  7. Rietschel, E. T., H. Brade. 1992. Bacterial endotoxins. Sci. Am. 267:54.[Medline]
  8. Kitchens, R. L., R. J. Ulevitch, R. S. Munford. 1992. Lipopolysaccharide (LPS) partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway. J. Exp. Med. 176:485.[Abstract/Free Full Text]
  9. Delude, R. L., Jr R. Savedra, H. Zhao, R. Thieringer, S. Yamamoto, M. J. Fenton, D. T. Golenbock. 1995. CD14 enhances cellular responses to endotoxin without imparting ligand-specific recognition. Proc. Natl. Acad. Sci. USA 92:9288.[Abstract/Free Full Text]
  10. Haziot, A., E. Ferrero, F. Kontgen, N. Hijiya, S. Yamamoto, J. Silver, C. L. Stewart, S. M. Goyert. 1996. Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice. Immunity 4:407.[Medline]
  11. Anderson, K. V., L. Bokla, C. Nusslein-Volhard. 1985. Establishment of dorsal-ventral polarity in the Drosophila embryo: the induction of polarity by the Toll gene product. Cell 42:791.[Medline]
  12. Belvin, M. P., K. V. Anderson. 1996. A conserved signaling pathway: the Drosophila toll-dorsal pathway. Annu. Rev. Cell Dev. Biol. 12:393.[Medline]
  13. Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, J. F. Bazan. 1998. A family of human receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 95:588.[Abstract/Free Full Text]
  14. Medzhitov, R., P. Preston-Hurlburt, Jr C. A. Janeway. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
  15. Yang, R. B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature 395:284.[Medline]
  16. Kirschning, C. J., H. Wesche, T. Merrill Ayres, M. Rothe. 1998. Human toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J. Exp. Med. 188:2091.[Abstract/Free Full Text]
  17. Sultzer, B. M.. 1968. Genetic control of leucocyte responses to endotoxin. Nature 219:1253.[Medline]
  18. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, B. Beutler. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  19. Qureshi, S. T., L. Larivi{theta}re, G. Leveque, S. Clermont, K. J. Moore, P. Gros, D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189:615.[Abstract/Free Full Text]
  20. Golenbock, D. T., Y. Liu, F. H. Millham, M. W. Freeman, R. A. Zoeller. 1993. Surface expression of human CD14 in Chinese hamster ovary fibroblasts imparts macrophage-like responsiveness to bacterial endotoxin. J. Biol. Chem. 268:22055.[Abstract/Free Full Text]
  21. Delude, R. L., A. Yoshimura, R. R. Ingalls, D. T. Golenbock. 1998. Construction of a lipopolysaccharide reporter cell line and its use in identifying mutants defective in endotoxin, but not TNF-{alpha}, signal transduction. J. Immunol. 161:3001.[Abstract/Free Full Text]
  22. Hsu, H., J. Xiong, D. V. Goeddel. 1995. The TNF receptor 1-associated protein TRADD signals cell death and NF-{kappa}B activation. Cell 81:495.[Medline]
  23. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487.[Abstract/Free Full Text]
  24. Delude, R. L., M. J. Fenton, Jr R. Savedra, P. Y. Perera, S. N. Vogel, R. Thieringer, D. T. Golenbock. 1994. CD14-mediated translocation of nuclear factor-{kappa}B induced by lipopolysaccharide does not require tyrosine kinase activity. J. Biol. Chem. 269:22253.[Abstract/Free Full Text]
  25. Kuhns, D. B., D. A. Long Priel, J. I. Gallin. 1997. Endotoxin and IL-1 hyporesponsiveness in a patient with recurrent bacterial infections. J. Immunol. 158:3959.[Abstract]
  26. Golenbock, D. T., R. Y. Hampton, N. Qureshi, K. Takayama, C. R. Raetz. 1991. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. J. Biol. Chem. 266:19490.[Abstract/Free Full Text]
  27. Heine, H., H. Brade, S. Kusumoto, T. Kusama, E. T. Rietschel, H.-D. Flad, A. J. Ulmer. 1994. Inhibition of LPS binding on human monocytes by phosphonooxyethyl analogs of lipid A. J. Endotox. Res. 1:14.
  28. Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuamanen, R. Dziarski, and D. T. Golenbock. 1999. Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. In press.



This article has been cited by other articles:


Home page
J. Neurosci.Home page
E. G. Reed-Geaghan, J. C. Savage, A. G. Hise, and G. E. Landreth
CD14 and Toll-Like Receptors 2 and 4 Are Required for Fibrillar A{beta}-Stimulated Microglial Activation
J. Neurosci., September 23, 2009; 29(38): 11982 - 11992.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
S. Weiss, H. Levy, M. Fisher, D. Kobiler, and Z. Altboum
Involvement of TLR2 in innate response to Bacillus anthracis infection
Innate Immunity, February 1, 2009; 15(1): 43 - 51.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
G. Hajishengallis, M. Wang, E. Harokopakis, M. Triantafilou, and K. Triantafilou
Porphyromonas gingivalis Fimbriae Proactively Modulate {beta}2 Integrin Adhesive Activity and Promote Binding to and Internalization by Macrophages.
Infect. Immun., October 1, 2006; 74(10): 5658 - 5666.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. M. Andersen, D. Al-Khairy, and R. R. Ingalls
Innate Immunity at the Mucosal Surface: Role of Toll-Like Receptor 3 and Toll-Like Receptor 9 in Cervical Epithelial Cell Responses to Microbial Pathogens
Biol Reprod, May 1, 2006; 74(5): 824 - 831.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Totemeyer, M. Sheppard, A. Lloyd, D. Roper, C. Dowson, D. Underhill, P. Murray, D. Maskell, and C. Bryant
IFN-{gamma} Enhances Production of Nitric Oxide from Macrophages via a Mechanism That Depends on Nucleotide Oligomerization Domain-2.
J. Immunol., April 15, 2006; 176(8): 4804 - 4810.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. Schmeck, S. Huber, K. Moog, J. Zahlten, A. C. Hocke, B. Opitz, S. Hammerschmidt, T. J. Mitchell, M. Kracht, S. Rosseau, et al.
Pneumococci induced TLR- and Rac1-dependent NF-{kappa}B-recruitment to the IL-8 promoter in lung epithelial cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L730 - L737.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Fan, Y. Li, Y. Vodovotz, T. R. Billiar, and M. A. Wilson
Hemorrhagic shock-activated neutrophils augment TLR4 signaling-induced TLR2 upregulation in alveolar macrophages: role in hemorrhage-primed lung inflammation
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L738 - L746.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. E. Thomas, A. Sapone, A. Fasano, and S. N. Vogel
Gliadin Stimulation of Murine Macrophage Inflammatory Gene Expression and Intestinal Permeability Are MyD88-Dependent: Role of the Innate Immune Response in Celiac Disease
J. Immunol., February 15, 2006; 176(4): 2512 - 2521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg
Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens
J. Immunol., November 15, 2005; 175(10): 6772 - 6785.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. D. Savov, D. M. Brass, B. L. Lawson, E. McElvania-Tekippe, J. K. L. Walker, and D. A. Schwartz
Toll-like receptor 4 antagonist (E5564) prevents the chronic airway response to inhaled lipopolysaccharide
Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L329 - L337.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. A. Steiner, S. Chakravarty, J. R. Robbins, A. S. Dragic, J. Pan, M. Herkenham, and A. A. Romanovsky
Thermoregulatory responses of rats to conventional preparations of lipopolysaccharide are caused by lipopolysaccharide per se-- not by lipoprotein contaminants
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R348 - R352.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
B. Fournier and D. J. Philpott
Recognition of Staphylococcus aureus by the Innate Immune System
Clin. Microbiol. Rev., July 1, 2005; 18(3): 521 - 540.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Sendide, N. E. Reiner, J. S. I. Lee, S. Bourgoin, A. Talal, and Z. Hmama
Cross-Talk between CD14 and Complement Receptor 3 Promotes Phagocytosis of Mycobacteria: Regulation by Phosphatidylinositol 3-Kinase and Cytohesin-1
J. Immunol., April 1, 2005; 174(7): 4210 - 4219.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. C. O'Brien, J. H. Wang, and H. P. Redmond
Bacterial Lipoprotein Induces Resistance to Gram-Negative Sepsis in TLR4-Deficient Mice via Enhanced Bacterial Clearance
J. Immunol., January 15, 2005; 174(2): 1020 - 1026.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Grabiec, G. Meng, S. Fichte, W. Bessler, H. Wagner, and C. J. Kirschning
Human but Not Murine Toll-like Receptor 2 Discriminates between Tri-palmitoylated and Tri-lauroylated Peptides
J. Biol. Chem., November 12, 2004; 279(46): 48004 - 48012.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. Mandell, A. P. Moran, A. Cocchiarella, J. Houghton, N. Taylor, J. G. Fox, T. C. Wang, and E. A. Kurt-Jones
Intact Gram-Negative Helicobacter pylori, Helicobacter felis, and Helicobacter hepaticus Bacteria Activate Innate Immunity via Toll-Like Receptor 2 but Not Toll-Like Receptor 4
Infect. Immun., November 1, 2004; 72(11): 6446 - 6454.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Nilsen, U. Nonstad, N. Khan, C. F. Knetter, S. Akira, A. Sundan, T. Espevik, and E. Lien
Lipopolysaccharide and Double-stranded RNA Up-regulate Toll-like Receptor 2 Independently of Myeloid Differentiation Factor 88
J. Biol. Chem., September 17, 2004; 279(38): 39727 - 39735.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. W. J. Schroder, H. Heine, C. Alexander, M. Manukyan, J. Eckert, L. Hamann, U. B. Gobel, and R. R. Schumann
Lipopolysaccharide Binding Protein Binds to Triacylated and Diacylated Lipopeptides and Mediates Innate Immune Responses
J. Immunol., August 15, 2004; 173(4): 2683 - 2691.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Hasebe, A. Yoshimura, T. Into, H. Kataoka, S. Tanaka, S. Arakawa, H. Ishikura, D. T. Golenbock, T. Sugaya, N. Tsuchida, et al.
Biological Activities of Bacteroides forsythus Lipoproteins and Their Possible Pathological Roles in Periodontal Disease
Infect. Immun., March 1, 2004; 72(3): 1318 - 1325.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. N. Cunningham, Y. Wang, R. Guo, G. He, and R. J. Quigg
Role of Toll-Like Receptor 4 in Endotoxin-Induced Acute Renal Failure
J. Immunol., February 15, 2004; 172(4): 2629 - 2635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Meng, A. Grabiec, M. Vallon, B. Ebe, S. Hampel, W. Bessler, H. Wagner, and C. J. Kirschning
Cellular Recognition of Tri-/Di-palmitoylated Peptides Is Independent from a Domain Encompassing the N-terminal Seven Leucine-rich Repeat (LRR)/LRR-like Motifs of TLR2
J. Biol. Chem., October 10, 2003; 278(41): 39822 - 39829.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Sau, S. S. Mambula, E. Latz, P. Henneke, D. T. Golenbock, and S. M. Levitz
The Antifungal Drug Amphotericin B Promotes Inflammatory Cytokine Release by a Toll-like Receptor- and CD14-dependent Mechanism
J. Biol. Chem., September 26, 2003; 278(39): 37561 - 37568.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Muroi, T. Ohnishi, S. Azumi-Mayuzumi, and K.-i. Tanamoto
Lipopolysaccharide-Mimetic Activities of a Toll-Like Receptor 2-Stimulatory Substance(s) in Enterobacterial Lipopolysaccharide Preparations
Infect. Immun., June 1, 2003; 71(6): 3221 - 3226.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. W. J. Schroder, S. Morath, C. Alexander, L. Hamann, T. Hartung, U. Zahringer, U. B. Gobel, J. R. Weber, and R. R. Schumann
Lipoteichoic Acid (LTA) of Streptococcus pneumoniae and Staphylococcus aureus Activates Immune Cells via Toll-like Receptor (TLR)-2, Lipopolysaccharide-binding Protein (LBP), and CD14, whereas TLR-4 and MD-2 Are Not Involved
J. Biol. Chem., April 25, 2003; 278(18): 15587 - 15594.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P.-Y. Bochud, T. R. Hawn, and A. Aderem
Cutting Edge: A Toll-Like Receptor 2 Polymorphism That Is Associated with Lepromatous Leprosy Is Unable to Mediate Mycobacterial Signaling
J. Immunol., April 1, 2003; 170(7): 3451 - 3454.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Malley, P. Henneke, S. C. Morse, M. J. Cieslewicz, M. Lipsitch, C. M. Thompson, E. Kurt-Jones, J. C. Paton, M. R. Wessels, and D. T. Golenbock
Recognition of pneumolysin by Toll-like receptor 4 confers resistance to pneumococcal infection
PNAS, February 18, 2003; 100(4): 1966 - 1971.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Dobrovolskaia, A. E. Medvedev, K. E. Thomas, N. Cuesta, V. Toshchakov, T. Ren, M. J. Cody, S. M. Michalek, N. R. Rice, and S. N. Vogel
Induction of In Vitro Reprogramming by Toll-Like Receptor (TLR)2 and TLR4 Agonists in Murine Macrophages: Effects of TLR "Homotolerance" Versus "Heterotolerance" on NF-{kappa}B Signaling Pathway Components
J. Immunol., January 1, 2003; 170(1): 508 - 519.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. D. Savov, S. H. Gavett, D. M. Brass, D. L. Costa, and D. A. Schwartz
Neutrophils play a critical role in development of LPS-induced airway disease
Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L952 - L962.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. E. Medvedev, A. Lentschat, L. M. Wahl, D. T. Golenbock, and S. N. Vogel
Dysregulation of LPS-Induced Toll-Like Receptor 4-MyD88 Complex Formation and IL-1 Receptor-Associated Kinase 1 Activation in Endotoxin-Tolerant Cells
J. Immunol., November 1, 2002; 169(9): 5209 - 5216.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Muroi, T. Ohnishi, and K.-i. Tanamoto
Regions of the Mouse CD14 Molecule Required for Toll-like Receptor 2- and 4-mediated Activation of NF-kappa B
J. Biol. Chem., October 25, 2002; 277(44): 42372 - 42379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. H. Wang, M. Doyle, B. J. Manning, Q. Di Wu, S. Blankson, and H. P. Redmond
Induction of Bacterial Lipoprotein Tolerance Is Associated with Suppression of Toll-like Receptor 2 Expression
J. Biol. Chem., September 20, 2002; 277(39): 36068 - 36075.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Le Cabec, S. Carreno, A. Moisand, C. Bordier, and I. Maridonneau-Parini
Complement Receptor 3 (CD11b/CD18) Mediates Type I and Type II Phagocytosis During Nonopsonic and Opsonic Phagocytosis, Respectively
J. Immunol., August 15, 2002; 169(4): 2003 - 2009.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Andonegui, S. M. Goyert, and P. Kubes
Lipopolysaccharide-Induced Leukocyte-Endothelial Cell Interactions: A Role for CD14 Versus Toll-Like Receptor 4 Within Microvessels
J. Immunol., August 15, 2002; 169(4): 2111 - 2119.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. A. Kurt-Jones, L. Mandell, C. Whitney, A. Padgett, K. Gosselin, P. E. Newburger, and R. W. Finberg
Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils
Blood, August 13, 2002; 100(5): 1860 - 1868.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. A. Gasper, C. C. Petty, L. W. Schrum, I. Marriott, and K. L. Bost
Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4
Infect. Immun., August 1, 2002; 70(8): 4075 - 4082.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Liu, D. J. Gallo, A. M. Green, D. L. Williams, X. Gong, R. A. Shapiro, A. A. Gambotto, E. L. Humphris, Y. Vodovotz, and T. R. Billiar
Role of Toll-Like Receptors in Changes in Gene Expression and NF-{kappa}B Activation in Mouse Hepatocytes Stimulated with Lipopolysaccharide
Infect. Immun., July 1, 2002; 70(7): 3433 - 3442.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-K. Lee, J. Lee, and P. S. Tobias
Two Lipoproteins Extracted from Escherichia coli K-12 LCD25 Lipopolysaccharide Are the Major Components Responsible for Toll-Like Receptor 2-Mediated Signaling
J. Immunol., April 15, 2002; 168(8): 4012 - 4017.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. P. Darveau, S. Arbabi, I. Garcia, B. Bainbridge, and R. V. Maier
Porphyromonas gingivalis Lipopolysaccharide Is Both Agonist and Antagonist for p38 Mitogen-Activated Protein Kinase Activation
Infect. Immun., April 1, 2002; 70(4): 1867 - 1873.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Watters, J. A. Sommer, Z. A. Pfeiffer, U. Prabhu, A. N. Guerra, and P. J. Bertics
A Differential Role for the Mitogen-activated Protein Kinases in Lipopolysaccharide Signaling. THE MEK/ERK PATHWAY IS NOT ESSENTIAL FOR NITRIC OXIDE AND INTERLEUKIN 1beta PRODUCTION
J. Biol. Chem., March 8, 2002; 277(11): 9077 - 9087.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Vasselon and P. A. Detmers
Toll Receptors: a Central Element in Innate Immune Responses
Infect. Immun., March 1, 2002; 70(3): 1033 - 1041.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Fox-Marsh and L. C. Harrison
Emerging evidence that molecules expressed by mammalian tissue grafts are recognized by the innate immune system
J. Leukoc. Biol., March 1, 2002; 71(3): 401 - 409.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Massari, P. Henneke, Y. Ho, E. Latz, D. T. Golenbock, and L. M. Wetzler
Cutting Edge: Immune Stimulation by Neisserial Porins Is Toll-Like Receptor 2 and MyD88 Dependent
J. Immunol., February 15, 2002; 168(4): 1533 - 1537.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Yoshimura, T. Kaneko, Y. Kato, D. T. Golenbock, and Y. Hara
Lipopolysaccharides from Periodontopathic Bacteria Porphyromonas gingivalis and Capnocytophaga ochracea Are Antagonists for Human Toll-Like Receptor 4
Infect. Immun., January 1, 2002; 70(1): 218 - 225.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Henneke, O. Takeuchi, J. A. van Strijp, H.-K. Guttormsen, J. A. Smith, A. B. Schromm, T. A. Espevik, S. Akira, V. Nizet, D. L. Kasper, et al.
Novel Engagement of CD14 and Multiple Toll-Like Receptors by Group B Streptococci
J. Immunol., December 15, 2001; 167(12): 7069 - 7076.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Prebeck, C. Kirschning, S. Durr, C. da Costa, B. Donath, K. Brand, V. Redecke, H. Wagner, and T. Miethke
Predominant Role of Toll-Like Receptor 2 Versus 4 in Chlamydia pneumoniae-Induced Activation of Dendritic Cells
J. Immunol., September 15, 2001; 167(6): 3316 - 3323.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Supajatura, H. Ushio, A. Nakao, K. Okumura, C. Ra, and H. Ogawa
Protective Roles of Mast Cells Against Enterobacterial Infection Are Mediated by Toll-Like Receptor 4
J. Immunol., August 15, 2001; 167(4): 2250 - 2256.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel
Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4
J. Immunol., August 15, 2001; 167(4): 2257 - 2267.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. B. Schromm, E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, et al.
Molecular Genetic Analysis of an Endotoxin Nonresponder Mutant Cell Line: A Point Mutation in a Conserved Region of Md-2 Abolishes Endotoxin-Induced Signaling
J. Exp. Med., July 2, 2001; 194(1): 79 - 88.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Liu, Y. Wang, M. Yamakuchi, S. Isowaki, E. Nagata, Y. Kanmura, I. Kitajima, and I. Maruyama
Upregulation of Toll-Like Receptor 2 Gene Expression in Macrophage Response to Peptidoglycan and High Concentration of Lipopolysaccharide Is Involved in NF-{kappa}B Activation
Infect. Immun., May 1, 2001; 69(5): 2788 - 2796.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
B. Beutler and A. Poltorak
The Sole Gateway to Endotoxin Response: How Lps Was Identified as Tlr4, and Its Role in Innate Immunity
Drug Metab. Dispos., April 1, 2001; 29(4): 474 - 478.
[Abstract] [Full Text]


Home page
Infect. Immun.Home page
R. R. Ingalls, E. Lien, and D. T. Golenbock
Membrane-Associated Proteins of a Lipopolysaccharide-Deficient Mutant of Neisseria meningitidis Activate the Inflammatory Response through Toll-Like Receptor 2
Infect. Immun., April 1, 2001; 69(4): 2230 - 2236.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. Chakravortty, Y. Kato, T. Sugiyama, N. Koide, M. M. Mu, T. Yoshida, and T. Yokochi
Inhibition of p38 Mitogen-Activated Protein Kinase Augments Lipopolysaccharide-Induced Cell Proliferation in CD14-Expressing Chinese Hamster Ovary Cells
Infect. Immun., February 1, 2001; 69(2): 931 - 936.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. L. S. George, H. Jin, C. L. Wohlford-Lenane, M. E. O'Neill, J. C. Phipps, P. O'Shaughnessy, J. N. Kline, P. S. Thorne, and D. A. Schwartz
Endotoxin responsiveness and subchronic grain dust-induced airway disease
Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L203 - L213.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Dziarski, Q. Wang, K. Miyake, C. J. Kirschning, and D. Gupta
MD-2 Enables Toll-Like Receptor 2 (TLR2)-Mediated Responses to Lipopolysaccharide and Enhances TLR2-Mediated Responses to Gram-Positive and Gram-Negative Bacteria and Their Cell Wall Components
J. Immunol., February 1, 2001; 166(3): 1938 - 1944.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Faure, L. Thomas, H. Xu, A. E. Medvedev, O. Equils, and M. Arditi
Bacterial Lipopolysaccharide and IFN-{{gamma}} Induce Toll-Like Receptor 2 and Toll-Like Receptor 4 Expression in Human Endothelial Cells: Role of NF-{{kappa}}B Activation
J. Immunol., February 1, 2001; 166(3): 2018 - 2024.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Haziot, N. Hijiya, S. C. Gangloff, J. Silver, and S. M. Goyert
Induction of a Novel Mechanism of Accelerated Bacterial Clearance by Lipopolysaccharide in CD14-Deficient and Toll-Like Receptor 4-Deficient Mice
J. Immunol., January 15, 2001; 166(2): 1075 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. A. Bouis, T. G. Popova, A. Takashima, and M. V. Norgard
Dendritic Cells Phagocytose and Are Activated by Treponema pallidum
Infect. Immun., January 1, 2001; 69(1): 518 - 528.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P.-Y. Perera, T. N. Mayadas, O. Takeuchi, S. Akira, M. Zaks-Zilberman, S. M. Goyert, and S. N. Vogel
CD11b/CD18 Acts in Concert with CD14 and Toll-Like Receptor (TLR) 4 to Elicit Full Lipopolysaccharide and Taxol-Inducible Gene Expression
J. Immunol., January 1, 2001; 166(1): 574 - 581.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. H. Wyllie, E. Kiss-Toth, A. Visintin, S. C. Smith, S. Boussouf, D. M. Segal, G. W. Duff, and S. K. Dower
Evidence for an Accessory Protein Function for Toll-Like Receptor 1 in Anti-Bacterial Responses
J. Immunol., December 15, 2000; 165(12): 7125 - 7132.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. H. Flo, L. Ryan, L. Kilaas, G. Skjak-Brak, R. R. Ingalls, A. Sundan, D. T. Golenbock, and T. Espevik
Involvement of CD14 and beta 2-Integrins in Activating Cells with Soluble and Particulate Lipopolysaccharides and Mannuronic Acid Polymers
Infect. Immun., December 1, 2000; 68(12): 6770 - 6776.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. Cario and D. K. Podolsky
Differential Alteration in Intestinal Epithelial Cell Expression of Toll-Like Receptor 3 (TLR3) and TLR4 in Inflammatory Bowel Disease
Infect. Immun., December 1, 2000; 68(12): 7010 - 7017.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. I. Tapping, S. Akashi, K. Miyake, P. J. Godowski, and P. S. Tobias
Toll-Like Receptor 4, But Not Toll-Like Receptor 2, Is a Signaling Receptor for Escherichia and Salmonella Lipopolysaccharides
J. Immunol., November 15, 2000; 165(10): 5780 - 5787.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. Lorenz, J. P. Mira, K. L. Cornish, N. C. Arbour, and D. A. Schwartz
A Novel Polymorphism in the Toll-Like Receptor 2 Gene and Its Potential Association with Staphylococcal Infection
Infect. Immun., November 1, 2000; 68(11): 6398 - 6401.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
A. Ozinsky, K.D. Smith, D. Hume, and D.M. Underhill
Co-operative induction of pro-inflammatory signaling by Toll-like receptors
Innate Immunity, October 1, 2000; 6(5): 393 - 396.
[Abstract] [PDF]


Home page
Innate ImmunityHome page
R. Dziarski and D. Gupta
Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes
Innate Immunity, October 1, 2000; 6(5): 401 - 405.
[Abstract] [PDF]


Home page
Innate ImmunityHome page
R. R. Ingalls, E. Lien, and D. T. Golenbock
Differential roles of TLR2 and TLR4 in the host response to Gram-negative bacteria: lessons from a lipopolysaccharide-deficient mutant of Neisseria meningitidis
Innate Immunity, October 1, 2000; 6(5): 411 - 415.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
M. G. Lei and D. C. Morrison
Differential Expression of Caveolin-1 in Lipopolysaccharide-Activated Murine Macrophages
Infect. Immun., September 1, 2000; 68(9): 5084 - 5089.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. W. J. Schroder, B. Opitz, N. Lamping, K. S. Michelsen, U. Zahringer, U. B. Gobel, and R. R. Schumann
Involvement of Lipopolysaccharide Binding Protein, CD14, and Toll-Like Receptors in the Initiation of Innate Immune Responses by Treponema Glycolipids
J. Immunol., September 1, 2000; 165(5): 2683 - 2693.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
L. A. J. O'Neill
The Interleukin-1 Receptor/Toll-like Receptor Superfamily: Signal Transduction During Inflammation and Host Defense
Sci. Signal., August 8, 2000; 2000(44): re1 - re1.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Fujihara, S. Wakamoto, T. Ito, M. Muroi, T. Suzuki, H. Ikeda, and K. Ikebuchi
Lipopolysaccharide-triggered desensitization of TNF-{alpha} mRNA expression involves lack of phosphorylation of I{kappa}B{alpha} in a murine macrophage-like cell line, P388D1
J. Leukoc. Biol., August 1, 2000; 68(2): 267 - 276.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
M. Hirschfeld, Y. Ma, J. H. Weis, S. N. Vogel, and J. J. Weis
Cutting Edge: Repurification of Lipopolysaccharide Eliminates Signaling Through Both Human and Murine Toll-Like Receptor 2
J. Immunol., July 15, 2000; 165(2): 618 - 622.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Scholz, K. Cartledge, and A. R. Dunn
Hck Enhances the Adherence of Lipopolysaccharide-stimulated Macrophages via Cbl and Phosphatidylinositol 3-Kinase
J. Biol. Chem., May 5, 2000; 275(19): 14615 - 14623.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Faure, O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, and M. Arditi
Bacterial Lipopolysaccharide Activates NF-kappa B through Toll-like Receptor 4 (TLR-4) in Cultured Human Dermal Endothelial Cells. DIFFERENTIAL EXPRESSION OF TLR-4 AND TLR-2 IN ENDOTHELIAL CELLS
J. Biol. Chem., April 6, 2000; 275(15): 11058 - 11063.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. A. Thomas, R. L. Modlin, H. D. Brightbill, and P. J. Godowski
Toll Genes and Responsiveness to Bacterial Endotoxins
N. Engl. J. Med., March 2, 2000; 342(9): 664 - 665.
[Full Text]


Home page
J. Immunol.Home page
A. M. Soler-Rodriguez, H. Zhang, H. S. Lichenstein, N. Qureshi, D. W. Niesel, S. E. Crowe, J. W. Peterson, and G. R. Klimpel
Neutrophil Activation by Bacterial Lipoprotein Versus Lipopolysaccharide: Differential Requirements for Serum and CD14
J. Immunol., March 1, 2000; 164(5): 2674 - 2683.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. H. Flo, O. Halaas, E. Lien, L. Ryan, G. Teti, D. T. Golenbock, A. Sundan, and T. Espevik
Human Toll-Like Receptor 2 Mediates Monocyte Activation by Listeria monocytogenes, But Not by Group B Streptococci or Lipopolysaccharide
J. Immunol., February 15, 2000; 164(4): 2064 - 2069.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Matsuguchi, K. Takagi, T. Musikacharoen, and Y. Yoshikai
Gene expressions of lipopolysaccharide receptors, toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes
Blood, February 15, 2000; 95(4): 1378 - 1385.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Ohashi, V. Burkart, S. Flohe, and H. Kolb
Cutting Edge: Heat Shock Protein 60 Is a Putative Endogenous Ligand of the Toll-Like Receptor-4 Complex
J. Immunol., January 15, 2000; 164(2): 558 - 561.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Cario, I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H.-C. Reinecker, and D. K. Podolsky
Lipopolysaccharide Activates Distinct Signaling Pathways in Intestinal Epithelial Cell Lines Expressing Toll-Like Receptors
J. Immunol., January 15, 2000; 164(2): 966 - 972.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Kol, A. H. Lichtman, R. W. Finberg, P. Libby, and E. A. Kurt-Jones
Cutting Edge: Heat Shock Protein (HSP) 60 Activates the Innate Immune Response: CD14 Is an Essential Receptor for HSP60 Activation of Mononuclear Cells
J. Immunol., January 1, 2000; 164(1): 13 - 17.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Means, E. Lien, A. Yoshimura, S. Wang, D. T. Golenbock, and M. J. Fenton
The CD14 Ligands Lipoarabinomannan and Lipopolysaccharide Differ in Their Requirement for Toll-Like Receptors
J. Immunol., December 15, 1999; 163(12): 6748 - 6755.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. M. Underhill, A. Ozinsky, K. D. Smith, and A. Aderem
Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages
PNAS, December 7, 1999; 96(25): 14459 - 14463.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Lien, T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al.
Toll-like Receptor 2 Functions as a Pattern Recognition Receptor for Diverse Bacterial Products
J. Biol. Chem., November 19, 1999; 274(47): 33419 - 33425.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
A. D. Wright and S. K. Chapes
LPS sensitivity in recombinant mice lacking functional alleles at MHCII, Lps and Nramp1 genes
Innate Immunity, October 1, 1999; 5(5-6): 297 - 305.
[Abstract] [PDF]


Home page
J. Immunol.Home page
A. Yoshimura, E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, and D. Golenbock
Cutting Edge: Recognition of Gram-Positive Bacterial Cell Wall Components by the Innate Immune System Occurs Via Toll-Like Receptor 2
J. Immunol., July 1, 1999; 163(1): 1 - 5.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. N. Becker, G. Diamond, M. W. Verghese, and S. H. Randell
CD14-dependent Lipopolysaccharide-induced beta -Defensin-2 Expression in Human Tracheobronchial Epithelium
J. Biol. Chem., September 15, 2000; 275(38): 29731 - 29736.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Lin, H. Lee, A. H. Berg, M. P. Lisanti, L. Shapiro, and P. E. Scherer
The Lipopolysaccharide-activated Toll-like Receptor (TLR)-4 Induces Synthesis of the Closely Related Receptor TLR-2 in Adipocytes
J. Biol. Chem., August 4, 2000; 275(32): 24255 - 24263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Lien, J. C. Chow, L. D. Hawkins, P. D. McGuinness, K. Miyake, T. Espevik, F. Gusovsky, and D. T. Golenbock
A Novel Synthetic Acyclic Lipid A-like Agonist Activates Cells via the Lipopolysaccharide/Toll-like Receptor 4 Signaling Pathway
J. Biol. Chem., January 12, 2001; 276(3): 1873 - 1880.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Frantz, R. A. Kelly, and T. Bourcier
Role of TLR-2 in the Activation of Nuclear Factor kappa B by Oxidative Stress in Cardiac Myocytes
J. Biol. Chem., February 9, 2001; 276(7): 5197 - 5203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Opitz, N. W. J. Schroder, I. Spreitzer, K. S. Michelsen, C. J. Kirschning, W. Hallatschek, U. Zahringer, T. Hartung, U. B. Gobel, and R. R. Schumann
Toll-like Receptor-2 Mediates Treponema Glycolipid and Lipoteichoic Acid-induced NF-kappa B Translocation
J. Biol. Chem., June 15, 2001; 276(25): 22041 - 22047.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Viriyakosol, P. S. Tobias, R. L. Kitchens, and T. N. Kirkland
MD-2 Binds to Bacterial Lipopolysaccharide
J. Biol. Chem., October 5, 2001; 276(41): 38044 - 38051.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Ozinsky, D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, and A. Aderem
The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors
PNAS, December 5, 2000; 97(25): 13766 - 13771.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heine, H.
Right arrow Articles by Golenbock, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heine, H.
Right arrow Articles by Golenbock, D. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS