|
|
||||||||
Division of Rheumatology, Department of Medicine, Mayo Clinic and Foundation, Rochester, MN 55905
| Abstract |
|---|
|
|
|---|
and ß, within the CD28 minimal promoter. Both
- and ß-bound complexes are found only in lymphoid tissues, in
CD28+ T cells, and in some transformed B cells. These
complexes are coordinately expressed except during replicative
senescence, which is characterized by the down-modulation of site ß-
but not site
-binding activities. In contrast, T cell activation
induces a parallel decline in both site
- and ß-binding
activities. CD4+ and CD8+ T cells differ in
their ß-binding profiles, which may explain the more pronounced
down-regulation of CD28 in senescent CD8+ T cells. In vivo
expanded CD4+CD28null and
CD8+CD28null T cells uniformly lack
- and
ß-bound complexes, resembling the pattern seen in chronically
activated cells and not of senescent cells. | Introduction |
|---|
|
|
|---|
CD28 is expressed on nearly all human CD4+ T cells.
However, CD4+CD28null T cells do emerge to
detectable levels in some individuals with aging (11). These unusual T
cells are also found in patients with rheumatoid arthritis
(RA)4 (12). Previous studies
have shown that this deficiency in CD28 expression is due to a
transcriptional block. CD28 gene expression is associated with the
presence of nuclear proteins binding to two distinct sequence motifs,
site
and ß, within the minimal promoter of the CD28 gene (11).
Mutations in either sequence motif abrogate CD28 gene promoter
activities, suggesting that an interaction between proteins binding to
both sequences is required for CD28 expression.
CD4+CD28null T cells lack DNA-binding
activities for both sequence motifs.
Although CD28 is constitutively expressed on CD4+ T cells, its level of surface expression is not static. At least two mechanisms influencing CD28 expression have been reported, TCR-mediated activation (1, 13) and in vitro replicative senescence (14, 15). Modulation of CD28 cell surface expression is of particular importance because the biological outcome of T cell stimulation is dependent on the interplay of four molecules with very different functions, i.e., CD28 and CD152 with their ligands, CD80 and CD86 (1). CD28 and CD152 are related glycoproteins but differ greatly in their binding properties to CD80 and CD86 (16, 17). They both have fast on/off rates for CD80/CD86; however, CD152 has a 10-fold higher affinity for these molecules than does CD28. Additionally, homodimerization of CD152 has been reported to increase its avidity for CD80 (18, 19, 20). Differences in the patterns of cell surface expression of CD28 and CD152 will, therefore, have immediate impact on whether a positive CD28-mediated signal or a negative CD152-mediated signal prevails.
We have now explored the roles of the CD28-associated
- and
ß-specific complexes in fine-tuning the level of CD28 expression.
Surprisingly, these two nuclear protein complexes were detected
exclusively in lymphoid cells and, in most instances, their binding
activities were coordinated. Upon TCR ligation, transient diminution of
both DNA-binding activities was observed accompanied by the
down-regulation of CD28 expression. In contrast, there was a
progressive loss of CD28 expression during replicative senescence that
was associated with a decrease in site ß-, but not in site
-,
binding activity. These data indicate that CD28 expression is
controlled by protein complexes binding to sites
and ß. However,
distinct mechanisms lead to CD28 down-regulation following T cell
activation and during replicative senescence.
| Materials and Methods |
|---|
|
|
|---|
T cell clones were established by limiting dilution cloning as described previously (12, 21). The clones were derived from PBMC of healthy donors or RA patients, some of whom have participated in previous studies (11, 22, 23, 24). Culture conditions for these clones have been described (11).
Short and long term cultures of T cell lines were established from PBMC
of healthy donors by stimulation with 1 µg/ml PHA (Sigma Chemical,
St. Louis, MO). After 10 days, CD4+ and CD8+ T
cells were separated by negative selection using the VarioMACS system
(Miltenyi Biotec, Auburn, CA) or by standard panning protocols. The
purity of these lymphocyte populations was confirmed by flow cytometric
analysis of cells stained for CD3, CD4, and CD8. Sublines of
CD28+ and CD28null cells from both
CD4+ and CD8+ T cell lines were established by
standard FACS procedures. These cell lines were maintained by a weekly
stimulation with
-irradiated neuraminidase/galactose oxidase-treated
EBV-transformed B lymphoblastoid cell lines and 15 U/ml exogenous IL-2.
The plasmacytoma cell lines ANBL/6, KAS6/1, and KP6 (provided by Dr. Diane Jelinek, Mayo Clinic, Rochester, MN) were originally isolated from patients with multiple myeloma (25, 26). They were maintained in RPMI 1640 (BioWhittaker, Walkersville, MD) supplemented with 10% FCS (Summit Biotech, Ft. Collins, CO), 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin (Life Technologies, Grand Island, NY), and 1 ng/ml human recombinant IL-6 (Genzyme, Cambridge, MA).
The EBV-transformed B lymphoblastoid cell lines (BIN40, HT10, MGAR, Rei, and TAB085) used in this study were established in our laboratory by standard protocols or were obtained from the 11th Histocompatibility Workshop. The PJL cell line (27) was provided by Dr. Paul Leibson (Mayo Clinic). These cell lines were maintained in the same culture media used for the plasmacytomas but without the addition of IL-6.
Various cell lines were obtained from American Type Culture Collection (ATCC, Manassas, VA). These include the B cell line, Ramos; the T cell lines, Jurkat, HUT78, and 6TCEM20; the epithelial carcinoma lines, HeLa and Colo320HSR; the erythroleukemia line, K562; the promonocytic line U937; and the rhabdomyosarcoma line, RD. Cells were propagated according to ATCC recommendations.
Flow cytometry
Phenotypes of cells were periodically examined by standard flow cytometry procedures. This involved triple immunofluorescence staining with Abs to CD3, CD4, and CD8 and analysis by FACSVantage or FACSCalibur cytometers (Becton Dickinson, San Jose, CA). Each experiment included cells incubated with isotype controls (Simultest, Becton Dickinson). Analysis of cell populations were done using the WinMDI program (J.Trotter, Scripps, La Jolla, CA).
Reverse transcriptase-PCR
The presence of CD28 mRNA in the various cells was assessed by standard RT-PCR. Experiments were conducted using amplification primers appropriately designed to detect the different splice forms of CD28 mRNA (28, 29). To amplify CD28 transcripts containing exons 1, 2, and 3, PCR was done with the primers CTCAGGCTGCTCTTGGCTCTC, CGCCCATGCTTGTAGCGTACG, and CAAGCCAGGACTCCACCAACC, respectively, paired with the common primer GATAGGCTGCGAAGTCGCGTC corresponding to the 3'-end of exon 4. PCR products were fractionated in 2% agarose gels.
T cell activation
There were two T cell activation procedures. In one set of experiments, triplicate cultures of 5 x 106 T cells were incubated with autologous, freshly isolated, plastic-adherent monocytes and 5 µg/ml soluble anti-CD3 Ab (OKT3, ATCC). In other studies, T cell cultures were incubated on immobilized OKT3 and the anti-CD28 mAb 28.2 (PharMingen, San Diego, CA). The OKT3 (100 ng/ml) and 28.2 (300 ng/ml) mAbs were immobilized on rabbit anti-mouse Ig-coated plates. These Ab concentrations were determined to induce proliferation of freshly isolated and short term T cell lines.
As system controls, T cell cultures that were stimulated with 50 ng/ml PMA and 10 nM ionomycin (Sigma) or T cells were incubated with IgG isotype controls.
Nuclear extracts and electrophoretic mobility shift assay (EMSA)
Surgical tissue specimens were obtained from the Surgical Pathology Laboratories, Mayo Clinic, cut into small pieces, and digested with collagenase by standard techniques. Single-cell suspensions were obtained, and nuclear extracts were prepared as described previously (11, 30). Briefly, between 5 x 106 and 1 x 107 cells were lysed in cold HEPES hypotonic buffer, and the nuclei were isolated by centrifugation. Nuclear proteins were extracted in 50 µl of a high salt buffer (31), and protein concentration was determined using a protein assay kit (Bio-Rad, Richmond, CA). Similar nuclear extract preparations were made with cell lines as indicated.
EMSAs were conducted as described previously (11, 30), Briefly,
20
µg of nuclear extract were combined with 30 µl of binding buffer
containing 3 µg of poly(dI-dC) (ICN Pharmaceuticals, Costa Mesa, CA)
and 3 µg of nonspecific oligonucleotide. To this mixture, 5 µl of
wash buffer were added, and the total reaction volume was adjusted to
50 µl with binding buffer and incubated on ice for 30 min. About 40
fmol of radiolabeled probes were added and incubated for an additional
30 min at room temperature. The sequences of oligonucleotide probes
corresponding to the site
and ß motifs were synthesized as
indicated in Fig. 1
. Protein-DNA
complexes were resolved in 6% nondenaturing polyacrylamide gels and
autoradiography. Generally, each experiment consisted of replicate
reactions of two separate preparations of nuclear extracts of the same
cell line. The reproducibility of EMSAs was assessed by repeated
experiments as indicated.
|
-/ß-binding
activities were validated by three criteria: 1) the higher mobility of
-bound complexes compared with ß-bound complexes; 2) the lack of
reciprocal competition between the two motifs; and 3) by irrelevant
probes. The irrelevant probes (Ets-1, Elk-1, AP3, and NF
B) have been
described previously. The SP1 sequence was used as an experimental
system control (11, 30). | Results |
|---|
|
|
|---|
In previous studies (11), we demonstrated that CD28 expression on
CD4+ T cells was correlated with nuclear proteins binding
to sequence motifs in the CD28 minimal promoter, referred to as sites
and ß (Fig. 1
). In EMSAs, probes corresponding to site
yielded a single band, while a faster and a slower migrating band were
found with probes corresponding to site ß. Introduction of mutations
into either motif resulted in the inactivation of promoter activity,
suggesting that CD28 expression requires the coordinated binding of
nuclear proteins to both sequence motifs. To explore the correlation
between CD28 expression and CD28-specific transcription factors, we
analyzed various lymphoid cells that differ in CD28 expression.
Representative flow cytometric analysis of various cell lines is shown
in Fig. 2
, and the results are summarized
in Table I
. CD4+ and
CD8+ T cells were sorted for their expression of CD28, and
CD28+ and CD28null T cells were analyzed
separately. The vast majority of peripheral blood CD4+ T
cells expressed the CD28 molecule. A subset of
CD28nullCD4+ T cells existed only in some
individuals, in whom such cells comprised <5% of the CD4 T cell
compartment (11). However, CD8+CD28null T cells
were common (data not shown). All CD28null T cells lacked
CD28 mRNA as determined by RT-PCR (Table I
). Cell surface density of
CD28 on peripheral CD28+CD8+ and
CD28+CD4+ T cells was equivalent (Fig. 2
).
|
|
Nuclear extracts from all of the cell types shown in Table I
were
analyzed for proteins binding to sites
and ß of the CD28 minimal
promoter. Results shown in Fig. 3
demonstrate a correlation between the presence of site
-bound
complexes (band A) and CD28 expression, irrespective of the cell
surface density of the molecule. Among the T and B cell lines examined,
the expression of site
-specific proteins was highly correlated with
the presence of CD28 mRNA.
|
Expression of CD28-specific transcription factors is limited to lymphoid tissue
As depicted in Fig. 3
, the presence of site
- and ß-binding
proteins in lymphoid cells was strictly correlated with CD28
expression. Moreover, the presence of these DNA-protein complexes was
highly synchronous in that none of the CD28+ cells examined
expressed only one of these two complexes. Consistent with previous
data (11), reciprocal competition assays showed that site
and ß
probes do not block motif-specific binding activities.
To determine whether
- and ß-bound complexes are truly
lymphoid-specific and are synchronously expressed, we examined a series
of tissues. As shown in Fig. 4
, site
-
and ß-binding activities were found only in the spleen and were
uniformly absent in all other tissues examined. Reciprocal competitive
EMSAs between the two sequences revealed that the binding activities of
splenic extracts were site
- and ß-specific (data not shown).
|
and ß
sequences (data not shown). Modulation of CD28 expression following T cell activation
Although CD28 is constitutively expressed on T cells, studies have
indicated that activating stimuli induce a transient reduction in the
levels of CD28 expression (1, 13). Indeed, T cells cocultured with
autologous monocytes in the presence of anti-CD3 mAb elicited the
down-regulation of CD28 on the cell surface after 24 h of culture
(Fig. 5
A). We then examined
whether this phenomenon may be associated with the specific
transcription factors binding to site
and ß of the CD28 gene
promoter. As depicted in Fig. 5
B, T cell stimulation
resulted in a parallel reduction in the levels of specific binding
activities to both motifs within 24 h after stimulation. These
reductions in site
- and ß-binding activities were seen in both
CD4+ and CD8+ T cells. The activation-induced
changes in both the cell surface expression of CD28 and the
-/ß-binding activities were transient. The levels of
-/ß-binding activities returned to baseline levels after 72
h, whereas the cell surface levels of CD28 returned to preactivation
levels between 72 and 96 h (data not shown). In agreement with
previous reports (1, 6), stimulation of cells with ionomycin and PMA
induced a similar pattern of transient down-regulation of CD28 and in
site
- and ß-activities (data not shown).
|
In the above experiments, activation of T cells was presumably
accomplished by the simultaneous engagement of the TCR-CD3 complex and
CD28 by OKT3 and CD80/CD86, respectively, presented on monocytes. To
directly assess whether these observations could be attributed to
TCR-CD3 and/or CD28 engagement, Ab cross-linking experiments were
conducted. T cells were cultured on anti-mouse Ig-coated plates
with the addition of anti-CD28 and anti-CD3 (OKT3) mAbs. As
shown in Fig. 6
A,
cross-linking of CD3 with or without co-cross-linking of CD28 induced
the down-regulation of CD28 expression. The cross-linking of CD28 by
itself did not affect the cell surface density of CD28. An analysis of
-/ß-binding profiles of parallel cultures showed that
cross-linking of CD3 alone or the simultaneous cross-linking of CD3 and
CD28 resulted in significant reductions of
- and ß-binding
activities (Fig. 6
B). In contrast, CD28 cross-linking alone
did not affect
-/ß-activities.
|
Loss of CD28 expression on T lymphocytes has been proposed to be a
marker of replicative senescence (14, 15). This is particularly
relevant for CD8+ T cells, which show increased frequencies
of CD28null cells in patients with chronic infections as
well as during normal aging (32, 33, 34, 35, 36, 37, 38). In contrast, the emergence of
CD28null T cells within the CD4 compartment appears to be
the exception rather than the rule (11). To explore the mechanism(s) of
CD28 down-regulation during replicative senescence, CD4+
and CD8+ T cells were purified, activated with immobilized
anti-CD3 mAb, and cultured in the presence of exogenous IL-2.
Before in vitro activation, the percentage of CD28null
cells in the purified CD4+ population was <0.1%. During
the culture period of 12 wk, there was a minimal emergence of
CD4+CD28null T cells accounting for 0.8% of
the total population. In contrast, fresh CD8+ T cells
contained between 33% and 48% CD28null T cells. There was
also a minimal increase in the frequencies of these cells by an average
of 1% during the culture period (data not shown), indicating that a
12-wk culture was not sufficient to allow for the emergence of
CD28null T cells. However, this culture period was
associated with a clear down-regulation of CD28 expression that was
more pronounced on CD8+ T cells compared with that seen on
CD4+ T cells. A representative experiment is shown in Fig. 7
A with purified
CD4+CD28+ and CD8+CD28+
T cells. During the 12-week culture, CD28 expression on
CD4+ cells declined from a mean fluorescence channel of 260
to 192. In CD8+ cells, CD28 expression declined within 4 wk
with 48% of the cells showing a CD28low phenotype. By 12
wk, all CD8 T cells had a reduced CD28 expression; the mean
fluorescence channel had decreased from 225 to 55.
|
- and ß-binding activities (Fig. 7
- and
ß-binding activities. Although nuclear factors binding to site
were maintained in both cell types during the culture period, there was
a characteristic pattern of loss in the site ß-binding activities. As
already shown in Fig. 3| Discussion |
|---|
|
|
|---|
In previous work (11), we mapped two sequence motifs in the minimal
CD28 gene promoter (Fig. 1
) that are occupied by two noncompeting
nuclear factors. Both motifs, site
and ß, are located downstream
from the TATA box. The central contributions of these sequences in CD28
expression can be inferred from mutational studies that demonstrated
the loss of motif-specific binding activities and the inactivation of
the minimal promoter. Moreover, a CD28null phenotype among
CD4+ T cells is associated with the loss of binding
activities of both motifs (11). The present study was designed to
investigate how sites
- and ß-binding activities are involved in
modulating CD28 expression, particularly under conditions known to
affect levels of cell surface expression. Data presented herein provide
several lines of evidence showing that the dynamics of
- and
ß-binding activities are predictive for different patterns of CD28
expression. First, tissue specificity of site
- and ß-bound
nuclear factors is indicated by the presence of both nuclear factor
complexes exclusively in lymphoid cells (
Figs. 24![]()
![]()
, Table I
). Second,
CD28 expression is directly correlated with the highly coordinated
expression of site
- and ß-bound nuclear proteins (
Figs. 24![]()
![]()
).
Finally, at least two distinct pathways for CD28 down-regulation are
indicated by the differential binding activities of
and ß
sequences (
Figs. 57![]()
![]()
). These pathways occur at conditions known to
modulate CD28 expression, i.e., the transient down-regulation of CD28
following T cell activation and the progressive reduction in CD28
expression that is characteristic of T cells during replicative
senescence.
The notion that sites
and ß play a role in CD28 expression
derives from the data showing the congruence of specific motif-binding
activities and CD28 expression (Figs. 2
and 3
, Table I
). These
activities are seen in both CD4+ and CD8+ T
cells and in B cells that express CD28. As shown previously, the
-
and ß-bound proteins represent two distinct molecules based on their
differences in gel mobility and the lack of reciprocal competition the
two sequence motifs (11). Preliminary studies on the isolation of the
- and ß-bound proteins reveal that they represent
47-kDa and
39-kDa molecules, respectively (A. N. Vallejo et al.,
unpublished observations). In contrast, various CD28null
cells, including T cell lines and clones, lack any detectable
-/ß-binding activities. The absence of both complexes in
CD28null T cells indicates a strong correlation between the
coordinate expression of both DNA-binding proteins and cell surface
expression of CD28. This suggestion is consistent with data from point
mutations in either the
or ß motif that show the abrogation of
transcriptional activity of the CD28 promoter (11).
Data presented here also show that
-/ß-bound complexes are found
only in lymphoid tissues (Fig. 4
), indicating that they are both gene-
and tissue-specific. This is a rather unexpected finding because it is
not uncommon for nuclear factors, whether they are activators of
transcription, scaffold/architectural proteins, or basal factors to be
involved in the transcriptional control of different genes in various
tissues. Whether this exclusivity of site
- and ß-specific nuclear
factors to lymphoid tissue is attributed to single motif-specific
binding proteins or larger tissue-specific complexes remains to be
examined.
Whereas the relative levels of site
-binding activities are
equivalent in all CD28+ cells, there are distinguishable
ß-binding profiles. CD4+CD28+ T cells
generally show two ß-bound complexes (B1 and B2), CD28+ B
cells and CD8+CD28+ T cells show a single band,
B2 (Fig. 3
). These results raise the possibility that there may be a
differential requirement of the ß complexes for CD28 transcription in
CD4+ and CD8+ T cells and in
CD28+-transformed B cells. These differences in ß-binding
profiles however, did not correlate with CD28 cell surface expression.
Transformed B cells have extremely low levels of CD28 expression when
compared with T cells (Fig. 2
). CD8+ and CD4+ T
cells have equivalent cell surface densities of CD28 that are multifold
higher compared to those seen on plasmacytoma cells.
The significance of CD28 expression on B cells is not known, although
it has been reported to be a feature of plasmacytomas, but not of
primary B cells (46, 47, 48). In the present work, we also report that
some, but not all, EBV-transformed lymphoblastoid B cells express CD28.
Some studies suggest that this may provide another survival advantage
for immortalized or transformed B cells as indicated by the
coexpression of CD80, the counterreceptor for CD28, on the same B cells
(48) and its ability to generate a signaling cascade (49).
Regardless of its function in B cells, the unusual expression of CD28
on these cells is associated with the acquisition of both
- and ß-binding activities (Figs. 2
and 3
, Table I
).
The present data also show that the site
and ß binding activities
influence the fine-tuning of CD28 expression. Activating stimuli induce
a transient reduction in the levels of cell surface expression of CD28
accompanied by the coordinate down-regulation of
- and ß-binding
activities (Figs. 5
and 6
). Continuous culture of CD4+ T
cells results in the modulation of ß- but not
-binding activities
that is accompanied by a progressive decrease in the cell surface
expression of CD28 (Fig. 7
A).
Down-regulation of CD28 expression following T cell activation is well
documented (1, 6, 13). As demonstrated in Figs. 5
and 6
, the engagement
of the TCR-CD3 complex, or mitogenic agents such as PMA/ionomycin
induce significant reductions in the levels of CD28 cell surface
expression. These are accompanied by the down-regulation of both site
- and ß-binding activities. Cross-linking of CD28 alone did not
affect CD28 expression or
-/ß-activities, indicating that
modulation of CD28 expression is directly influenced by activation
signals emanating from the TCR-CD3 complex. These data corroborate
previous studies showing activation-induced down-modulation of CD28
gene promoter activity (11). They are also consistent with other
studies demonstrating the rapid and selective reduction in the steady
state levels of CD28 mRNA following activation (45). Collectively,
these observations indicate the existence of a regulatory pathway that
specifically targets the down-regulation of CD28 gene transcription.
The characteristic reduction in both
- and ß-binding activities
following activation strongly support this hypothesis. The functional
impact of CD28 down-regulation in T cell-mediated responses remains to
be explored. However, receptor down-regulation of the TCR complex, CD4,
and CD8 have been reported (50, 51, 52, 53, 54). This is thought to effectively
reduce the avidity of receptor-ligand interactions, resulting in the
modulation of T cell effector functions. Hence, variations in CD28
expression may influence the strength of the costimulatory signal that
determines whether T cells undergo proliferation or anergy (1, 2, 3, 4, 5, 6, 7, 8, 9, 10).
Additionally, reduction in CD28 expression following activation has
been shown to correlate with increased susceptibility to Fas-induced
apoptosis (10, 45), indicating the importance of receptor modulation in
maintaining T cell homeostasis.
While activation-induced down-regulation of CD28 expression equally
affected CD4+ and CD8+ T cells, the gradual
loss of CD28 expression during continuous culture was more pronounced
in the CD8+ T cells (Fig. 7
). This type of cell culture has
been proposed as a model of replicative senescence (14, 15, 55) and
mimics the characteristic increase in the frequencies of
CD8+CD28null T cells in vivo during aging or
chronic infections (14, 31, 32, 33, 34, 35). In support of this hypothesis,
CD8+CD28null T cells have been shown to have
significantly shorter telomeres compared with
CD8+CD28+ T cells (56). In contrast to
CD8+ T cells, CD4+CD28null T cells
are infrequent and are found only in some elderly individuals and among
RA patients (11, 12), suggesting that either CD8+ T cells
have a higher turnover compared with CD4+ T cells or
that CD8+ T cells have a high propensity of losing CD28
expression. Data presented here support the later hypothesis.
Continuous culture of CD4+ and CD8+ T cells
resulted in a more rapid decline in CD28 expression on CD8+
T cells than on CD4+ T cells (Fig. 7
A).
The reduction of CD28 expression on T cells during continuous culture
is correlated with changes in the ß-binding profiles while the
profile is maintained (Figs. 3
and 7
B). While freshly
isolated CD4+CD28+ T cells have two ß-bound
complexes, B1 and B2, cultured CD4+CD28+ T
cells lose the B1 but not the B2 complex. In contrast, CD8+
T cells, which generally exhibit only the B2 complex, gradually lost
this complex during continuous culture. These results show that
regulation of CD28 expression in CD4+ and CD8+
T cells can be distinguished by their ß-binding profiles and that
this difference may be related to the progressive loss of CD28
expression during replicative senescence in vitro.
Although the T cell culture system showed the down-regulation of CD28,
a complete loss of CD28 expression and the emergence of
CD8+CD28null or
CD4+CD28null T cells was not achieved. This is
in marked contrast with the in vivo situation where T cells completely
lose the expression of CD28, and CD28low T cells are not
observed (11, 32, 33, 34, 35, 36). As the data show,
CD4+CD28null and
CD8+CD28null T cells freshly isolated from
peripheral blood lack both
- and ß-bound complexes (Fig. 3
) (11).
This is unlike in vitro replicative senescence wherein site ß- but
not site
-binding activity is down-modulated (Fig. 7
B).
In contrast, activation results in the down-regulation of both
- and
ß-binding activities (Fig. 6
). Thus, we propose that continuous
activation in vivo, rather than replicative immunosenescence, may
account for the emergence of CD28null T cells.
CD4+CD28null T cells are highly oligoclonal
(57, 58), suggesting that they may be derived from the chronic
activation and proliferation of their CD28+CD4+
progenitors. This interpretation is supported by the isolation of T
cell clones with identical TCR ß-chain sequences in both
CD28+ and CD28null subsets (57). The loss of
CD28 expression could be a mechanism to reestablish nonresponsiveness
of a T cell under conditions of continuous antigenic stimulation. This
suggestion is consistent with the high frequencies of
CD4+CD28null T cells in the chronic
inflammatory disease RA (12, 59).
In summary, data presented here show that the dynamics of the binding
profiles of the
and ß sequence motifs in the CD28 gene promoter
correlate with the patterns of expression of CD28. Both motif-specific
binding activities are restricted to lymphoid tissues and are modulated
by activating stimuli. Under these conditions,
- and ß-bound
complexes are coordinately expressed. However, this coordinate
expression is not maintained during in vitro replicative senescence.
Among CD8+ T cells, continuous culture induces the
selective diminution of the ß-protein complex with a concurrent
decrease in the levels of cell surface expression of CD28. Changes in
CD4+ T cells are less pronounced with the selective loss of
one of the two ß-bound complexes accompanied by a slight, but
significant, down-regulation of CD28 expression. The complete loss of
function in both motifs is correlated with a CD28null
phenotype of both CD4+ and CD8+ T cells in
vivo. Although both activation and replicative senescence modulate CD28
expression, further studies are needed to determine which mechanism
leads to the CD28null endpoint phenotype observed in vivo.
Characterization of the molecular nature of the motif-specific
complexes will be critical to our further understanding of the
mechanisms involved in CD28 expression and its modulation during
adaptive immune responses that led to the development of
CD28null T cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jörg J. Goronzy (E-mail address: ) or Dr.AbbeVallejo (E-mail address: ), Mayo Clinic, 200 First Street S.W., Rochester, MN 55905. ![]()
3 Current address: School of Medicine, Universität München, Munich, Germany. ![]()
4 Abbreviations used in this paper: RA, rheumatoid arthritis; EMSA, electrophoretic mobility shift assay. ![]()
Received for publication October 13, 1998. Accepted for publication March 8, 1999.
| References |
|---|
|
|
|---|
-interferon (IFN)-inducible factor distinct from STAT1
, p48, and IFN regulatory factor-1. J. Biol. Chem. 271:29813.This article has been cited by other articles:
![]() |
B. H. Lemster, J. J. Michel, D. T. Montag, J. J. Paat, S. A. Studenski, A. B. Newman, and A. N. Vallejo Induction of CD56 and TCR-Independent Activation of T Cells with Aging J. Immunol., February 1, 2008; 180(3): 1979 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cicin-Sain, I. Messaoudi, B. Park, N. Currier, S. Planer, M. Fischer, S. Tackitt, D. Nikolich-Zugich, A. Legasse, M. K. Axthelm, et al. Dramatic increase in naive T cell turnover is linked to loss of naive T cells from old primates PNAS, December 11, 2007; 104(50): 19960 - 19965. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zal, C. Baboonian, and J. C. Kaski Letter to the Editor: Autoreactive CD4+CD28- T Cells and Acute Coronary Syndromes Arterioscler. Thromb. Vasc. Biol., March 1, 2007; 27(3): E18 - E18. [Full Text] [PDF] |
||||
![]() |
J. M. Witkowski, M. Soroczynska-Cybula, E. Bryl, Z. Smolenska, and A. Jozwik Klotho--a Common Link in Physiological and Rheumatoid Arthritis-Related Aging of Human CD4+ Lymphocytes J. Immunol., January 15, 2007; 178(2): 771 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Baeten, S. Louis, C. Braud, C. Braudeau, C. Ballet, F. Moizant, A. Pallier, M. Giral, S. Brouard, and J.-P. Soulillou Phenotypically and Functionally Distinct CD8+ Lymphocyte Populations in Long-Term Drug-Free Tolerance and Chronic Rejection in Human Kidney Graft Recipients J. Am. Soc. Nephrol., January 1, 2006; 17(1): 294 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Scriba, M. Purbhoo, C. L. Day, N. Robinson, S. Fidler, J. Fox, J. N. Weber, P. Klenerman, A. K. Sewell, and R. E. Phillips Ultrasensitive Detection and Phenotyping of CD4+ T Cells with Optimized HLA Class II Tetramer Staining J. Immunol., November 15, 2005; 175(10): 6334 - 6343. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Fritsch, X. Shen, G. P. Sims, K. S. Hathcock, R. J. Hodes, and P. E. Lipsky Stepwise Differentiation of CD4 Memory T Cells Defined by Expression of CCR7 and CD27 J. Immunol., November 15, 2005; 175(10): 6489 - 6497. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gniadecki and A. Lukowsky Monoclonal T-Cell Dyscrasia of Undetermined Significance Associated With Recalcitrant Erythroderma Arch Dermatol, March 1, 2005; 141(3): 361 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Lewis, M. Merched-Sauvage, J. J. Goronzy, C. M. Weyand, and A. N. Vallejo Tumor Necrosis Factor-{alpha} and CD80 Modulate CD28 Expression through a Similar Mechanism of T-cell Receptor-independent Inhibition of Transcription J. Biol. Chem., July 9, 2004; 279(28): 29130 - 29138. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zal, J. C. Kaski, G. Arno, J. P. Akiyu, Q. Xu, D. Cole, M. Whelan, N. Russell, J. A. Madrigal, I. A. Dodi, et al. Heat-Shock Protein 60-Reactive CD4+CD28null T Cells in Patients With Acute Coronary Syndromes Circulation, March 16, 2004; 109(10): 1230 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Jankovic, I. Messaoudi, and J. Nikolich-Zugich Phenotypic and functional T-cell aging in rhesus macaques (Macaca mulatta): differential behavior of CD4 and CD8 subsets Blood, November 1, 2003; 102(9): 3244 - 3251. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, H. Yang, P. A. Klimiuk, C. M. Weyand, and J. J. Goronzy Synoviocyte-Mediated Expansion of Inflammatory T Cells in Rheumatoid Synovitis Is Dependent on CD47-Thrombospondin 1 Interaction J. Immunol., August 15, 2003; 171(4): 1732 - 1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Schonland, J. K. Zimmer, C. M. Lopez-Benitez, T. Widmann, K. D. Ramin, J. J. Goronzy, and C. M. Weyand Homeostatic control of T-cell generation in neonates Blood, August 15, 2003; 102(4): 1428 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Warrington, A. N. Vallejo, C. M. Weyand, and J. J. Goronzy CD28 loss in senescent CD4+ T cells: reversal by interleukin-12 stimulation Blood, May 1, 2003; 101(9): 3543 - 3549. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Brenchley, N. J. Karandikar, M. R. Betts, D. R. Ambrozak, B. J. Hill, L. E. Crotty, J. P. Casazza, J. Kuruppu, S. A. Migueles, M. Connors, et al. Expression of CD57 defines replicative senescence and antigen-induced apoptotic death of CD8+ T cells Blood, April 1, 2003; 101(7): 2711 - 2720. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, E. Bryl, K. Klarskov, S. Naylor, C. M. Weyand, and J. J. Goronzy Molecular Basis for the Loss of CD28 Expression in Senescent T Cells J. Biol. Chem., November 27, 2002; 277(49): 46940 - 46949. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hanawa, Y. Ma, S. A. Mikolajczak, M. L. Charles, T. Yoshida, R. Yoshida, C. A. Strathdee, D. W. Litchfield, and A. Ochi A novel costimulatory signaling in human T lymphocytes by a splice variant of CD28 Blood, March 15, 2002; 99(6): 2138 - 2145. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Goronzy, J. W. Fulbright, C. S. Crowson, G. A. Poland, W. M. O'Fallon, and C. M. Weyand Value of Immunological Markers in Predicting Responsiveness to Influenza Vaccination in Elderly Individuals J. Virol., December 15, 2001; 75(24): 12182 - 12187. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bryl, A. N. Vallejo, C. M. Weyand, and J. J. Goronzy Down-Regulation of CD28 Expression by TNF-{alpha} J. Immunol., September 15, 2001; 167(6): 3231 - 3238. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bryl, M. Gazda, J. Foerster, and J. M. Witkowski Age-related increase of frequency of a new, phenotypically distinct subpopulation of human peripheral blood T cells expressing lowered levels of CD4 Blood, August 15, 2001; 98(4): 1100 - 1107. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Namekawa, M. R. Snyder, J.-H. Yen, B. E. Goehring, P. J. Leibson, C. M. Weyand, and J. J. Goronzy Killer Cell Activating Receptors Function as Costimulatory Molecules on CD4+CD28null T Cells Clonally Expanded in Rheumatoid Arthritis J. Immunol., July 15, 2000; 165(2): 1138 - 1145. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, L. O. Mugge, P. A. Klimiuk, C. M. Weyand, and J. J. Goronzy Central Role of Thrombospondin-1 in the Activation and Clonal Expansion of Inflammatory T Cells J. Immunol., March 15, 2000; 164(6): 2947 - 2954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, C. M. Weyand, and J. J. Goronzy Functional Disruption of the CD28 Gene Transcriptional Initiator in Senescent T Cells J. Biol. Chem., January 19, 2001; 276(4): 2565 - 2570. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |