The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siemasko, K.
Right arrow Articles by Clark, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siemasko, K.
Right arrow Articles by Clark, M. R.
The Journal of Immunology, 1999, 162: 6518-6525.
Copyright © 1999 by The American Association of Immunologists

Ig{alpha} and Igß Are Required for Efficient Trafficking to Late Endosomes and to Enhance Antigen Presentation1

Karyn Siemasko*, Bartholomew J. Eisfelder*, Christopher Stebbins{dagger}, Shara Kabak*, Andrea J. Sant{dagger}, Wenxia Song{ddagger} and Marcus R. Clark2,*,{dagger}

Sections of * Rheumatology and {dagger} Pathology, Department of Medicine, Committee on Immunology, University of Chicago, Chicago, IL 60637; and {ddagger} Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The B cell Ag receptor (BCR) is a multimeric complex, containing Ig{alpha} and Igß, capable of internalizing and delivering specific Ags to specialized late endosomes, where they are processed into peptides for loading onto MHC class II molecules. By this mechanism, the presentation of receptor-selected epitopes to T cells is enhanced by several orders of magnitude. Previously, it has been reported that, under some circumstances, either Ig{alpha} or Igß can facilitate the presentation of Ags. However, we now demonstrate that if these Ags are at low concentrations and temporally restricted, both Ig{alpha} and Igß are required. When compared with the BCR, chimeric complexes containing either chain alone were internalized but failed to access the MHC class II-enriched compartment (MIIC) or induce the aggregation and fusion of its constituent vesicles. Furthermore, Ig{alpha}/Igß complexes in which the immunoreceptor tyrosine-based activation motif tyrosines of Ig{alpha} were mutated were also incapable of accessing the MIIC or of facilitating the presentation of Ag. These data indicate that both Ig{alpha} and Igß contribute signaling, and possibly other functions, to the BCR that are necessary and sufficient to reconstitute the trafficking and Ag-processing enhancing capacities of the intact receptor complex.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The fate of a B cell during development and differentiation is determined by the quality and quantity of signals provided by the B cell Ag receptor (BCR)3 (1, 2, 3). The BCR is a multimeric complex in which an Ag-recognition subunit, membrane-bound Ig, is noncovalently associated with heterodimers of Ig{alpha} and Igß, which provide the receptor with its signaling capacity (4). The cytoplasmic domains of Ig{alpha} and Igß are devoid of intrinsic tyrosine kinase activity. However, each contains a conserved motif (immunoreceptor tyrosine-based activation motif (ITAM)) (5, 6) that, upon phosphorylation, recruits and activates the tyrosine kinase Syk (7, 8). Although the ITAMs of Ig{alpha} and Igß are identical, Igß functions to amplify the tyrosine phosphorylation of Ig{alpha} (9). These and other data indicate that nonconserved sequences embedded within each ITAM may determine their specific function within the context of the intact BCR complex (10, 11, 12, 13). The pathways that lie distal to Syk are myriad and include the intermediates Ras (14) and Jnk (Ref. 15, and M.R.C., unpublished observations), as well as the distal transcription factors, NFAT and NF{kappa}B (16). Although necessary, this interconnected network of activation cascades is not sufficient to drive the expansion and differentiation of resting peripheral B cells into large populations of activated lymphocytes capable of secreting high-affinity IgG Abs. Also required are soluble and membrane-restricted signals provided by T cells, which recognize MHC class II, restricted Ag-derived peptides expressed on the B cell surface (17, 18)

In B cells, newly synthesized MHC class II molecules are found in at least two compartments that contain processed peptides. The best characterized is the MHC class II-enriched compartment (MIIC), which bears the markers of a late endocytic compartment, including the lysosome-associated membrane protein-1 (Lamp-1) (19, 20, 21, 22). Another compartment, the CIIV, is derived from earlier endocytic vesicles that contain the transferrin receptor (23, 24). Evidence indicates that these, and possibly other compartments, can coexist and be utilized within a particular cell line (25). However, late endosomes are more degradative (26) and, therefore, may be better adapted for the rapid and efficient derivation of immunogenic peptides.

The native BCR has endocytic, targeting, and activating properties, all of which may contribute to the ability of the receptor to both restrict and enhance the presentation of specific peptides to T cells. The receptor is the main physiological portal by which Ag can gain access to the cell interior. Pinocytosis is poor, and the only Fc{gamma}R found on B cells contains a motif within its cytoplasmic tail that inhibits endocytosis (27). Once internalized, the BCR rapidly targets Ag to MIIC-like compartments, ensuring low-affinity Ags access to the processing compartment (28, 29). Finally, the BCR delivers signals capable of inducing the aggregation, fusion, and acidification of the late endosomes that constitute the MIIC (30). Such changes are predicted to generate a subcellular environment conducive to the processing and loading of peptides onto MHC class II molecules. In toto, these receptor attributes allow surface expression of Ag-derived MHC class II-restricted peptides within 20 min of initial receptor binding (28) at an efficiency as much as 106 greater than that obtained for fluid-phase Ag (31, 32).

Herein, we demonstrate that the ability of the BCR to rapidly deliver endocytosed complexes to the MIIC is dependent upon both Ig{alpha} and Igß. Although endocytosis could be mediated by chimeras containing either Ig{alpha} or Igß, these chimeric complexes could not efficiently target Ag to the MIIC, nor could they facilitate the presentation of temporally restricted Ag. Analysis of signaling defective chimeras suggests that cooperation between Ig{alpha} and Igß may lead to the recruitment and activation of signaling molecules required for targeting to the MIIC.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and Abs

The A20/IIA1.6 B cell line (IgG2a+, FcR-, I-Ad+, I-Ed+) (33), was maintained in IMDM (Life Technologies, Grand Island, NY) supplemented with 10% FCS (HyClone, Logan, UT), 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in 7.5% CO2.

Platelet-derived growth factor receptor (PDGFR) chimera construction

Construction, expression, and activation of PDGFR chimeras, except Ig{alpha}-Igß tandem, have been previously described (9). The Ig{alpha}-Igß tandem was constructed by PCR amplification of the cytoplasmic tail of Ig{alpha} with a 5' primer to introduce a BamHI restriction site and a 3' overlapping primer (ATGCCCAGCTGGAAAAGCCAGACAAGGATGACGGCAAGGC) that contained both 3' Ig{alpha} and 5' Igß sequences. Igß was then amplified using a 5' primer complementary to the primer above and a 3' primer to introduce an EcoRI restriction site. The two PCR products were knit together using the 5' BamHI primer and the 3' EcoRI primer. The resulting knit was cloned, sequenced, and expressed as described previously (9).

Ag presentation

For myoglobin/anti-IgG conjugation, goat anti-rabbit IgG (heavy and light chain)(ICN Pharmaceuticals, Costa Mesa, CA) was incubated with a 10:1 molar ratio excess of LC-SPDP (Pierce, Rockford, IL) for 75 min at room temperature in 10 mM PO4, 150 mM NaCl (pH 8) (conjugation buffer). Myoglobin (Sigma, St. Louis, MO) was incubated at a 1:1 molar ratio with Traut’s reagent (Pierce) for 75 min at 4°C in 100 mM PO4, 50 mM NaCl, 1 mM EDTA (pH 9). The reactive goat anti-rabbit IgG was then incubated with a 10:1 molar excess of reactive myoglobin at room temperature for 72 h in conjugation buffer. The conjugate was purified using a rabbit anti-goat IgG (Fc fragment-specific) (Jackson ImmunoResearch, West Grove, PA) column. The approximate final concentration of myoglobin in the conjugate stock was 500 ng/ml.

To target Ag as a "pulse" to the chimeric complexes on each transfected cell line, the following procedure was used. First, transfected or wild-type (nontransfected) cells were incubated on ice sequentially with PDGF-BB (100 ng/ml) (Sigma) for 5 min, mouse anti-human PDGFRß (5 µg/ml) (Genzyme, Cambridge, MA) for 3 min, and rabbit anti-mouse IgG1 (5 µg/ml) (Zymed, San Francisco, CA) for 10 min. After washing, cells were then incubated with the indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG for 15 min on ice. The cells were then warmed to 37°C for 30 min, washed, and used in Ag presentation assays. To control for nonspecific uptake by pinocytosis, cells were treated as above, however, the primary anti-PDGFRß Ab was omitted. In experiments in which Ag was targeted to the endogenous BCR, cells were first incubated with rabbit polyclonal anti-IgG Abs (15 µg/ml) (Jackson ImmunoResearch) for the times indicated. This stimulating Ab is recognized by the myoglobin-Ab conjugate.

To target Ag continuously to the chimeric complexes, cells were incubated on ice sequentially with PDGF-BB, mouse anti-human PDGFRß, and rabbit anti-mouse at the concentrations indicated above. Samples were then incubated with the indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG for 15 min and then put directly into Ag presentation assays without washing.

The ability of each transfectant to present either pulsed or continuously available Ag was assayed by incubating 5 x 104 cells with 5 x 104 myoglobin-specific T cell clones (Ach 8.2) for 20 h at 37°C. Supernatants were collected and assayed for IL-2 content by coculture with the lymphokine-dependent cell line CTLL-2 (American Type Culture Collection, Manassas, VA), followed by measurement of 3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide (MTT) incorporation.

Confocal microscopy

For BCR/Lamp-1 costaining, A20/IIA1.6 cells were first incubated with 10 µg/ml goat anti-mouse IgG2a Abs (Southern Biotechnology Associates, Birmingham, AL) at 4°C for 10 min, washed in IMDM, then incubated with donkey anti-goat IgG-FITC (1:100) (Jackson ImmunoResearch). To surface stain the chimeras, each transfectant was incubated sequentially on ice with 100 ng/ml PDGF-BB ligand, 5 µg/ml mouse anti-hPDGFRß, and 5 µg/ml anti-mouse IgG1-FITC (Zymed). Following surface labeling, cells were warmed to 37°C for 30 min then fixed with 3% paraformaldehyde/3% sucrose and permeabilized with 0.05% saponin and stained for Lamp-1 as described previously (30). Confocal sections of ~0.75–1.0 um were acquired using a Zeiss (Oberkochen, Germany) 410 confocal microscope and displayed by pseudo-coloring using LSM software by overlaying consecutive scans of 568ex/590em (PE-red) and 488ex/515em (FITC-green). MIIC* was defined as any single intracellular aggregate containing >80% of the visible Lamp-1+ endosomal compartment (30). MIIC* formation for each sample was quantitated by scoring 10 random fields (~100 cells).

Internalization

Clones expressing similar levels of PDGFR chimera(s) (9) were each incubated on ice with 100 ng/ml PDGF-BB ligand, 5 µg/ml mouse anti-human PDGFRß, and 5 µg/ml anti-mouse IgG1-HRP (Zymed). A total of 2.5 x 107 cells was then washed two times with IMDM/0.5% FCS and incubated at 37°C as indicated. To inhibit further endocytosis, cells were placed on ice. Cells were then washed two times with IMDM/0.5% FCS and resuspended in 100 µl IMDM/0.5% FCS. The amount of noninternalized chimeras bound with HRP-conjugated Ab was measured colorimetrically by incubating the cells with 5 mM O-phenylenediamine HCl in 0.15 M phosphate buffer (pH 6) with 0.15% H2O2 at room temperature for 15 min in the dark (34). The total HRP activity for each clone was measured by solubilizing a duplicate sample from the 10-min time point with an equal volume of PBS/1% Nonidet P-40 for 10 min at room temperature and then incubating the cells with 0.15% H2O2 at room temperature for 15 min in the dark. Peroxidase reactions were stopped with 6 N HCl and centrifuged at 20,000 x g for 10 min at 4°C. Percent internalization was calculated by: (OD 492 total - OD sample)/OD total.

Subcellular distribution of the chimeric receptors

Cell samples were incubated in DMEM/BSA (6 mg/ml BSA, 20 mM MOPS (pH 7.4)) containing 100 ng/ml PDGF-BB ligand, anti-hPDGFR (10 µg/ml), and an HRP-conjugated secondary Ab (10 µg/ml) (Zymed) for 15 min on ice, then washed and warmed to 37°C for 30 min. The cells were then subject to percoll gradient fractionation. Fractions (0.5 ml) were collected and assayed for HRP activity, as described (35).

Surface biotinylation, immunoprecipitation, and analysis of surface-biotinylated Ig{alpha}

Cell samples (5 x 107) were washed at 4°C with HBSS lacking phosphate and containing 20 mM Na HEPES (pH 7.4) and incubated in 10 ml of the same buffer containing 0.2 mg/ml sulfosuccinimidyl-6-(biotinamido)hexanoate (SSBH) (Pierce) for 15 min at 4°C. After the 15-min incubation, 10 ml of freshly made SSBH containing solution was then added, and the incubation extended for an additional 15 min at 4°C. Cells then were washed with DME/BSA and chased in medium at 37°C for 30 min. The cells were suspended in lysis buffer (1% Nonidet P-40, 50 mM Tris/HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, and protease inhibitors) and resolved on an 8% SDS-PAGE, transferred to nylon membrane (Immobilon-P; Millipore, Bedford, MA), and Western blotted with streptavidin-HRP (1:10,000 dilution) (Pierce) and developed using enhanced chemiluminescence (Amersham, Arlington Heights, IL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of receptor complexes containing the cytoplasmic tails of Ig{alpha} and/or Igß

We and others have demonstrated that Ig{alpha} and Igß each contribute distinct (10, 11, 12, 13) and complementary (9) signaling functions to the receptor complex. Both chains are required for normal B lymphocyte development (2, 3) and both are required for receptor-induced apoptosis in immature cells (36). These biological functions are thought to be dependent upon the signaling capacities of each chain. While it is clear that Ig{alpha} and Igß are necessary for establishing the resting peripheral B lymphocyte pool, their relative contributions to the subsequent immune responses mediated by these cells is uncertain. To begin to examine if Ig{alpha} and Igß can function synergistically in mediating peripheral immune responses, we asked whether one or both were required for the BCR to facilitate the presentation of Ag to T cells.

To address this question, we needed to be able to form and compare different receptor complexes containing the cytoplasmic tails of Ig{alpha} and/or Igß. Therefore, we derived clones of the B cell lymphoma A20 IIA1.6 expressing chimeras in which the extracellular and transmembrane domains of the PDGFR{alpha} or -ß were fused to the cytoplasmic tails of Ig{alpha}, Igß, or a tandem of both (Fig. 1GoA) (9). Since PDGFR{alpha} and -ß have equal affinity for PDGF-BB, adding it to cells expressing a single chimera [PDGFRß/Ig{alpha} (Ig{alpha}) or PDGFRß/Igß (Igß)] induces homodimers to form on the cell surface. On cells expressing two different chimeras (PDGFRß/Ig{alpha} and PDGFR{alpha}/Igß), heterodimers are formed (Ig{alpha}/Igß heterodimer). These dimeric complexes, which constitute the resting receptor, can then be aggregated (activated) with anti-receptor Abs (37).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 1. Both Ig{alpha} and Igß are required to facilitate the presentation of pulsed, but not continuously available, Ag. A, Schematic representation of PDGFR chimeras in each transfected cell line. The surface expression and signaling characteristics of the A20 IIA1.6 clones expressing PDGFRß/Ig{alpha} (Ig{alpha}), PDGFRß/Igß (Igß), and PDGFRß/Ig{alpha}//PDGFR{alpha}/Igß (Ig{alpha}/Igß) have been reported previously (9). The other clones depicted, Ig{alpha}-Igß tandem, Ig{alpha}-Ig{alpha} tandem, and Ig{alpha}(Y{Delta}F)/Igß, had similar surface expression levels (data not shown). B, Schematic representation of chimera activation. The addition of PDGF-BB forms dimers that constitute the resting receptor complex (9). The sequential addition of primary (mouse anti-hPDGFRß) and secondary Abs (rabbit anti-mouse IgG1) aggregates or activates the receptor complexes. The primary and secondary Abs are represented as one Ab. In assays of Ag presentation, conjugated goat anti-rabbit IgG Abs were used to target myoglobin to the aggregated receptor complexes. As described in Materials and Methods, the Ag conjugate was given as a 30-min pulse at the beginning of each experiment. C, Both Ig{alpha} and Igß are required to facilitate the (Figure and Legend continue.) presentation of pulsed Ag. Activated chimeric complexes ({blacksquare}) containing both Ig{alpha} and Igß, either as heterodimers (Ig{alpha}/Igß) or homodimer tandems (Ig{alpha}-Igß), were capable of facilitating presentation of myoglobin to the same degree as the BCR ({diamondsuit}) on each transfectant. In contrast, activated chimeric complexes containing only Ig{alpha} or Igß did not enhance the presentation of myoglobin to T cells above background (pinocytosis, •) or above that observed in wild-type cells (wt) (nontransfected cells). T cell activation was measured by IL-2 production (MTT assay; O.D.) in response to increasing concentrations of Ag containing anti-receptor secondary conjugates. D, Presentation requires the tyrosines of Ig{alpha}. A20 cells expressing Ig{alpha}/Igß heterodimer, Ig{alpha}(Y{Delta}F)/Igß heterodimer, Ig{alpha}-Igß tandem, or Ig{alpha}-Ig{alpha} tandem were assayed as above for their ability to facilitate the presentation of pulsed myoglobin at the highest dilution to give a maximal response. E, Igß can facilitate the presentation of continuously available Ag. When myoglobin/Ab conjugates were present for the duration of the presentation assay (cont.), chimeric complexes containing either Igß or Ig{alpha}/Igß could facilitate the presentation of Ag. In contrast, pulsed Ag complexes (pulse) could only be presented by chimeras containing Ig{alpha} and Igß at low concentrations.

 
The presentation of pulsed Ag requires both Ig{alpha} and Igß

In our assays, we sought to compare the ability of each chimeric complex to facilitate Ag presentation to that of the endogenous BCR on each transfectant. Therefore, the test Ag, myoglobin, was covalently conjugated to Abs that would recognize the aggregating Abs of each complex, goat anti-rabbit IgG (Fig. 1GoB). Transfected or wild-type (nontransfected) cells were incubated on ice sequentially with PDGF-BB, mouse anti-human PDGFRß, and rabbit anti-mouse IgG1 to aggregate the chimeras or rabbit anti-mouse IgG to aggregate the BCR. After washing, cells were then incubated with the indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG for 15 min on ice, warmed to 37°C for 30 min, and then washed again. In this way, the Ag was given as a pulse at the beginning of the experiment. Ag-pulsed B cells were incubated with myoglobin-specific T cells, and IL-2 production was assayed after 20 h.

Only chimeric complexes containing both Ig{alpha} and Igß were capable of facilitating the presentation of pulsed Ag to T cells (Fig. 1GoC). Furthermore, the degree to which these Ig{alpha}/Igß-containing complexes presented Ag was nearly identical to that of the BCR on each transfectant. BCR-stimulated cells, in the absence of targeted Ag, did not stimulate the T cells as measured in our assay. Nor did stimulation of the BCR increase the production of IL-2 (data not shown). Some modest enhancement of Ag presentation by the Ig{alpha} or Igß homodimeric complexes was observed at higher doses of Ag. However, it was not comparable to Ag targeted to the BCR. Nor was it comparable to Ag targeted to the chimeric complexes containing both Ig{alpha} and Igß cytoplasmic tails. Flow cytometric analysis demonstrated that all of the transfectants expressed similar levels of each chimera. Furthermore, each chimeric complex was capable of binding similar amounts of myoglobin-Ab conjugate (Ref. 9, and data not shown).

Ig{alpha} and Igß contain ITAMs that, individually, are able to recruit and activate tyrosine kinases (13, 33, 38). However, the Ig{alpha} ITAM is the predominant motif for the activation of tyrosine kinases (9, 11). Therefore, we mutated the two tyrosines of the Ig{alpha} ITAM to phenylalanines. These conservative changes are not expected to affect the overall conformation of the cytoplasmic tail but should specifically abolish the ability of these residues to be phosphorylated. As predicted, the Ig{alpha}(Y{Delta}F)/Igß heterodimeric complex was incapable of initiating tyrosine kinase activation (S.K. and M.R.C., unpublished observations). We then asked whether this signaling defective receptor complex could facilitate the presentation of myoglobin. As demonstrated in Fig. 1GoD, it could not. These results suggest that the signaling capacity of the BCR is necessary for the presentation of Ag.

Next, we examined what the spatial requirements were for cooperation between Ig{alpha} and Igß. The two chains are always found in association with the BCR as a disulfide-linked heterodimer (39). However, it is not known if this configuration is necessary for the functioning of these chains. Therefore, we constructed single chain chimeras in which the extracellular and transmembrane domains of PDGFRß were fused to tandem cytoplasmic domains of Ig{alpha}-Igß or Ig{alpha}-Ig{alpha}. The Ig{alpha}-Igß tandem homodimer could facilitate the presentation of Ag, while the Ig{alpha}-Ig{alpha} tandem homodimer could not (Fig. 1GoD). Thus, regardless of the spatial relationships between the two chains, Igß is able to provide one or more nonredundant functions that are necessary to facilitate the presentation of Ag.

Our results demonstrating the interdependence of the Ig{alpha} and Igß cytosolic tails are in apparent contrast to previous reports in which chimeras containing either the Ig{alpha} or Igß cytoplasmic tails alone could facilitate the presentation of Ag (40, 41). However, in those experiments, Ag complexes were available to the receptor for the duration of the assay or at high concentration. In our experiments, Ag was targeted to the receptor as a pulse at the beginning of each experiment. To test whether our single chain chimeras could facilitate the presentation of continuously available Ag, we first loaded chimeric receptors with varying concentrations of Ag complexes and then incubated transfectants with myoglobin-specific T cells in the presence of the concentration of Ag complex used to initially load the receptor. Under these conditions, both the Igß homodimer and the Ig{alpha}/Igß heterodimeric complexes facilitated the presentation of myoglobin (Fig. 1GoE).

Receptors containing either Ig{alpha} or Igß are internalized

The rapid internalization of the ligated BCR is an early and important mechanism that serves to facilitate the processing and presentation of Ag (42). Therefore, we examined whether the chimeric receptors differed in their ability to internalize aggregated receptor complexes. As demonstrated in Fig. 2Go, 30–60% of heterodimeric and homodimeric complexes containing Ig{alpha} and/or Igß were internalized from the cell surface within 10 min. Complexes containing Ig{alpha}-Igß tandem or Ig{alpha}(Y{Delta}F)/Igß were internalized relatively less than the other chimeras. However, there was no correlation between internalization and the capacity to facilitate the presentation of Ag. While the Ig{alpha}-Igß tandem homodimer had only 30% internalization, the Ag presentation of this chimeric complex was as efficient as the Ag presentation seen via the wild-type BCR (Fig. 1GoD). Thus, inability of these mutant and single chain chimeras to facilitate Ag presentation was not due to differences in internalization.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 2. All of the chimeric complexes were internalized to a similar degree following cross-linking. The percent of receptors internalized following cross-linking for 10 min is shown. This time point was chosen based on experiments demonstrating that the BCR, Igß homodimer, Ig{alpha} homodimer, and Ig{alpha}/Igß heterodimer all had similar rates and magnitudes of internalization with maximums at 10 min (data not shown). No significant additional clearance from the cell surface was observed after 30 min (data not shown).

 
Both Ig{alpha} and Igß are needed to form and access the MIIC*

As the different chimeric complexes did not significantly vary in their ability to internalize aggregating ligand, we next compared them to the BCR in their ability to deliver Ag to the MIIC. In unstimulated wild-type A20IIA1.6 cells, the Lamp-1+-bearing late endosomes that constitute the MIIC are diffusely distributed throughout the cytoplasm (Fig. 3GoA). However, upon BCR ligation, these vesicles aggregate and fuse to form an acidic multivesicular complex of large vesicles that we refer to as the MIIC*. The MIIC*, which is rich in MHC class II and Ii (30), typically contains 80% or more of the Lamp-1+ vesicles within the cell. There-fore, we next asked whether Ig{alpha}, Igß, or both were necessary to reconstitute the targeting and MIIC-modulating properties of the BCR. The chimeras on each of the indicated transfectants were dimerized with PDGF-BB, then aggregated with Abs labeled with FITC. After stimulation for 30 min, samples were fixed and stained for Lamp-1. Random fields from unstimulated and stimulated cells were then scored for presence of the MIIC* (>80% vesicles in a single multivesicular structure). Photomicrographs of typical results are shown in Fig. 3GoB. The chimeric receptors, which contained single copies of either Ig{alpha} or Igß, induced the MIIC* poorly (3 and 8% of cells, respectively) and did not colocalize efficiently with the Lamp-1+ vesicles. Similar results were obtained with the single chain chimera containing a tandem of Ig{alpha}. In contrast, those chimeric complexes that contain both Ig{alpha} and Igß, either on separate chains or in tandem, induced the aggregation of Lamp-1+ vesicles (34% of cells for the Ig{alpha}/Igß heterodimer). These complexes could also traffic to the MIIC* they had formed (Fig. 3GoB). To directly confirm that the Ig{alpha}/Igß heterodimeric complex was forming and trafficking to the same compartment as the BCR, we concurrently ligated each receptor independently with Abs labeled with FITC or PE. As expected, after 30 min, there was extensive cytoplasmic colocalization of the Ig{alpha}/Igß chimera with the BCR (data not shown). Thus, Ig{alpha} in combination with Igß recapitulates the MIIC-activating and -trafficking capacities of the endogenous BCR.



View larger version (75K):
[in this window]
[in a new window]
 
FIGURE 3. Formation and access to the MIIC* requires both Ig{alpha} and Igß. A, The BCR induces and targets to the MIIC*. Within 15 min of BCR (green) stimulation, >80% of detectable Lamp-1+ late endosomes (red) translocate to a single perinuclear site to form a single multivesicular structure that we refer to as the MIIC*. B, Aggregation of chimeric complexes (green) containing only Ig{alpha} or Igß (Ig{alpha} homodimer, Igß homodimer, Ig{alpha}-Ig{alpha} tandem) failed to induce the MIIC* (Lamp-1+/red) or efficiently colocalize with Lamp-1+ vesicles. In contrast, activated complexes containing both Ig{alpha} and Igß (Ig{alpha}/Igß heterodimer or Ig{alpha}-Igß tandem) induce and traffic to the MIIC* within 15 min (arrows). MIIC* induction and colocalization were dependent upon the ITAM tyrosines within Ig{alpha} (Ig{alpha}(Y{Delta}F)/Igß). Control experiments were done to show that the rabbit anti-mouse IgG1 Ab did not cross-react with the surface IgG2a (data not shown). Similar results were obtained in at least two independent clones expressing each chimera (data not shown).

 
Interestingly, the signaling-defective Ig{alpha}(Y{Delta}F)/Igß chimeric complex did not traffic to the Lamp-1+ compartment nor was it able to induce the aggregation of the MIICs’ constituent vesicles to form the MIIC*. The observed defect was very similar to that observed for the single chain chimeras, suggesting that Ig{alpha} and Igß may synergize to provide a signaling function that is dependent upon phosphorylation of the Ig{alpha}.

Our confocal analysis indicated that both Ig{alpha} and Igß were needed to access late endosomes, while the single chain and signaling-defective chimeras presumably were arrested in earlier endosomal compartments. Since early and late endosomes differ in their density, we performed percoll gradient centrifugation to follow the movement of the chimeras from early to late endosomes. Wild-type, Ig{alpha}, or Ig{alpha}/Igß cells were pulsed with PDGF-BB ligand, anti-hPDGFRß, and an HRP-conjugated secondary Ab for 15 min and chased for 30 min at 37°C. Fractions from each gradient were collected and assayed. As seen in Fig. 4GoA, the Ig{alpha} chimera was primarily detected in the earlier fractions in which early endosomes are found. In marked contrast, the Ig{alpha}/Igß heterodimer was distributed throughout the later dense fractions. In particular, there were significant amounts of chimera detected in the densest fractions (fractions 17–20). These fractions also contain the Lamp-1+ late endosomes most often implicated in Ag presentation (Ref. 43, and data not shown). The reduced amount of HRP activity associated with the Ig{alpha} homodimer was probably due to recycling of the receptor complex. These data, in conjunction with our previous confocal studies, demonstrate that receptor complexes containing both Ig{alpha} and Igß rapidly access late endosomal compartments not available to single-tail or signaling-defective receptor complexes.



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 4. The Ig{alpha}/Igß heterodimer targets dense endosomes and is degraded. A, The Ig{alpha}/ß heterodimer, but not a chimera containing Ig{alpha} alone, targets the dense endosomal fractions. A20 cells expressing either Ig{alpha} ({blacksquare}) or Ig{alpha}/Igß ({diamondsuit}) were pulsed with anti-hPDGFRß Ab and an HRP-conjugated secondary Ab and then warmed to 37°C for 30 min. Cells were then subjected to Percoll fractionation, and the HRP activity of each fraction assayed. The HRP activities of the fractions from nontransfected A20 cells ({blacktriangleup}) that underwent the same treatment were also analyzed. The light grey box denotes the distribution of the early endosome and plasma membrane marker transferrin receptor, while the darker grey box denotes the distribution of late endosome/lysosome markers Lamp-1 and ß-hexosaminidase in the dense fractions. The golgi marker {alpha}-mannosidase was found in fractions 1–5 (data not shown). B, The presence of Igß increases the turnover rate of Ig{alpha}. The surfaces of A20 cells were biotinylated at 4°C. The cells were cultured in medium at 37°C for the times indicated, and then were lysed. The Ig{alpha} chimera or sIgG (IgG2a) was immunoprecipitated and subjected to SDS-PAGE and Western blotting.

 
Receptor complexes able to access later endosomal compartments should be more rapidly degraded than complexes that arrest earlier in the endocytic pathway. Therefore, we examined whether degradation of Ig{alpha} was facilitated by coexpressed Igß. The surfaces of the cells expressing Ig{alpha} or Ig{alpha}/Igß were biotinylated and chased at 37°C for various times. The chimeric complexes were immunoprecipitated, resolved by SDS-PAGE, transferred to nylon membrane, and immunoblotted with streptavidin/HRP. Even after 4 h, there was little degradation of Ig{alpha} in singly transfected cells (Fig. 4GoB). In contrast, most of the Ig{alpha} chimera coexpressed with Igß was degraded by 2 h. These data indicate that receptors that contain both Ig{alpha} and Igß access a more degradative environment than receptors containing Ig{alpha} alone.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The BCR differs fundamentally from other surface receptors in the way it accesses specific endocytic compartments. In contrast to other receptors, which simply target various compartments within the endocytic pathway, the BCR generates signals that allow internalized Ag to be quickly and efficiently delivered to an acidic late endosomal structure rich in MHC class II (29, 30). Our data argue that it is these signaling capacities of the BCR that allow it to facilitate the presentation to T cells of MHC class II-restricted peptides derived from rare and fleeting Ags.

The compartment accessed by the BCR and by signaling competent receptor complexes bears the markers of the MIIC (Lamp-1+/MHC II+/transferrin receptor-) (19, 20, 21, 22, 30). However, stimulation of these receptors did more than facilitate targeting to this compartment. It also induced the translocation, fusion, and acidification of the widely distributed cytoplasmic vesicles that constitute the MIIC to form a single multivesicular complex that we term the MIIC*. Early endosomes were excluded from this complex (30). In contrast to an earlier report (44), we found this late endosomal structure to be rich in MHC class II molecules and Ii (30). However, the distribution of Ii was heterogeneous, suggesting that the MIIC* contains different microenvironments that differ in their content of Ii (45). The advantages of the MIIC* in comparison to the MIIC, or any other postulated processing compartment, are unclear. Regardless of the mechanism, our data demonstrate that receptors able to access this compartment are more rapidly degraded than those that cannot. It may be that by centralizing and organizing the processing compartments, the transport of Ag is simplified and, therefore, made more efficient.

Formation and targeting to the MIIC* required both Ig{alpha} and Igß. In the context of the heterodimer, most, if not all, inductive tyrosine phosphorylation occurs at the Ig{alpha}-chain (9), which then recruits Syk to the phosphorylated ITAM. Since the Igß ITAM in the heterodimer is not appreciably phosphorylated, it is not surprising that it cannot compensate for mutations in the Ig{alpha} ITAM. Recruitment of Syk is sufficient to activate the kinase and to initiate the signaling cascades normally activated by the native BCR (38, 46). The requirement for the Ig{alpha} ITAM indicates that Syk or molecules distal to it may be necessary for efficient Ag processing. This possibility is supported by experiments in which a dominant negative form of Syk could inhibit receptor-facilitated MHC class II-restricted Ag presentation to T cells (47). However, it is not clear if Syk is functioning purely as a signaling molecule or also as a docking molecule for unknown mediators of endosomal sorting (48, 49)

The mechanisms by which signals from the BCR enhance the delivery of Ag to the MIIC are unclear. One possibility is that signaling activates latent trafficking mechanisms within the cell. This seems unlikely given that receptors bound to either monovalent, which should not initiate signaling, or polyvalent Ags, which do, travel along the same endocytic pathway (50). Consistent with our data, however, they traffic to late endosomes at greatly differing rates (28) and efficiencies. The homotypic fusion we recently reported as occurring between vesicles of the MIIC to form the MIIC* might be a manifestation of a more general process that promotes heterotypic fusion between the MIIC* and endocytosed receptor complexes (30).

Rapid and direct delivery of Ag to the MIIC may be of particular importance in the germinal center, where there are strict temporal requirements for the recruitment of T cell help (51). During a humoral response, centroblasts in the dark zone of the germinal center are dividing every 7 h (52, 53). Even though the rate of division is high, it is not autonomous. Following almost every division, newly derived cells migrate to the light zone, where they are tested for their ability to compete for limiting amounts of Ag displayed on follicular dendritic cells and for their ability to recruit T cell help (51, 52). These two checkpoints ensure the selection of high-affinity B cells able to function within the context of the ongoing immune response. The process that bridges these two checkpoints is the presentation of Ag-derived MHC class II-restricted peptides to specific-activated T cells. Our data argue that the transition between these two checkpoints is facilitated by signals from the BCR that ensure that Ag is quickly and directly deposited in a processing compartment specialized for the derivation of peptides and their loading on MHC class II. In this way, the generation of MHC class II peptide complexes does not limit rapid B cell proliferation and selection.


    Acknowledgments
 
We thank Dr. Yair Argon for careful reading of this manuscript.


    Footnotes
 
1 M.R.C. is supported by Grants GM52736 and GM56187 from the National Institutes of Health and by the Arthritis Foundation. K.S. is supported by Cardiovascular Sciences Training Grant 5T32HL0738117. Back

2 Address correspondence and reprint requests to Dr. Marcus Clark, Department of Medicine, University of Chicago, 5841 South Maryland Avenue, MC 0930, Chicago, IL 60637. E-mail address: Back

3 Abbreviations used in this paper: BCR, B cell Ag receptor; ITAM, immunoreceptor tyrosine-based activation motif; MIIC, MHC class II-enriched compartment; Lamp-1, lysosome-associated membrane protein-1; CIIV, class II vesicles; PDGF, platelet-derived growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide. Back

Received for publication January 19, 1999. Accepted for publication March 11, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419.[Medline]
  2. Torres, R. M., H. Flaswinkel, M. Reth, K. Rajewsky. 1996. Aberrant B cell development and immune response in mice with a compromised BCR complex. Science 272:1804.[Abstract]
  3. Gong, S., M. C. Nussenzweig. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Ig-ß. Science 272:411.[Abstract]
  4. Cambier, J. C., C. M. Pleiman, M. R. Clark. 1994. Signal transduction by the B cell antigen receptor and its coreceptors. Annu. Rev. Immunol. 12:457.[Medline]
  5. Keegan, A. D., W. E. Paul. 1992. Multichain immune recognition receptors: similarities in structure and signaling pathways. Immunol. Today 13:63.[Medline]
  6. Cambier, J. C.. 1995. New nomenclature for the Reth motif (or ARH1/TAM/ARAM/YXXL). Immunol. Today 16:110.[Medline]
  7. Kurosaki, T.. 1997. Molecular mechanisms in B cell antigen receptor signaling. Curr. Opin. Immunol 9:309.[Medline]
  8. Reth, M., J. Wienands. 1997. Initiation and processing of signals from the B cell antigen receptor. Annu. Rev. Immunol. 15:453.[Medline]
  9. Luisiri, P., Y. J. Lee, B. J. Eisfelder, M. R. Clark. 1996. Cooperativity and segregation of function within the Ig{alpha}/ß heterodimer of the B cell antigen receptor complex. J. Biol. Chem. 271:5158.[Abstract/Free Full Text]
  10. Kim, K. M., G. Alber, P. Weiser, M. Reth. 1993. Differential signaling through the Ig-{alpha} and Ig-ß components of the B-cell antigen receptor. Eur. J. Immunol. 23:911.[Medline]
  11. Sanchez, M., Z. Misulovin, A. L. Burkhardt, S. Mahajan, T. Costa, R. Franke, J. B. Bolen, M. Nussenzweig. 1993. Signal transduction by immunoglobulin is mediated through Ig-{alpha} and Ig-ß. J. Exp. Med. 178:1049.[Abstract/Free Full Text]
  12. Tseng, J., Y. J. Lee, B. J. Eisfelder, M. R. Clark. 1994. The B cell antigen receptor complex: mechanisms and implications of tyrosine kinase activation. Immunol. Res. 13:299.[Medline]
  13. Clark, M. R., S. A. Johnson, J. C. Cambier. 1994. Analysis of Ig-{alpha} tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig-{alpha} stimulation of Fyn activity. EMBO J. 13:1911.[Medline]
  14. Kawauchi, K., A. H. Lazarus, M. J. Rapoport, A. Harwood, J. C. Cambier, T. L. Delovitch. 1994. Tyrosine kinase and CD45 tyrosine phosphatase activity mediate p21 ras activation in B cells stimulated through the antigen receptor. J. Immunol. 152:3306.[Abstract]
  15. Li, Y. Y., M. Baccam, S. B. Waters, J. E. Pessin, G. A. Bishop, G. A. Koretzky. 1996. CD40 ligation results in protein kinase C-independent activation of ERK and JNK in resting murine splenic B cells. J. Immunol. 157:1440.[Abstract]
  16. Dometsch, R. E., R. S. Lewis, C. C. Goodnow, J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:759.[Medline]
  17. Clark, E. A., J. A. Ledbetter. 1994. How B-cells and T-cells talk to each other. Nature 367:425.[Medline]
  18. Healy, J. I., C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 16:645.[Medline]
  19. Qiu, Y., X. Xu, A. Wandinger-Ness, D. P. Dalke, S. K. Pierce. 1994. Separation of subcellular compartments containing distinct functional forms of MHC class II. J. Cell Biol. 125:595.[Abstract/Free Full Text]
  20. Peters, P. J., J. J. Neefjes, V. Oorschot, H. L. Ploegh, H. J. Geuze. 1991. Segregation of MHC II molecules from MHC I molecules in the golgi complex for transport to lysosomal compartments. Nature 349:669.[Medline]
  21. Neefjes, J. J., V. Stollorz, P. J. Peters, H. J. Geuze, H. L. Ploegh. 1990. The biosynthetic pathway of MHC class II but not class I molecules intersects the endocytic route. Cell 61:171.[Medline]
  22. West, M. A., J. M. Lucocq, C. Watts. 1994. Antigen processing and class II MHC peptide-loading in human B-lymphoblastoid cells. Nature 369:147.[Medline]
  23. Amigorena, S., J. R. Drake, P. Webster, I. Mellman. 1994. Transient accumulation of new class II MHC molecules in a novel endocytic compartment in B lymphocytes. Nature 369:113.[Medline]
  24. Pierre, P., L. K. Denzin, C. Hammond, J. R. Drake, S. Amigorena, P. Cresswell, I. Mellman. 1996. HLA-DM is localized to conventional and unconventional MHC class II-containing endocytic compartments. Immunity 4:229.[Medline]
  25. Castellino, F., R. N. Germain. 1995. Extensive trafficking of MHC-class II-invariant chain complexes in the endocytic pathway and appearance of peptide-loaded class II in multiple compartments. Immunity 2:73.[Medline]
  26. Mellman, I.. 1996. Endocytosis and molecular sorting. Annu. Rev. Cell. Dev. 12:575.[Medline]
  27. Amigorena, S., C. Bonnerot, J. R. Drake, D. Choquet, W. Hunziker, J.-G. Guillet, P. Webster, C. Sautes, I. Mellman, W. H. Fridman. 1992. Cytoplasmic domain heterogeneity and functions of IgG Fc receptors in B lymphocytes. Science 256:1808.[Abstract/Free Full Text]
  28. Aluvihare, V. R., A. A. Khamlichi, G. T. Williams, L. Adorini, M. S. Neuberger. 1997. Acceleration of intracellular targeting of antigen by the B-cell antigen receptor: importance depends on the nature of the antigen-antibody interaction. EMBO J. 16:3553.[Medline]
  29. Batista, F. D., M. S. Neuberger. 1998. Affinity dependence of the B cell response to antigen: a threshold, a ceiling and the importance of off-rate. Immunity 8:751.[Medline]
  30. Siemasko, K., B. J. Eisfelder, E. Williamson, S. Kabak, M. R. Clark. 1998. Cutting Edge: Signals from the B lymphocyte antigen receptor regulate MHC class II containing late endosomes. J. Immunol. 160:5203.[Abstract/Free Full Text]
  31. Lanzavecchia, A.. 1985. Antigen-specific interaction between T and B cells. Nature 314:537.[Medline]
  32. Chesnut, R. W., H. M. Grey. 1981. Studies on the capacity of B cells to serve as antigen-presenting cells. J. Immunol. 126:1075.[Medline]
  33. Kim, N., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549.[Abstract/Free Full Text]
  34. Drake, J. R., E. A. Repasky, R. B. Bankert. 1989. Endocytosis of antigen, anti-idiotype, and anti-immunoglobulin antibodies and receptor re-expression by murine B cells. J. Immunol. 143:1768.[Abstract]
  35. Qiu, Y., X. Xu, A. Wandinger-Ness, D. P. Dalke, and S. K. Pierce. 1994. Separation of subcellular compartments containing distinct functional forms of MHC class II. J. Cell Biol. 125.
  36. Tseng, J., B. J. Eisfelder, M. R. Clark. 1997. The induction of apoptosis by the B cell antigen receptor requires both Ig-{alpha} and Ig-ß. Blood 89:1513.[Abstract/Free Full Text]
  37. Williams, L. T.. 1989. Signal transduction by the platelet-derived growth factor receptor. Science 243:1564.[Abstract/Free Full Text]
  38. Rowley, R. B., A. L. Burkhardt, H. G. Chao, G. R. Matsueda, J. B. Bolen. 1995. Syk protein-tyrosine kinase is regulated by tyrosine-phosphorylated Ig alpha/Ig beta immunoreceptor tyrosine activation motif binding and autophosphorylation. J. Biol. Chem. 270:11590.[Abstract/Free Full Text]
  39. Campbell, K. S., J. C. Cambier. 1990. B lymphocyte antigen receptors (mIg) are non-covalently associated with a disulfide-linked, inducibly phosphorylated glycoprotein complex. EMBO J. 9:441.[Medline]
  40. Patel, K. J., M. S. Neuberger. 1993. Antigen presentation by the B cell antigen receptor is driven by the {alpha}/ß sheath and occurs independently of its cytoplasmic tyrosines. Cell 74:939.[Medline]
  41. Bonnerot, C., D. Lankar, D. Hanau, D. Spehner, J. Davoust, J. Salamero, W. H. Fridman. 1995. Role of B cell receptor Ig{alpha} and Igß subunits in MHC class-II restricted antigen presentation. Immunity 3:335.[Medline]
  42. Lanzavecchia, A.. 1990. Receptor-mediated uptake and its effect on antigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. 8:73.
  43. Xu, X., B. Press, N. M. Wagle, H. Cho, A. Wandinger-Ness, S. K. Pierce. 1996. B cell antigen receptor signaling links biochemical changes in the class II peptide-loading compartment to enhanced processing. Int. Immunol. 8:1867.[Abstract/Free Full Text]
  44. Drake, J. R., P. Webster, J. C. Cambier, I. Mellman. 1997. Delivery of B cell receptor-internalized antigen to endosomes and class II vesicles. J. Exp. Med. 186:1299.[Abstract/Free Full Text]
  45. Ferrari, G., A. M. Knight, C. Watts, J. Pieters. 1997. Distinct intracellular compartments involved in invariant chain degradation and antigenic peptide loading of major histocompatibility complex (MHC) class II molecules. J. Cell Biol. 139:1433.[Abstract/Free Full Text]
  46. Kurosaki, T., S. A. Johnson, L. Pao, K. Sada, H. Yamamura, J. C. Cambier. 1995. Role of the Syk autophosphorylation site and SH2 domains in B cell antigen receptor signaling. J. Exp. Med. 182:1815.[Abstract/Free Full Text]
  47. Lankar, D., V. Briken, K. Adler, P. Weiser, S. Cassard, U. Blank, M. Viguier, C. Bonnerot. 1998. Syk tyrosine kinase and B cell antigen receptor (BCR) immunoglobulin-alpha subunit determine BCR-mediated major histocompatibility complex class II-restricted antigen presentation. J. Exp. Med. 188:819.[Abstract/Free Full Text]
  48. Felder, S. K., K. Miller, A. Moehren, J. Ullrich, J. Schlessinger. 1990. Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body. Cell 61:623.[Medline]
  49. Joly, M., A. Kazlauskas, S. Corvera. 1995. Phosphatidylinositol 3-kinase activity is required at a postendocytic step in platelet-derived growth factor receptor trafficking. J. Biol. Chem. 1995:13225.
  50. Song, W., H. Cho, P. Cheng, S. K. Pierce. 1995. Entry of B cell antigen receptor and antigen into class II peptide-loading compartment is independent of receptor cross-linking. J. Immunol. 155:4255.[Abstract]
  51. Kelsoe, G.. 1996. Life and death in germinal center (redux). Immunity 4:107.[Medline]
  52. MacLennan, I. C. M.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  53. Hanna, M. G.. 1964. An autoradiographic study of the germinal center in spleen white pulp during early intervals of the immune response. Lab. Invest. 13:95.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
O. O. Onabajo, M. K. Seeley, A. Kale, B. Qualmann, M. Kessels, J. Han, T.-H. Tan, and W. Song
Actin-Binding Protein 1 Regulates B Cell Receptor-Mediated Antigen Processing and Presentation in Response to B Cell Receptor Activation
J. Immunol., May 15, 2008; 180(10): 6685 - 6695.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Zhang, M. Veselits, S. O'Neill, P. Hou, A. L. Reddi, I. Berlin, M. Ikeda, P. D. Nash, R. Longnecker, H. Band, et al.
Ubiquitinylation of Igbeta Dictates the Endocytic Fate of the B Cell Antigen Receptor
J. Immunol., October 1, 2007; 179(7): 4435 - 4443.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. L. Dragone, M. D. Myers, C. White, S. Gadwal, T. Sosinowski, H. Gu, and A. Weiss
Src-like adaptor protein (SLAP) regulates B cell receptor levels in a c-Cbl-dependent manner
PNAS, November 28, 2006; 103(48): 18202 - 18207.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Gazumyan, A. Reichlin, and M. C. Nussenzweig
Ig{beta} tyrosine residues contribute to the control of B cell receptor signaling by regulating receptor internalization
J. Exp. Med., July 10, 2006; 203(7): 1785 - 1794.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-H. Kim, L. Cramer, H. Mueller, B. Wilson, and B. J. Vilen
Independent Trafficking of Ig-{alpha}/Ig-{beta} and {micro}-Heavy Chain Is Facilitated by Dissociation of the B Cell Antigen Receptor Complex
J. Immunol., July 1, 2005; 175(1): 147 - 154.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Reichlin, A. Gazumyan, H. Nagaoka, K. H. Kirsch, M. Kraus, K. Rajewsky, and M. C. Nussenzweig
A B Cell Receptor with Two Ig{alpha} Cytoplasmic Domains Supports Development of Mature But Anergic B Cells
J. Exp. Med., March 15, 2004; 199(6): 855 - 865.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. V. Barrault and A. M. Knight
Distinct Sequences in the Cytoplasmic Domain of Complement Receptor 2 Are Involved in Antigen Internalization and Presentation
J. Immunol., March 15, 2004; 172(6): 3509 - 3517.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. A. Perrin-Cocon, C. L. Villiers, J. Salamero, F. Gabert, and P. N. Marche
B Cell Receptors and Complement Receptors Target the Antigen to Distinct Intracellular Compartments
J. Immunol., March 15, 2004; 172(6): 3564 - 3572.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. E. Skelsey, E. Mayhew, and J. Y. Niederkorn
Splenic B Cells Act as Antigen Presenting Cells for the Induction of Anterior Chamber-Associated Immune Deviation
Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5242 - 5251.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. B. Chung, A. D. Wells, S. Adler, A. Jacob, L. A. Turka, and J. G. Monroe
Incomplete Activation of CD4 T Cells by Antigen-Presenting Transitional Immature B Cells: Implications for Peripheral B and T Cell Responsiveness
J. Immunol., August 15, 2003; 171(4): 1758 - 1767.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Li, K. Siemasko, M. R. Clark, and W. Song
Cooperative interaction of Ig{alpha} and Ig{beta} of the BCR regulates the kinetics and specificity of antigen targeting
Int. Immunol., October 1, 2002; 14(10): 1179 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Kabak, B. J. Skaggs, M. R. Gold, M. Affolter, K. L. West, M. S. Foster, K. Siemasko, A. C. Chan, R. Aebersold, and M. R. Clark
The Direct Recruitment of BLNK to Immunoglobulin {alpha} Couples the B-Cell Antigen Receptor to Distal Signaling Pathways
Mol. Cell. Biol., April 15, 2002; 22(8): 2524 - 2535.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Snyder, X. Zhang, and L. J. Wysocki
Negligible Class II MHC Presentation of B Cell Receptor-Derived Peptides by High Density Resting B Cells
J. Immunol., April 15, 2002; 168(8): 3865 - 3873.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. Valdez, W. Mah, M. M. Winslow, L. Xu, P. Ling, and S. E. Townsend
Major Histocompatibility Complex Class II Presentation of Cell-associated Antigen Is Mediated by CD8{alpha}+ Dendritic Cells In Vivo
J. Exp. Med., March 11, 2002; 195(6): 683 - 694.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Siemasko, B. J. Skaggs, S. Kabak, E. Williamson, B. K. Brown, W. Song, and M. R. Clark
Receptor-Facilitated Antigen Presentation Requires the Recruitment of B Cell Linker Protein to Ig{alpha}
J. Immunol., March 1, 2002; 168(5): 2127 - 2138.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Roucard, C. Thomas, M.-A. Pasquier, J. Trowsdale, J.-J. Sotto, J. Neefjes, and M. van Ham
In Vivo and In Vitro Modulation of HLA-DM and HLA-DO Is Induced by B Lymphocyte Activation
J. Immunol., December 15, 2001; 167(12): 6849 - 6858.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Kraus, L. I. Pao, A. Reichlin, Y. Hu, B. Canono, J. C. Cambier, M. C. Nussenzweig, and K. Rajewsky
Interference with Immunoglobulin (Ig){alpha} Immunoreceptor Tyrosine-based Activation Motif (ITAM) Phosphorylation Modulates or Blocks B Cell Development, Depending on the Availability of an Ig{beta} Cytoplasmic Tail
J. Exp. Med., August 20, 2001; 194(4): 455 - 470.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. L. Lang, L. Shen, H. Gao, W. F. Cusack, G. A. Lang, and W. F. Wade
Fc{{alpha}} Receptor Cross-Linking Causes Translocation of Phosphatidylinositol-Dependent Protein Kinase 1 and Protein Kinase B{{alpha}} to MHC Class II Peptide-Loading-Like Compartments
J. Immunol., May 1, 2001; 166(9): 5585 - 5593.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. S. Gordon, R. M. Kato, F. Lansigan, A. A. Thompson, R. Wall, and D. J. Rawlings
Aberrant B cell receptor signaling from B29 (Igbeta , CD79b) gene mutations of chronic lymphocytic leukemia B cells
PNAS, May 9, 2000; 97(10): 5504 - 5509.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siemasko, K.
Right arrow Articles by Clark, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siemasko, K.
Right arrow Articles by Clark, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS