|
|
||||||||
and Igß Are Required for Efficient Trafficking to Late Endosomes and to Enhance Antigen Presentation1




Sections of
*
Rheumatology and
Pathology, Department of Medicine, Committee on Immunology, University of Chicago, Chicago, IL 60637; and
Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742
| Abstract |
|---|
|
|
|---|
and Igß, capable of internalizing and delivering specific Ags
to specialized late endosomes, where they are processed into peptides
for loading onto MHC class II molecules. By this mechanism, the
presentation of receptor-selected epitopes to T cells is enhanced by
several orders of magnitude. Previously, it has been reported that,
under some circumstances, either Ig
or Igß can facilitate the
presentation of Ags. However, we now demonstrate that if these Ags are
at low concentrations and temporally restricted, both Ig
and Igß
are required. When compared with the BCR, chimeric complexes containing
either chain alone were internalized but failed to access the MHC class
II-enriched compartment (MIIC) or induce the aggregation and fusion of
its constituent vesicles. Furthermore, Ig
/Igß complexes in which
the immunoreceptor tyrosine-based activation motif tyrosines of Ig
were mutated were also incapable of accessing the MIIC or of
facilitating the presentation of Ag. These data indicate that both
Ig
and Igß contribute signaling, and possibly other functions, to
the BCR that are necessary and sufficient to reconstitute the
trafficking and Ag-processing enhancing capacities of the intact
receptor complex. | Introduction |
|---|
|
|
|---|
and Igß, which provide the receptor with its signaling capacity
(4). The cytoplasmic domains of Ig
and Igß are devoid of intrinsic
tyrosine kinase activity. However, each contains a conserved motif
(immunoreceptor tyrosine-based activation motif (ITAM)) (5, 6) that,
upon phosphorylation, recruits and activates the tyrosine kinase Syk
(7, 8). Although the ITAMs of Ig
and Igß are identical, Igß
functions to amplify the tyrosine phosphorylation of Ig
(9). These
and other data indicate that nonconserved sequences embedded within
each ITAM may determine their specific function within the context of
the intact BCR complex (10, 11, 12, 13). The pathways that lie distal to Syk
are myriad and include the intermediates Ras (14) and Jnk (Ref. 15, and
M.R.C., unpublished observations), as well as the distal transcription
factors, NFAT and NF
B (16). Although necessary, this interconnected
network of activation cascades is not sufficient to drive the expansion
and differentiation of resting peripheral B cells into large
populations of activated lymphocytes capable of secreting high-affinity
IgG Abs. Also required are soluble and membrane-restricted signals
provided by T cells, which recognize MHC class II, restricted
Ag-derived peptides expressed on the B cell surface (17, 18) In B cells, newly synthesized MHC class II molecules are found in at least two compartments that contain processed peptides. The best characterized is the MHC class II-enriched compartment (MIIC), which bears the markers of a late endocytic compartment, including the lysosome-associated membrane protein-1 (Lamp-1) (19, 20, 21, 22). Another compartment, the CIIV, is derived from earlier endocytic vesicles that contain the transferrin receptor (23, 24). Evidence indicates that these, and possibly other compartments, can coexist and be utilized within a particular cell line (25). However, late endosomes are more degradative (26) and, therefore, may be better adapted for the rapid and efficient derivation of immunogenic peptides.
The native BCR has endocytic, targeting, and activating properties, all
of which may contribute to the ability of the receptor to both restrict
and enhance the presentation of specific peptides to T cells. The
receptor is the main physiological portal by which Ag can gain access
to the cell interior. Pinocytosis is poor, and the only Fc
R found on
B cells contains a motif within its cytoplasmic tail that inhibits
endocytosis (27). Once internalized, the BCR rapidly targets Ag to
MIIC-like compartments, ensuring low-affinity Ags access to the
processing compartment (28, 29). Finally, the BCR delivers signals
capable of inducing the aggregation, fusion, and acidification of the
late endosomes that constitute the MIIC (30). Such changes are
predicted to generate a subcellular environment conducive to the
processing and loading of peptides onto MHC class II molecules. In
toto, these receptor attributes allow surface expression of Ag-derived
MHC class II-restricted peptides within 20 min of initial receptor
binding (28) at an efficiency as much as 106 greater than
that obtained for fluid-phase Ag (31, 32).
Herein, we demonstrate that the ability of the BCR to rapidly deliver
endocytosed complexes to the MIIC is dependent upon both Ig
and
Igß. Although endocytosis could be mediated by chimeras containing
either Ig
or Igß, these chimeric complexes could not efficiently
target Ag to the MIIC, nor could they facilitate the presentation of
temporally restricted Ag. Analysis of signaling defective chimeras
suggests that cooperation between Ig
and Igß may lead to the
recruitment and activation of signaling molecules required for
targeting to the MIIC.
| Materials and Methods |
|---|
|
|
|---|
The A20/IIA1.6 B cell line (IgG2a+, FcR-, I-Ad+, I-Ed+) (33), was maintained in IMDM (Life Technologies, Grand Island, NY) supplemented with 10% FCS (HyClone, Logan, UT), 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in 7.5% CO2.
Platelet-derived growth factor receptor (PDGFR) chimera construction
Construction, expression, and activation of PDGFR chimeras,
except Ig
-Igß tandem, have been previously described (9). The
Ig
-Igß tandem was constructed by PCR amplification of the
cytoplasmic tail of Ig
with a 5' primer to introduce a
BamHI restriction site and a 3' overlapping primer
(ATGCCCAGCTGGAAAAGCCAGACAAGGATGACGGCAAGGC)
that contained both 3' Ig
and 5' Igß sequences. Igß was then
amplified using a 5' primer complementary to the primer above and a 3'
primer to introduce an EcoRI restriction site. The two PCR
products were knit together using the 5' BamHI primer and
the 3' EcoRI primer. The resulting knit was cloned,
sequenced, and expressed as described previously (9).
Ag presentation
For myoglobin/anti-IgG conjugation, goat anti-rabbit IgG (heavy and light chain)(ICN Pharmaceuticals, Costa Mesa, CA) was incubated with a 10:1 molar ratio excess of LC-SPDP (Pierce, Rockford, IL) for 75 min at room temperature in 10 mM PO4, 150 mM NaCl (pH 8) (conjugation buffer). Myoglobin (Sigma, St. Louis, MO) was incubated at a 1:1 molar ratio with Trauts reagent (Pierce) for 75 min at 4°C in 100 mM PO4, 50 mM NaCl, 1 mM EDTA (pH 9). The reactive goat anti-rabbit IgG was then incubated with a 10:1 molar excess of reactive myoglobin at room temperature for 72 h in conjugation buffer. The conjugate was purified using a rabbit anti-goat IgG (Fc fragment-specific) (Jackson ImmunoResearch, West Grove, PA) column. The approximate final concentration of myoglobin in the conjugate stock was 500 ng/ml.
To target Ag as a "pulse" to the chimeric complexes on each transfected cell line, the following procedure was used. First, transfected or wild-type (nontransfected) cells were incubated on ice sequentially with PDGF-BB (100 ng/ml) (Sigma) for 5 min, mouse anti-human PDGFRß (5 µg/ml) (Genzyme, Cambridge, MA) for 3 min, and rabbit anti-mouse IgG1 (5 µg/ml) (Zymed, San Francisco, CA) for 10 min. After washing, cells were then incubated with the indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG for 15 min on ice. The cells were then warmed to 37°C for 30 min, washed, and used in Ag presentation assays. To control for nonspecific uptake by pinocytosis, cells were treated as above, however, the primary anti-PDGFRß Ab was omitted. In experiments in which Ag was targeted to the endogenous BCR, cells were first incubated with rabbit polyclonal anti-IgG Abs (15 µg/ml) (Jackson ImmunoResearch) for the times indicated. This stimulating Ab is recognized by the myoglobin-Ab conjugate.
To target Ag continuously to the chimeric complexes, cells were incubated on ice sequentially with PDGF-BB, mouse anti-human PDGFRß, and rabbit anti-mouse at the concentrations indicated above. Samples were then incubated with the indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG for 15 min and then put directly into Ag presentation assays without washing.
The ability of each transfectant to present either pulsed or continuously available Ag was assayed by incubating 5 x 104 cells with 5 x 104 myoglobin-specific T cell clones (Ach 8.2) for 20 h at 37°C. Supernatants were collected and assayed for IL-2 content by coculture with the lymphokine-dependent cell line CTLL-2 (American Type Culture Collection, Manassas, VA), followed by measurement of 3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide (MTT) incorporation.
Confocal microscopy
For BCR/Lamp-1 costaining, A20/IIA1.6 cells were first incubated
with 10 µg/ml goat anti-mouse IgG2a Abs (Southern Biotechnology
Associates, Birmingham, AL) at 4°C for 10 min, washed in IMDM, then
incubated with donkey anti-goat IgG-FITC (1:100) (Jackson
ImmunoResearch). To surface stain the chimeras, each transfectant was
incubated sequentially on ice with 100 ng/ml PDGF-BB ligand, 5 µg/ml
mouse anti-hPDGFRß, and 5 µg/ml anti-mouse IgG1-FITC
(Zymed). Following surface labeling, cells were warmed to 37°C for 30
min then fixed with 3% paraformaldehyde/3% sucrose and permeabilized
with 0.05% saponin and stained for Lamp-1 as described previously
(30). Confocal sections of
0.751.0 um were acquired using a Zeiss
(Oberkochen, Germany) 410 confocal microscope and displayed by
pseudo-coloring using LSM software by overlaying consecutive scans of
568ex/590em (PE-red) and
488ex/515em (FITC-green). MIIC* was defined as
any single intracellular aggregate containing >80% of the visible
Lamp-1+ endosomal compartment (30). MIIC* formation for
each sample was quantitated by scoring 10 random fields (
100 cells).
Internalization
Clones expressing similar levels of PDGFR chimera(s) (9) were each incubated on ice with 100 ng/ml PDGF-BB ligand, 5 µg/ml mouse anti-human PDGFRß, and 5 µg/ml anti-mouse IgG1-HRP (Zymed). A total of 2.5 x 107 cells was then washed two times with IMDM/0.5% FCS and incubated at 37°C as indicated. To inhibit further endocytosis, cells were placed on ice. Cells were then washed two times with IMDM/0.5% FCS and resuspended in 100 µl IMDM/0.5% FCS. The amount of noninternalized chimeras bound with HRP-conjugated Ab was measured colorimetrically by incubating the cells with 5 mM O-phenylenediamine HCl in 0.15 M phosphate buffer (pH 6) with 0.15% H2O2 at room temperature for 15 min in the dark (34). The total HRP activity for each clone was measured by solubilizing a duplicate sample from the 10-min time point with an equal volume of PBS/1% Nonidet P-40 for 10 min at room temperature and then incubating the cells with 0.15% H2O2 at room temperature for 15 min in the dark. Peroxidase reactions were stopped with 6 N HCl and centrifuged at 20,000 x g for 10 min at 4°C. Percent internalization was calculated by: (OD 492 total - OD sample)/OD total.
Subcellular distribution of the chimeric receptors
Cell samples were incubated in DMEM/BSA (6 mg/ml BSA, 20 mM MOPS (pH 7.4)) containing 100 ng/ml PDGF-BB ligand, anti-hPDGFR (10 µg/ml), and an HRP-conjugated secondary Ab (10 µg/ml) (Zymed) for 15 min on ice, then washed and warmed to 37°C for 30 min. The cells were then subject to percoll gradient fractionation. Fractions (0.5 ml) were collected and assayed for HRP activity, as described (35).
Surface biotinylation, immunoprecipitation, and analysis of
surface-biotinylated Ig
Cell samples (5 x 107) were washed at 4°C with HBSS lacking phosphate and containing 20 mM Na HEPES (pH 7.4) and incubated in 10 ml of the same buffer containing 0.2 mg/ml sulfosuccinimidyl-6-(biotinamido)hexanoate (SSBH) (Pierce) for 15 min at 4°C. After the 15-min incubation, 10 ml of freshly made SSBH containing solution was then added, and the incubation extended for an additional 15 min at 4°C. Cells then were washed with DME/BSA and chased in medium at 37°C for 30 min. The cells were suspended in lysis buffer (1% Nonidet P-40, 50 mM Tris/HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, and protease inhibitors) and resolved on an 8% SDS-PAGE, transferred to nylon membrane (Immobilon-P; Millipore, Bedford, MA), and Western blotted with streptavidin-HRP (1:10,000 dilution) (Pierce) and developed using enhanced chemiluminescence (Amersham, Arlington Heights, IL).
| Results |
|---|
|
|
|---|
and/or Igß
We and others have demonstrated that Ig
and Igß each
contribute distinct (10, 11, 12, 13) and complementary (9) signaling functions
to the receptor complex. Both chains are required for normal B
lymphocyte development (2, 3) and both are required for
receptor-induced apoptosis in immature cells (36). These biological
functions are thought to be dependent upon the signaling capacities of
each chain. While it is clear that Ig
and Igß are necessary for
establishing the resting peripheral B lymphocyte pool, their relative
contributions to the subsequent immune responses mediated by these
cells is uncertain. To begin to examine if Ig
and Igß can function
synergistically in mediating peripheral immune responses, we asked
whether one or both were required for the BCR to facilitate the
presentation of Ag to T cells.
To address this question, we needed to be able to form and compare
different receptor complexes containing the cytoplasmic tails of Ig
and/or Igß. Therefore, we derived clones of the B cell lymphoma A20
IIA1.6 expressing chimeras in which the extracellular and transmembrane
domains of the PDGFR
or -ß were fused to the cytoplasmic tails of
Ig
, Igß, or a tandem of both (Fig. 1
A) (9). Since PDGFR
and
-ß have equal affinity for PDGF-BB, adding it to cells expressing a
single chimera [PDGFRß/Ig
(Ig
) or PDGFRß/Igß (Igß)]
induces homodimers to form on the cell surface. On cells expressing two
different chimeras (PDGFRß/Ig
and PDGFR
/Igß), heterodimers
are formed (Ig
/Igß heterodimer). These dimeric
complexes, which constitute the resting receptor, can then be
aggregated (activated) with anti-receptor Abs (37).
|
and Igß
In our assays, we sought to compare the ability of each chimeric
complex to facilitate Ag presentation to that of the endogenous BCR on
each transfectant. Therefore, the test Ag, myoglobin, was covalently
conjugated to Abs that would recognize the aggregating Abs of each
complex, goat anti-rabbit IgG (Fig. 1
B). Transfected or
wild-type (nontransfected) cells were incubated on ice sequentially
with PDGF-BB, mouse anti-human PDGFRß, and rabbit anti-mouse
IgG1 to aggregate the chimeras or rabbit anti-mouse IgG to
aggregate the BCR. After washing, cells were then incubated with the
indicated dilutions of myoglobin-conjugated goat anti-rabbit IgG
for 15 min on ice, warmed to 37°C for 30 min, and then washed again.
In this way, the Ag was given as a pulse at the beginning of the
experiment. Ag-pulsed B cells were incubated with myoglobin-specific T
cells, and IL-2 production was assayed after 20 h.
Only chimeric complexes containing both Ig
and Igß were capable of
facilitating the presentation of pulsed Ag to T cells (Fig. 1
C). Furthermore, the degree to which these
Ig
/Igß-containing complexes presented Ag was nearly identical to
that of the BCR on each transfectant. BCR-stimulated cells, in the
absence of targeted Ag, did not stimulate the T cells as measured in
our assay. Nor did stimulation of the BCR increase the production of
IL-2 (data not shown). Some modest enhancement of Ag presentation by
the Ig
or Igß homodimeric complexes was observed at higher doses
of Ag. However, it was not comparable to Ag targeted to the BCR. Nor
was it comparable to Ag targeted to the chimeric complexes containing
both Ig
and Igß cytoplasmic tails. Flow cytometric analysis
demonstrated that all of the transfectants expressed similar levels of
each chimera. Furthermore, each chimeric complex was capable of binding
similar amounts of myoglobin-Ab conjugate (Ref. 9, and data not shown).
Ig
and Igß contain ITAMs that, individually, are able to recruit
and activate tyrosine kinases (13, 33, 38). However, the Ig
ITAM is
the predominant motif for the activation of tyrosine kinases (9, 11).
Therefore, we mutated the two tyrosines of the Ig
ITAM to
phenylalanines. These conservative changes are not expected to affect
the overall conformation of the cytoplasmic tail but should
specifically abolish the ability of these residues to be
phosphorylated. As predicted, the Ig
(Y
F)/Igß heterodimeric
complex was incapable of initiating tyrosine kinase activation (S.K.
and M.R.C., unpublished observations). We then asked whether this
signaling defective receptor complex could facilitate the presentation
of myoglobin. As demonstrated in Fig. 1
D, it could not.
These results suggest that the signaling capacity of the BCR is
necessary for the presentation of Ag.
Next, we examined what the spatial requirements were for cooperation
between Ig
and Igß. The two chains are always found in association
with the BCR as a disulfide-linked heterodimer (39). However, it is not
known if this configuration is necessary for the functioning of these
chains. Therefore, we constructed single chain chimeras in which the
extracellular and transmembrane domains of PDGFRß were fused to
tandem cytoplasmic domains of Ig
-Igß or Ig
-Ig
. The
Ig
-Igß tandem homodimer could facilitate the presentation of Ag,
while the Ig
-Ig
tandem homodimer could not (Fig. 1
D).
Thus, regardless of the spatial relationships between the two chains,
Igß is able to provide one or more nonredundant functions that are
necessary to facilitate the presentation of Ag.
Our results demonstrating the interdependence of the Ig
and Igß
cytosolic tails are in apparent contrast to previous reports in which
chimeras containing either the Ig
or Igß cytoplasmic tails alone
could facilitate the presentation of Ag (40, 41). However, in those
experiments, Ag complexes were available to the receptor for the
duration of the assay or at high concentration. In our experiments, Ag
was targeted to the receptor as a pulse at the beginning of each
experiment. To test whether our single chain chimeras could facilitate
the presentation of continuously available Ag, we first loaded chimeric
receptors with varying concentrations of Ag complexes and then
incubated transfectants with myoglobin-specific T cells in the presence
of the concentration of Ag complex used to initially load the receptor.
Under these conditions, both the Igß homodimer and the Ig
/Igß
heterodimeric complexes facilitated the presentation of myoglobin (Fig. 1
E).
Receptors containing either Ig
or Igß are internalized
The rapid internalization of the ligated BCR is an early and
important mechanism that serves to facilitate the processing and
presentation of Ag (42). Therefore, we examined whether the chimeric
receptors differed in their ability to internalize aggregated receptor
complexes. As demonstrated in Fig. 2
,
3060% of heterodimeric and homodimeric complexes containing Ig
and/or Igß were internalized from the cell surface within 10 min.
Complexes containing Ig
-Igß tandem or Ig
(Y
F)/Igß were
internalized relatively less than the other chimeras. However, there
was no correlation between internalization and the capacity to
facilitate the presentation of Ag. While the Ig
-Igß tandem
homodimer had only 30% internalization, the Ag presentation of this
chimeric complex was as efficient as the Ag presentation seen via the
wild-type BCR (Fig. 1
D). Thus, inability of these mutant and
single chain chimeras to facilitate Ag presentation was not due to
differences in internalization.
|
and Igß are needed to form and access the MIIC*
As the different chimeric complexes did not significantly vary in
their ability to internalize aggregating ligand, we next compared them
to the BCR in their ability to deliver Ag to the MIIC. In unstimulated
wild-type A20IIA1.6 cells, the Lamp-1+-bearing late
endosomes that constitute the MIIC are diffusely distributed throughout
the cytoplasm (Fig. 3
A).
However, upon BCR ligation, these vesicles aggregate and fuse to form
an acidic multivesicular complex of large vesicles that we refer to as
the MIIC*. The MIIC*, which is rich in MHC class II and Ii (30),
typically contains 80% or more of the Lamp-1+ vesicles
within the cell. There-fore, we next asked whether Ig
, Igß, or
both were necessary to reconstitute the targeting and MIIC-modulating
properties of the BCR. The chimeras on each of the indicated
transfectants were dimerized with PDGF-BB, then aggregated with Abs
labeled with FITC. After stimulation for 30 min, samples were fixed and
stained for Lamp-1. Random fields from unstimulated and stimulated
cells were then scored for presence of the MIIC* (>80% vesicles in a
single multivesicular structure). Photomicrographs of typical results
are shown in Fig. 3
B. The chimeric receptors, which
contained single copies of either Ig
or Igß, induced the MIIC*
poorly (3 and 8% of cells, respectively) and did not colocalize
efficiently with the Lamp-1+ vesicles. Similar results were
obtained with the single chain chimera containing a tandem of Ig
. In
contrast, those chimeric complexes that contain both Ig
and Igß,
either on separate chains or in tandem, induced the aggregation of
Lamp-1+ vesicles (34% of cells for the Ig
/Igß
heterodimer). These complexes could also traffic to the MIIC* they had
formed (Fig. 3
B). To directly confirm that the Ig
/Igß
heterodimeric complex was forming and trafficking to the same
compartment as the BCR, we concurrently ligated each receptor
independently with Abs labeled with FITC or PE. As expected,
after 30 min, there was extensive cytoplasmic colocalization of the
Ig
/Igß chimera with the BCR (data not shown). Thus, Ig
in
combination with Igß recapitulates the MIIC-activating and
-trafficking capacities of the endogenous BCR.
|
(Y
F)/Igß chimeric
complex did not traffic to the Lamp-1+ compartment nor was
it able to induce the aggregation of the MIICs constituent vesicles
to form the MIIC*. The observed defect was very similar to that
observed for the single chain chimeras, suggesting that Ig
and Igß
may synergize to provide a signaling function that is dependent upon
phosphorylation of the Ig
.
Our confocal analysis indicated that both Ig
and Igß were needed
to access late endosomes, while the single chain and
signaling-defective chimeras presumably were arrested in earlier
endosomal compartments. Since early and late endosomes differ in their
density, we performed percoll gradient centrifugation to follow the
movement of the chimeras from early to late endosomes. Wild-type,
Ig
, or Ig
/Igß cells were pulsed with PDGF-BB ligand,
anti-hPDGFRß, and an HRP-conjugated secondary Ab for 15 min and
chased for 30 min at 37°C. Fractions from each gradient were
collected and assayed. As seen in Fig. 4
A, the Ig
chimera was
primarily detected in the earlier fractions in which early endosomes
are found. In marked contrast, the Ig
/Igß heterodimer was
distributed throughout the later dense fractions. In particular, there
were significant amounts of chimera detected in the densest fractions
(fractions 1720). These fractions also contain the
Lamp-1+ late endosomes most often implicated in Ag
presentation (Ref. 43, and data not shown). The reduced amount of HRP
activity associated with the Ig
homodimer was probably due to
recycling of the receptor complex. These data, in conjunction with our
previous confocal studies, demonstrate that receptor complexes
containing both Ig
and Igß rapidly access late endosomal
compartments not available to single-tail or signaling-defective
receptor complexes.
|
was facilitated by coexpressed Igß. The surfaces of the cells
expressing Ig
or Ig
/Igß were biotinylated and chased at 37°C
for various times. The chimeric complexes were immunoprecipitated,
resolved by SDS-PAGE, transferred to nylon membrane, and immunoblotted
with streptavidin/HRP. Even after 4 h, there was little
degradation of Ig
in singly transfected cells (Fig. 4
chimera coexpressed with Igß was
degraded by 2 h. These data indicate that receptors that contain
both Ig
and Igß access a more degradative environment than
receptors containing Ig
alone. | Discussion |
|---|
|
|
|---|
The compartment accessed by the BCR and by signaling competent receptor complexes bears the markers of the MIIC (Lamp-1+/MHC II+/transferrin receptor-) (19, 20, 21, 22, 30). However, stimulation of these receptors did more than facilitate targeting to this compartment. It also induced the translocation, fusion, and acidification of the widely distributed cytoplasmic vesicles that constitute the MIIC to form a single multivesicular complex that we term the MIIC*. Early endosomes were excluded from this complex (30). In contrast to an earlier report (44), we found this late endosomal structure to be rich in MHC class II molecules and Ii (30). However, the distribution of Ii was heterogeneous, suggesting that the MIIC* contains different microenvironments that differ in their content of Ii (45). The advantages of the MIIC* in comparison to the MIIC, or any other postulated processing compartment, are unclear. Regardless of the mechanism, our data demonstrate that receptors able to access this compartment are more rapidly degraded than those that cannot. It may be that by centralizing and organizing the processing compartments, the transport of Ag is simplified and, therefore, made more efficient.
Formation and targeting to the MIIC* required both Ig
and Igß. In
the context of the heterodimer, most, if not all, inductive tyrosine
phosphorylation occurs at the Ig
-chain (9), which then recruits Syk
to the phosphorylated ITAM. Since the Igß ITAM in the heterodimer is
not appreciably phosphorylated, it is not surprising that it cannot
compensate for mutations in the Ig
ITAM. Recruitment of Syk is
sufficient to activate the kinase and to initiate the signaling
cascades normally activated by the native BCR (38, 46). The requirement
for the Ig
ITAM indicates that Syk or molecules distal to it may be
necessary for efficient Ag processing. This possibility is supported by
experiments in which a dominant negative form of Syk could inhibit
receptor-facilitated MHC class II-restricted Ag presentation to T cells
(47). However, it is not clear if Syk is functioning purely as a
signaling molecule or also as a docking molecule for unknown mediators
of endosomal sorting (48, 49)
The mechanisms by which signals from the BCR enhance the delivery of Ag to the MIIC are unclear. One possibility is that signaling activates latent trafficking mechanisms within the cell. This seems unlikely given that receptors bound to either monovalent, which should not initiate signaling, or polyvalent Ags, which do, travel along the same endocytic pathway (50). Consistent with our data, however, they traffic to late endosomes at greatly differing rates (28) and efficiencies. The homotypic fusion we recently reported as occurring between vesicles of the MIIC to form the MIIC* might be a manifestation of a more general process that promotes heterotypic fusion between the MIIC* and endocytosed receptor complexes (30).
Rapid and direct delivery of Ag to the MIIC may be of particular importance in the germinal center, where there are strict temporal requirements for the recruitment of T cell help (51). During a humoral response, centroblasts in the dark zone of the germinal center are dividing every 7 h (52, 53). Even though the rate of division is high, it is not autonomous. Following almost every division, newly derived cells migrate to the light zone, where they are tested for their ability to compete for limiting amounts of Ag displayed on follicular dendritic cells and for their ability to recruit T cell help (51, 52). These two checkpoints ensure the selection of high-affinity B cells able to function within the context of the ongoing immune response. The process that bridges these two checkpoints is the presentation of Ag-derived MHC class II-restricted peptides to specific-activated T cells. Our data argue that the transition between these two checkpoints is facilitated by signals from the BCR that ensure that Ag is quickly and directly deposited in a processing compartment specialized for the derivation of peptides and their loading on MHC class II. In this way, the generation of MHC class II peptide complexes does not limit rapid B cell proliferation and selection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Marcus Clark, Department of Medicine, University of Chicago, 5841 South Maryland Avenue, MC 0930, Chicago, IL 60637. E-mail address: ![]()
3 Abbreviations used in this paper: BCR, B cell Ag receptor; ITAM, immunoreceptor tyrosine-based activation motif; MIIC, MHC class II-enriched compartment; Lamp-1, lysosome-associated membrane protein-1; CIIV, class II vesicles; PDGF, platelet-derived growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide. ![]()
Received for publication January 19, 1999. Accepted for publication March 11, 1999.
| References |
|---|
|
|
|---|
/ß heterodimer of the B cell antigen receptor complex. J. Biol. Chem. 271:5158.
and Ig-ß components of the B-cell antigen receptor. Eur. J. Immunol. 23:911.[Medline]
and Ig-ß. J. Exp. Med. 178:1049.
tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig-
stimulation of Fyn activity. EMBO J. 13:1911.[Medline]
and Ig-ß. Blood 89:1513.
/ß sheath and occurs independently of its cytoplasmic tyrosines. Cell 74:939.[Medline]
and Igß subunits in MHC class-II restricted antigen presentation. Immunity 3:335.[Medline]
This article has been cited by other articles:
![]() |
O. O. Onabajo, M. K. Seeley, A. Kale, B. Qualmann, M. Kessels, J. Han, T.-H. Tan, and W. Song Actin-Binding Protein 1 Regulates B Cell Receptor-Mediated Antigen Processing and Presentation in Response to B Cell Receptor Activation J. Immunol., May 15, 2008; 180(10): 6685 - 6695. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhang, M. Veselits, S. O'Neill, P. Hou, A. L. Reddi, I. Berlin, M. Ikeda, P. D. Nash, R. Longnecker, H. Band, et al. Ubiquitinylation of Igbeta Dictates the Endocytic Fate of the B Cell Antigen Receptor J. Immunol., October 1, 2007; 179(7): 4435 - 4443. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Dragone, M. D. Myers, C. White, S. Gadwal, T. Sosinowski, H. Gu, and A. Weiss Src-like adaptor protein (SLAP) regulates B cell receptor levels in a c-Cbl-dependent manner PNAS, November 28, 2006; 103(48): 18202 - 18207. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gazumyan, A. Reichlin, and M. C. Nussenzweig Ig{beta} tyrosine residues contribute to the control of B cell receptor signaling by regulating receptor internalization J. Exp. Med., July 10, 2006; 203(7): 1785 - 1794. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Kim, L. Cramer, H. Mueller, B. Wilson, and B. J. Vilen Independent Trafficking of Ig-{alpha}/Ig-{beta} and {micro}-Heavy Chain Is Facilitated by Dissociation of the B Cell Antigen Receptor Complex J. Immunol., July 1, 2005; 175(1): 147 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Reichlin, A. Gazumyan, H. Nagaoka, K. H. Kirsch, M. Kraus, K. Rajewsky, and M. C. Nussenzweig A B Cell Receptor with Two Ig{alpha} Cytoplasmic Domains Supports Development of Mature But Anergic B Cells J. Exp. Med., March 15, 2004; 199(6): 855 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. V. Barrault and A. M. Knight Distinct Sequences in the Cytoplasmic Domain of Complement Receptor 2 Are Involved in Antigen Internalization and Presentation J. Immunol., March 15, 2004; 172(6): 3509 - 3517. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Perrin-Cocon, C. L. Villiers, J. Salamero, F. Gabert, and P. N. Marche B Cell Receptors and Complement Receptors Target the Antigen to Distinct Intracellular Compartments J. Immunol., March 15, 2004; 172(6): 3564 - 3572. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Skelsey, E. Mayhew, and J. Y. Niederkorn Splenic B Cells Act as Antigen Presenting Cells for the Induction of Anterior Chamber-Associated Immune Deviation Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5242 - 5251. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Chung, A. D. Wells, S. Adler, A. Jacob, L. A. Turka, and J. G. Monroe Incomplete Activation of CD4 T Cells by Antigen-Presenting Transitional Immature B Cells: Implications for Peripheral B and T Cell Responsiveness J. Immunol., August 15, 2003; 171(4): 1758 - 1767. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, K. Siemasko, M. R. Clark, and W. Song Cooperative interaction of Ig{alpha} and Ig{beta} of the BCR regulates the kinetics and specificity of antigen targeting Int. Immunol., October 1, 2002; 14(10): 1179 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kabak, B. J. Skaggs, M. R. Gold, M. Affolter, K. L. West, M. S. Foster, K. Siemasko, A. C. Chan, R. Aebersold, and M. R. Clark The Direct Recruitment of BLNK to Immunoglobulin {alpha} Couples the B-Cell Antigen Receptor to Distal Signaling Pathways Mol. Cell. Biol., April 15, 2002; 22(8): 2524 - 2535. [Abstract] [Full Text] [PDF] |
||||