| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Section of Immunobiology, Yale University School of Medicine, and Howard Hughes Medical Institute, New Haven, CT 06520
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The exact mechanism of EAE pathogenesis mediated by encephalitogenic T
cells is currently unknown, but undoubtedly involves TNF-
,
lymphotoxin- (LT-; also known as TNF-ß), and FasL (CD95L),
members of the TNF family of cytokines (8). The production of TNF-
and LT- by Th1 clones has been correlated with encephalitogenic
potential (9), and Abs to both prevent EAE upon transfer of
encephalitogenic clones (10). Upon activation, Th1 cells not only
produce TNF and LT, but up-regulate cell surface expression of FasL
(11). The subsequent engagement of Fas (CD95), the counter-receptor of
FasL, leads to cell death via apoptosis of the Fas-expressing target
(12, 13). The Fas/FasL interaction has been linked to regulation of
homeostasis within the immune system, dysregulation of which leads to
lymphadenopathy, splenomegaly, and autoimmune disorders (14, 15).
Two recent reports investigating the roles of Fas and FasL in EAE induction have shown that a disruption in a functional Fas and FasL interaction has a protective effect on the active induction of EAE using mice carrying the lpr or gld mutations (16, 17). We expanded upon these studies by using an MBP transgenic (tg) mouse to examine the role of Fas/FasL interaction in the active and passive induction of EAE. We found that immunization of MBP mice carrying gld or lpr mutations did not protect against EAE induction, and these animals had a disease course similar to that of MBP-wt mice. In addition, the adoptive transfer of FasL-deficient T cells into wt or gld recipients only led to a partial reduction in EAE disease severity. However, a protective effect was detected when the recipient mice were deficient in Fas. Therefore, it is clear that interaction of Fas with FasL is not necessary to develop EAE, but it can play a role in EAE pathogenesis. Thus, both Fas-dependent and Fas-independent mechanisms contribute to EAE pathogenesis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B10.PL (I-Au), C57BL/6-gld/gld, and C57BL/6-lpr/lpr mice were purchased from The Jackson Laboratory (Bar Harbor, ME). MBP-TCR tg mice expressing a TCR transgene specific for the acetylated N-terminal peptide of MBP bound to I-Au were generated as previously described (18) and reared in our colony at Yale University (New Haven, CT). B10.PL-gld/gld (B10.PL-gld) and B10.PL-lpr/lpr (B10.PL-lpr) mice were produced in our breeding colony by backcrossing C57BL/6-gld/gld and C57BL/6-lpr/lpr mice onto B10.PL, respectively, and then were crossed with the MBP TCR tg (MBP-wt; backcrossed to B10.PL for >10 generations) to generate MBP-TCR-gld/gld (MBP-gld) and MBP-TCR-lpr/lpr (MBP-lpr) mice. All mice were between 5 and 8 wk of age when used.
Peptides and Abs
The N-terminal MBP peptide Ac1–11 (Ac-ASQKRPSQRSK) was synthesized and HPLC purified by the W. M. Keck Foundation Biotechnology Resource Laboratory at Yale University. A clonotypic mAb (19G) specific for the MBP-TCR was produced in our laboratory using standard hybridoma generation techniques (6). Anti-mouse CD4-PE and anti-mouse CD8-R163 were purchased from Life Technologies (Gaithersburg, MD). Anti-mouse IgG-FITC (Fc specific) was purchased from Sigma (St. Louis, MO). Anti-mouse CD49d-biotin, anti-mouse TCR Vß8.1/8.2-FITC, and anti-mouse Fas-PE were purchased from PharMingen (San Diego, CA). Streptavidin-PE was purchased from Caltag (Burlingame, CA).
Cells
MBP-TCR CD4+ T cell lines were generated from the
spleens of MBP-wt, MBP-gld, and MBP-lpr mice. Briefly, spleens were
minced, and following removal of RBC, 20 x 106 total
splenocytes were cultured in 25-cm2 flasks in the presence
of 5 µg/ml Ac1–11 in Click’s Eagle’s Hanks’ amino acids medium
containing 5% FCS. After 3–4 days, the cellular contents from each
flask were transferred to a 75-cm2 flask and maintained in
Click’s medium containing 10% FCS and 2 U/ml IL-2. Four days before
adoptive transfer, the MBP T cell lines were restimulated with Ac1–11
(5 µg/ml) in the presence of inactivated splenocytes from B10.PL
mice. On the day of transfer, live cells were isolated by density
gradient separation and washed three times in PBS, and 1 x
106 T cells were adoptively transferred in 200 µl of PBS.
On the day of adoptive transfer, the cell surface expression of CD4,
Vß8.2, CD49d, and the MBP-TCR (mAb 19G) was confirmed by cell surface
staining and flow cytometry, and was >99% positive for these markers.
In addition, the T cell lines were analyzed for stimulation with
Ac1–11 by measuring cell proliferation and cytokine production. All
lines produced the Th1 cytokine IFN-
as detected by ELISA as
previously described (19).
Immunofluorescence
Three-color immunofluorescence using anti-MBP-TCR (19G detected with anti-mouse FITC), anti-CD4-PE, and anti-CD8-R613 was conducted on single-cell suspensions from thymus and lymph nodes from B10.PL, B10.PL-gld, B10.PL-lpr, MBP-wt, MBP-gld, and MBP-lpr mice at 5 wk of age. Single-color immunofluorescence using anti-CD4-PE, anti-Vß8.1/8.2-FITC, anti-CD49d-biotin detected with streptavidin-PE, and anti-MBP TCR (19G) detected with anti-mouse Fc-specific IgG-FITC was conducted on T cell lines generated from MBP-wt, -gld, and -lpr mice on the day of transfer. Ab incubations were conducted on ice, and the cells were fixed in 1% paraformaldehyde and analyzed using CellQuest on a FACScan (Becton Dickinson, Mountain View, CA).
T cell activation assay and IFN- secretion
For proliferation analysis, 2–4 x 106 rested
MBP-wt, MBP-gld, and MBP-lpr T cells were restimulated with 5 µg/ml
Ac1–11 and inactivated B10.PL splenocytes at least 7 days following
primary stimulation. Four days later, dead cells were removed by
density separation, washed three times, and plated at 1/2 dilutions of
cells starting at 2.5 x 105 cells/well. Upon plating
the cells were pulsed with [3H]TdR for 15 h and
counted on a beta counter to measure proliferation (counts per minute).
For Ag-specific proliferation and IFN- production, 20,000 rested T
cells were cocultured with 1.5 x 105 irradiated
B10.PL (H-2u) spleen cells in the presence of 1/10
dilutions of Ac1–11 from 0.001–10 µg/ml. After 24 h, culture
supernatants were collected and analyzed by ELISA for the production of
IFN- as previously described (19), using anti-mouse IFN- and
anti-mouse IFN--biotin, both purchased from PharMingen (San
Diego, CA). Cultures were pulsed after 48 h with
[3H]TdR and were harvested 15 h later.
EAE induction
Groups of four or five MBP-wt, MBP-gld, and MBP-lpr female mice were immunized with 75 µg of MBP Ac1–11 emulsified in CFA containing 4 mg/ml of heat-killed mycobacterium tuberculosis H37Ra (Sigma) s.c. in each internal flank. Two hundred nanograms of pertussis toxin (List, Campbell, CA) in PBS was injected i.v. at the time of immunization and again 48 h later. For experiments requiring adoptive transfer of encephalitogenic T cells, irradiated (600 rad) female B10.PL, B10.PL-gld, or B10.PL-lpr mice were i.v. injected with 1 x 106 CD4+ T cells generated from MBP-wt, MBP-gld, or MBP-lpr mice. Individual animals were assessed daily for symptoms of EAE and were scored using a scale from 1–5 as follows: 0, no disease; 1, limp tail and/or wobbly walk; 2, hind limb paresis; 3, hind limb paralysis; 4, hind and fore limb paralysis; and 5, death.
Cytokine mRNA synthesis
RT-PCR was used to detect cytokine synthesis by CD4+ T cell lines generated from MBP-wt, MBP-gld, and MBP-lpr mice. Total RNA was isolated from 5 x 106 T cells on the day of transfer using Trizol (Life Technologies). cDNA was synthesized as previously described (19) from 5 µg of RNA using Superscript II reverse transcriptase (Life Technologies). PCR reactions were performed using 1 µl of cDNA for all primers except IL-5, with one amplification cycle of denaturation at 94°C for 5 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min; followed by 30 or 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min; and ending with a final extension at 72°C for 15 min. The annealing temperature for the IL-5 primers was 60°C.
Primer sequences for hypoxanthine phosphoribosyltransferase (HPRT),
IFN-, TNF-, IL-2, and IL-4 (20) and primers for perforin (21)
were previously described. The forward primer for LT- was
TGGCTGGGAACAGGGGAAGGTTGAC; the reverse primer was
CGTGCTTTCTTCTAGAACCCCTTGG (22). The forward primer for IL-5 was
GAAAGAGACCTTGACACAGCTG; the reverse primer was
GAACTCTTGCAGGTAATCCAGG. The forward primer for IL-10 was
CCAGTTTTACCTGGTAGAAGTGATG; the reverse primer was
AACTCAGACGACCTGAGGTCCTGGATCTGT. The forward primer for FasL was
GAGTGTGGCCCATTTAACAG; the reverse primer was
CTTTTAAAGCTTATACAAGCCGAAAAAGGT.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To analyze positive selection of the MBP-TCR transgene containing
the rearranged - and ß-chains of a TCR that recognizes the
acetylated N-terminal peptide of MBP in mice carrying the
gld or lpr mutation, we crossed MBP-wt mice to
B10.PL-gld/gld (B10.PL-gld) or -lpr/lpr
(B10.PL-lpr) mice to generate B10.PL-gld/gld and
B10.PL-lpr/lpr mice with and without the MBP-TCR. The
transgenic mice are called MBP-wt, MBP-gld, and MBP-lpr. FACS analysis
showed that CD4 and CD8 populations were not altered in the lymph nodes
or thymus of B10.PL mice carrying the gld (Fig. 1
A) or lpr (Fig. 1B) mutation. In addition, positive selection of the MBP-TCR
was not disrupted in mice carrying the gld/gld (Fig. 1A) or lpr/lpr (Fig. 1B) mutation.
This is shown by identical CD4 and CD8 populations in the lymph nodes
of MBP-wt mice when compared with either MBP-gld (Fig. 1A)
or MBP-lpr (Fig. 1B) mice. Further analysis of MBP-TCR tg
mice showed that >90% of CD4+ lymph node cells expressed
the MBP-TCR as assessed by staining with a clonotypic mAb for the
MBP-TCR (19G). Similarly, in the thymus the CD4 and CD8 single-positive
(SP) and CD4 CD8 double-positive T cell populations were similar in
MBP-wt, -gld, and -lpr mice. In addition, examination of thymic CD4 SP
cells showed that essentially all cells expressed the MBP-TCR. These
data demonstrate good positive selection of the MBP TCR transgene in
MBP-wt, -gld, and -lpr mice with no accumulation of any T cell
populations.
|
To examine the role of the Fas/FasL mechanism in EAE, we immunized
both MBP-wt and MBP-gld mice simultaneously with the MBP peptide
Ac1–11. The mice were evaluated daily for 40 days for clinical signs
of EAE. Fig. 2A shows that the
disease course for the MBP-wt and MBP-gld mice was almost identical for
the two groups with a day of onset as early as days 7–8
postimmunization. The data shown in Fig. 2 are summarized in Table I, which shows that both the MBP-wt and
MBP-gld groups had a high incidence of EAE (93 and 88%, respectively).
Mortality was also similar in the MBP-gld (59%) and MBP-wt (67%)
groups. These high rates of mortality suggest that MBP mice that
developed EAE were generally unable to recover from its debilitating
effects. Additionally, the average day of onset and peak day of disease
were identical for the two groups. The average peak disease scores for
the MBP-wt (3.8) and MBP-gld (3.5) mice were also comparable. The high
incidence, elevated peak disease score, and early onset of EAE in
MBP-gld mice suggest that the gld mutation disrupting
functional pairing of the FasL with Fas does not alter the induction of
or the recovery from EAE in gld/gld mice carrying the MBP
transgene. The comparison of the EAE disease course in MBP-wt vs
MBP-lpr mice yielded similar results, with the incidence and mortality
rate being equal in the two groups (Fig. 2B and Table I).
However, a delay in disease onset was observed in the MBP-lpr group,
shown as a reduction in the average cumulative disease score from 91 in
the MBP-wt to 72 (Fig. 2B and Table I). The decrease
observed in the MBP-lpr group was not statistically significant
compared with that in the MBP-wt group.
|
|
To further examine the role of Fas/FasL interactions in the
pathogenesis of EAE, we generated T cell lines from MBP-wt, MBP-gld,
and MBP-lpr mice. As shown in Fig. 3A, T cell lines generated
from the three strains of mice are CD4+ (Fig. 3, A–C) and express the MBP-TCR (Fig. 3, D–F). The
MBP-TCR expression was further confirmed by positive staining for the
ß-chain (Vß8.2) contained in the MBP-TCR (Fig. 3, G–I).
Since we have previously shown a correlation between encephalitogenic
potential and the expression of 4 (CD49d)-containing
integrins on T cell clones (6), we examined our T cell lines for
expression of CD49d and found all three lines to express high levels of
the integrin subunit (Fig. 3, J–L). The deficiency in
Fas expression in the MBP-lpr lines was confirmed by lack of Fas cell
surface expression (Fig. 3O) compared with that in MBP-wt
(Fig. 3M) and MBP-gld (Fig. 3N) lines.
|
P, all three lines express high levels of mRNA for the Th1
cytokines IFN-, TNF-, and LT-. Only low level expression of
the Th2 cytokines IL-4, IL-5, and IL-10 was detected. Interestingly,
the MBP-gld line seemed to produce more IL-10 mRNA than the MBP-wt and
MBP-lpr T cell lines, and the MBP-lpr line produced less IL-2 (Fig. 3P). Since the PCR shown in Fig. 3P was not
quantitative, we performed semiquantitative RT-PCR, as we have
previously described (19), on two additional T cell lines generated
from each mouse. This analysis did not demonstrate an increase in IL-10
mRNA in the MBP-gld T cells lines compared with that in the MBP-wt and
MBP-lpr T cell lines (data not shown). Similarly, IL-2 levels were not
different in the three groups of mice. The small amount of IL-2 mRNA is
consistent with the lines being polarized effector cells and not
activated naive cells. In addition, we were able to detect message for
perforin, but not for TGFß1 or TGFß2 (data not shown). Since FasL
is only expressed following activation of T cells, we wanted to confirm
that the T cell lines used in this study were expressing FasL. As shown
in Fig. 3P, all three lines produce FasL mRNA. The point
mutation in the FasL gene described in gld mice (23), which
affects ligand binding but not mRNA transcription, was confirmed in our
colony. The robust expression of the housekeeping gene HPRT is shown as
a control for RNA isolation and cDNA synthesis.
It has been previously reported that T cells isolated from
gld and lpr mice have elevated proliferative
responses and increased production of IFN- and TNF- when
stimulated through the TCR (24). The increased proliferation is
attributed to a lack of T cell death due to a disruption in Fas/FasL
interactions. We also observed this phenomenon in proliferation assays
conducted with multiple T cell lines. T cells from MBP-gld and MBP-lpr
mice stimulated with Ac1–11 consistently gave increased proliferative
responses compared with T cells from MBP-wt mice (Fig. 4A). This increased
proliferation was accompanied by increased secretion of IFN-
measured by ELISA (Fig. 4B). In addition, using
semiquantitative RT-PCR we observed increased mRNA for both IFN- and
TNF- in MBP-gld and -lpr T cell lines compared with that in wt
control T cells (data not shown). We also examined the production of
IL-4, but it was produced in low abundance and was barely detectable by
ELISA (data not shown). Since T cell death via Fas/FasL does not occur
in proliferation assays with MBP-gld and MBP-lpr T cells, the increased
cell proliferation probably reflects increased cell numbers, which
could account for increased levels of IFN-. To address whether
MBP-gld and MBP-lpr T cell lines have an intrinsic capacity for
increased proliferation, we examined the rate of proliferation of T
cells 4 days following Ag stimulation. In Fig. 4C we show
that when equal numbers of T cells are replated in medium alone,
MBP-lpr and MBP-gld T cells do not proliferate at a higher rate that
MBP-wt T cells.
|
To further examine the role of Fas/FasL in the pathogenesis of
EAE, we adoptively transferred the T cell lines from MBP-wt and MBP-gld
mice into B10.PL or B10.PL-gld recipient mice. Because the number of
transferred encephalitogenic T cells affects the severity and duration
of the EAE disease course, we performed the experiment using 1 x
106 T cells to examine whether a less severe disease course
than that observed in Fig. 2 is dependent upon Fas/FasL. As shown in
Fig. 5A B10.PL-gld mice
receiving MBP-wt T cells had an earlier day of onset of disease (day
7), an earlier peak day of disease (day 13), and a longer, more severe
disease course compared with B10.PL mice receiving MBP-wt T cells,
which had a day of onset on day 12 and a peak day of disease on day 15
and had essentially recovered by day 24. In contrast, B10.PL and
B10.PL-gld mice receiving MBP-gld T cells, had a slight delay in
disease onset (days 13 and 14, respectively) and a delayed peak day of
disease (day 18) resulting in an overall less severe disease course
(Fig. 5A). To further examine the observed differences
between disease courses shown in Fig. 5A, we calculated the
total disease score obtained for each of the four groups of mice in
three separate experiments. The data shown represent the average
cumulative disease score ± SE for each group (Fig. 5B). A small increase in the cumulative disease score was
observed in the B10.PL-gld mice transferred with MBP-wt T cells
compared with that in the control group of B10.PL mice receiving MBP-wt
T cells. The increase was 112% of the control value and was not
statistically significant. In contrast, wt and gld recipient
mice transferred with MBP-gld T cells had reduced disease scores that
were 38 and 68% of the control group value, respectively (Fig. 5B). However, a statistically significant decrease
(p < 0.001) from the control group was only
observed in the B10.PL recipient mice. These data show that in the
absence of a functional FasL on the transferred T cells a reduced
severity of disease is observed.
|
Because the reduction in disease severity shown in Fig. 5 was only
partial in the presence of a mutated FasL protein, we performed the
analogous experiment using mice with a disrupted Fas gene
(lpr) to more fully understand the role of Fas in EAE
pathogenesis. Fig. 6A
illustrates that a disrupted Fas molecule on the transferred T cells,
regardless of the recipient, has no effect on the disease course
observed. This is illustrated by the almost identical disease courses
of B10.PL recipient mice transferred with MBP-wt or MBP-lpr T cells. In
contrast, the B10.PL-lpr mice adoptively transferred with MBP-wt T
cells did not exhibit signs of EAE over a 35-day time course (Fig. 6A). Nevertheless, the lpr recipients transferred
with MBP-lpr T cells had a disease course similar to that of the wt
control group, suggesting an important role for the Fas molecule on the
encephalitogenic T cells. The cumulative disease scores for the four
groups of mice shown in Fig. 6A were calculated for five
separate experiments and are shown in Fig. 6B. Similar
disease scores were observed for the wt control group and for B10.PL
and B10.PL-lpr mice transferred with MBP-lpr T cells. The lack of
disease in the lpr recipient mice transferred with MBP-wt T
cells is shown by a cumulative disease score of 1.5, representing a
statistically significant decrease (p < 0.001)
from the control group. This indicates that cells lacking Fas can use
alternative mechanisms to generate EAE, whereas cells with competent
Fas appear to be biased toward the use of FasL to cause pathology.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). These results are in contrast to the
study by Sabelko et al., demonstrating protection in lpr
mice immunized with gpMBP (16). However, an important difference
between the two studies is the number of autoreactive T cells at the
time of immunization. In the MBP-TCR transgenic mice up to 90% of the
CD4+ T cells express the transgene. In nontransgenic mice
only a small population of T cells specific for myelin Ags exists. The
activation and expansion of a large pool of autoreactive T cells in the
MBP transgenic mouse results in a rapid and often fatal disease course
(Fig. 2). However, in B10.PL mice immunized with the same Ag an acute
disease course occurs with little mortality (20). Unchecked
lymphoproliferation of the MBP tg T cells in vivo seems not to be a
factor in the EAE observed in transgenic animals, since all T cell
populations in the thymus, lymph nodes, and spleen (data not shown) of
MBP-gld and MBP-lpr are comparable to those in MBP-wt at the age of EAE
induction (Fig. 1). In this study the susceptibility to EAE in MBP-gld
and MBP-lpr mice is presumably due to a large resident population of
autoreactive T cells that can enter the CNS upon activation, leading to
cell destruction by mechanisms other than the binding of Fas by FasL. Two separate groups investigated active EAE induction using MOG35–55 in C57BL/6 mice carrying the lpr and gld mutations with contrasting results. Waldner et al. reported almost complete protection from EAE in both B6-gld and B6-lpr mice, with wt mice exhibiting a relapsing-remitting disease course (17). In contrast, the study performed by Malipiero et al. showed only partial protection in disease severity, with lpr and gld mice exhibiting a monophasic disease course, and the wt mice exhibiting a chronic disease course (25). The discrepancies in these two studies may be reflected by the more aggressive disease induction protocol used by the Malipiero group using a higher concentration of pertussis toxin and boosting with Ag 1 wk following primary Ag challenge. The protection reported by the Waldner group may partially reflect disease induced in older male mice, which are less susceptible to disease than female mice. The lack of substantial protection in the Malipiero study may also reflect differences in EAE induction with MBP vs MOG. An acute monophasic disease course ensues following MBP immunization in B10.PL mice, while a chronic disease course accompanied by demyelination and a possible role for autoantibody occur with MOG immunization in C57BL/6 mice (26, 27).
The active induction of EAE in gld or lpr mice
does not definitively reveal the cell populations in which the presence
of Fas and FasL are important in EAE. To examine this question we
performed adoptive transfers to passively induce EAE and targeted the
deficiency in Fas and FasL to the transferred T cells, the recipient,
or both. Because EAE is believed to be mediated by Th1 CD4+
T cells, we generated Th1 T cell lines from MBP-wt, MBP-gld, and
MBP-lpr mice. These lines expressed CD4 and the MBP TCR and produced
the Th1 cytokines IFN-, TNF-, and LT- on the day of transfer
(Fig. 3). These T cell lines also expressed high levels of very late
Ag-4, which we have previously shown to be important for migration into
the CNS (6). These experiments revealed that the absence of a
functional Fas molecule in the recipient mice was protective against
EAE induction by the transfer of MBP-wt T cells compared with transfer
into wt recipients (Fig. 6). We attribute this result to a blockage of
Fas-induced cell death due to the absence of functional Fas expression
in the CNS. This result is supported by the reverse experiment, showing
no disease protection when Fas-deficient T cells are transferred into
wt recipients. Thus, protection is only observed when Fas is deficient
in the CNS. To our surprise, the transfer of MBP-lpr T cells into
lpr recipients did not result in any measurable disease
protection. This result is probably due to the loss of homeostatic
regulation of the transferred T cell population by Fas and FasL (28).
The lymphoproliferative disorders observed in MRL mice carrying the
gld and lpr mutations led investigators to
propose that Fas/FasL interactions are essential for the homeostatic
control of T cell populations (29). This was supported by the
observation that T cells express both Fas and FasL upon activation and
that T cells commit fratricide and perhaps even suicide by this
mechanism, controlling the extent of the T cell response (30). Thus,
the loss of Fas on the cell surface of the transferred T cells may
allow them to accumulate in sufficient numbers to cause EAE by a
mechanism that is clearly unrelated to Fas/FasL.
We cannot, however, exclude the possibility that the protection
observed upon transfer of MBP-wt T cells into lpr recipients
is due to death of the Fas-expressing wt T cells by interaction with
FasL-expressing cells in the lpr recipients. This control of
the T cell population could occur in the periphery or perhaps in the
CNS. This mechanism of controlling the transferred T cell population
would not be present when Fas-deficient T cells are transferred into
lpr recipients. To test whether MBP-wt T cells undergo cell
death following transfer into lpr recipients we are
performing experiments to determine whether the wt T cells enter the
CNS and undergo apoptosis or whether T cell apoptosis occurs in the
periphery in T cells that never enter the CNS. Additional evidence for
homeostatic control of the transferred T cell population is the
increased disease severity observed in gld animals
transferred with MBP-wt T cells (Fig. 5B). The absence of a
functional FasL to mediate Fas-induced death in the recipient may allow
the encephalitogenic T cells to accumulate more rapidly and in larger
numbers than in wt recipients, leading to earlier onset and a more
severe disease course. The increase in disease severity was consistent
in three independent experiments. Since the MBP-gld and -lpr T cell
lines do not proliferate at a higher rate in vitro on the day of
transfer (Fig. 4C), we are investigating the potential loss
of homeostatic control in vivo due to deficiencies in Fas or FasL by
measuring the numbers of MBP tg T cells observed in the CNS at specific
time points following adoptive transfer. We are also examining whether
there is an increase in cell divisions in the transferred T cell
population when both the transferred T cells and the recipient mice are
deficient in Fas or FasL, and no protection from disease is observed.
The substantial protection observed when Fas was absent from the CNS
was only partially reproduced in the reciprocal experiment examining
EAE in the absence of FasL on the transferred T cells (Fig. 5).
Inflammatory cytokines produced by the infiltrating T cells are likely
candidates for the cause of the paralysis that we observed in the
absence of FasL on the transferred T cell population. These include
IFN-, TNF-, and LT-, all abundantly produced by the
encephalitogenic T cell lines we generated (Fig. 3). By ELISA, we found
that the MBP-gld and -lpr T cell lines secreted a higher level of
IFN- compared with MBP-wt T cells (Fig. 4B). Increased
IFN- production may contribute to the lack of total protection
observed when FasL-deficient T cells are transferred into B10.PL mice.
IFN- production is highly correlated with encephalitogenicity and
may contribute to disease by up-regulation of adhesion molecules on
endothelial cells, facilitating migration of lymphocytes into the CNS;
induction of MHC class I and MHC class II molecules on astrocytes,
microglial cells, and brain endothelium facilitating Ag presentation in
the CNS; and activation of macrophages leading to production of nitric
oxide, a potent cytotoxic molecule (1). TNF- and LT-, like FasL,
are members of the TNF family and cause cell death by apoptosis
following interaction with their counter-receptors, the TNFR1 and
TNFR2, leading to a cascade of proteolytic events culminating in
blebbing of the cytoplasmic membrane, nuclear condensation, and DNA
fragmentation (8, 31). In addition to death via a Fas mechanism (32),
oligodendrocyte cell death and subsequent myelin damage have been shown
to be mediated by both TNF- and LT- (33, 34). TNF- and LT-
share the same receptors (TNFR1 and TNFR2), with TNFR1 shown to be
expressed by astrocytes, microglia, and oligodendrocytes, and
TNFR2 expressed by microglia in rat brain (35).
In addition to the production of IFN-, TNF-, and LT- we have
shown that our CD4 T cells lines express perforin (Fig. 3). Perforin is
contained in cytoplasmic organelles resembling granules and is released
into the cell interface between the effector and the target cell, where
it inserts into the cell membrane, creating holes that allow the uptake
of granzyme, which causes lysis (36). Produced in abundance in CD8 CTL,
CD4 T cells have also been shown to mediate cytotoxicity via perforin
(37). Although perforin knockout C57BL/6 mice were shown to be
susceptible to MOG35–55-induced EAE (25), perforin mRNA
was detected before disease onset in MBP-induced EAE in the Lewis rat
(38). In addition, Held et al. (39) showed that only 1.6% of
IL-2R+ cells express perforin mRNA following EAE induced by
MBP immunization. In contrast, 25% of the same cell population was
shown to produce perforin in EAE induced by adoptive transfer of
encephalitogenic T cells, suggesting a greater role for perforin in
passive induction of EAE than in active induction.
We propose that the early pathogenesis in the CNS is mediated by a
small number of CD4+ T cells that express FasL. FasL
interacts with Fas on oligodendrocytes, presumably up-regulated by
IFN- (8) produced by the Th1 encephalitogenic T cell, leading to
apoptotic death of oligodendrocytes. This early cell destruction then
leads to a full inflammatory response and the recruitment of additional
autoreactive T cells, macrophages, and other cell types to the site of
immune attack forming an inflammatory lesion. The ensuing myelin
destruction would provide ample Ag for the continued activation and
expansion of the autoreactive T cell pool. As the autoreactive Th1
cells accumulate, the local production of the pathogenic Th1 cytokines
TNF- and LT- would also increase, resulting in continued
apoptotic death of oligodendrocytes and demyelination. Macrophages
present may contribute to oligodendrocyte destruction by the production
of nitric oxide (40). The escalating inflammatory response could then
be dampened by any number of proposed mechanisms, including T cell
apoptosis by Fas and FasL and the emergence of a Th2 response (41).
Thus, only when small numbers of encephalitogenic T cells, allowing
only limited production of Th1 inflammatory cytokines in the CNS, are
transferred into recipients deficient in Fas, is protection from
disease observed. The transfer of 10 times more T cells into
Fas-deficient recipients (our unpublished observations) or the presence
of large numbers of autoreactive T cells in MBP transgenic mice (Fig. 2) overcomes protection, presumably due to overwhelming production of
inflammatory cytokines in the CNS, leading to oligodendrocyte cell
damage and circumventing a role for Fas. This is supported by data
demonstrating only partial protection when the encephalitogenic T cells
lack a functional FasL. Although experimental evidence shows that Fas
expression in the CNS is important for EAE induction, it is not
essential. This becomes important in the pursuit of therapeutic agents.
Therapeutic strategies targeting blocking of Fas in the CNS may be
helpful for the prevention of multiple sclerosis exacerbations, but not
for the treatment of an acute episode once inflammation is established.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Bonnie N. Dittel, Section of Immunobiology, Yale University School of Medicine, P.O. Box 208011, 310 Cedar St., FMB 402, New Haven, CT 06520-8011. E-mail:
3 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; MBP, myelin basic protein; LT, lymphotoxin; tg, transgenic; wt, wild type; SP, single positive; HPRT, hypoxanthine phosphoribosyltransferase.
Received for publication November 2, 1998. Accepted for publication March 15, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4 integrin by CD4 T cells is required for their entry into brain parenchyma. J. Exp. Med. 177:57. production by myelin basic protein-specific T cell clones correlates with encephalitogenicity. Int. Immunol. 2:539. in T helper 1, T helper 2, and T helper 0 clones bearing the same TCR. J. Immunol. 158:4065.[Abstract]
and tumor necrosis factor- by stimulated CD4+ T cells. J. Immunol. 146:4138.[Abstract]
and tumor necrosis factor ß. J. Neuroimmunol. 61:205.[Medline]
in the pathogenesis of experimental allergic encephalomyelitis: comparison of autoantigen induced and transferred disease in Lewis rats. J. Autoimmun. 6:311.[Medline]
This article has been cited by other articles:
|
|
 |
|
  E. D. Ponomarev, K. Maresz, Y. Tan, and B. N. Dittel CNS-Derived Interleukin-4 Is Essential for the Regulation of Autoimmune Inflammation and Induces a State of Alternative Activation in Microglial Cells J. Neurosci., October 3, 2007; 27(40): 10714 - 10721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Fazilleau, C. Delarasse, I. Motta, S. Fillatreau, M.-L. Gougeon, P. Kourilsky, D. Pham-Dinh, and J. M. Kanellopoulos T Cell Repertoire Diversity Is Required for Relapses in Myelin Oligodendrocyte Glycoprotein-Induced Experimental Autoimmune Encephalomyelitis J. Immunol., April 15, 2007; 178(8): 4865 - 4875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Mann, K. Maresz, L. P. Shriver, Y. Tan, and B. N. Dittel B Cell Regulation of CD4+CD25+ T Regulatory Cells and IL-10 Via B7 is Essential for Recovery From Experimental Autoimmune Encephalomyelitis J. Immunol., March 15, 2007; 178(6): 3447 - 3456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Ponomarev, L. P. Shriver, K. Maresz, J. Pedras-Vasconcelos, D. Verthelyi, and B. N. Dittel GM-CSF Production by Autoreactive T Cells Is Required for the Activation of Microglial Cells and the Onset of Experimental Autoimmune Encephalomyelitis J. Immunol., January 1, 2007; 178(1): 39 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. P. Shriver and B. N. Dittel T-Cell-Mediated Disruption of the Neuronal Microtubule Network: Correlation with Early Reversible Axonal Dysfunction in Acute Experimental Autoimmune Encephalomyelitis Am. J. Pathol., September 1, 2006; 169(3): 999 - 1011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Aktas, T. Prozorovski, and F. Zipp Death Ligands and Autoimmune Demyelination Neuroscientist, August 1, 2006; 12(4): 305 - 316. [Abstract] [PDF]
|
|
|
|
 |
|
 X. W. Huang, J. Yang, A. F. Dragovic, H. Zhang, T. S. Lawrence, and M. Zhang Antisense oligonucleotide inhibition of tumor necrosis factor receptor 1 protects the liver from radiation-induced apoptosis. Clin. Cancer Res., May 1, 2006; 12(9): 2849 - 2855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-X. Zhang, S. Yu, D. Calida, Z. Zhao, B. Gran, M. Kamoun, and A. Rostami Loss of the Surface Antigen 3G11 Characterizes a Distinct Population of Anergic/Regulatory T Cells in Experimental Autoimmune Encephalomyelitis J. Immunol., March 15, 2006; 176(6): 3366 - 3373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Ponomarev, L. P. Shriver, and B. N. Dittel CD40 Expression by Microglial Cells Is Required for Their Completion of a Two-Step Activation Process during Central Nervous System Autoimmune Inflammation J. Immunol., February 1, 2006; 176(3): 1402 - 1410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Hovelmeyer, Z. Hao, K. Kranidioti, G. Kassiotis, T. Buch, F. Frommer, L. von Hoch, D. Kramer, L. Minichiello, G. Kollias, et al. Apoptosis of Oligodendrocytes via Fas and TNF-R1 Is a Key Event in the Induction of Experimental Autoimmune Encephalomyelitis J. Immunol., November 1, 2005; 175(9): 5875 - 5884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. R. Ryan, D. McCue, and S. M. Anderton Fas-mediated death and sensory adaptation limit the pathogenic potential of autoreactive T cells after strong antigenic stimulation J. Leukoc. Biol., July 1, 2005; 78(1): 43 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Ponomarev and B. N. Dittel {gamma}{delta} T Cells Regulate the Extent and Duration of Inflammation in the Central Nervous System by a Fas Ligand-Dependent Mechanism J. Immunol., April 15, 2005; 174(8): 4678 - 4687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Ponomarev, M. Novikova, M. Yassai, M. Szczepanik, J. Gorski, and B. N. Dittel {gamma}{delta} T Cell Regulation of IFN-{gamma} Production by Central Nervous System-Infiltrating Encephalitogenic T Cells: Correlation with Recovery from Experimental Autoimmune Encephalomyelitis J. Immunol., August 1, 2004; 173(3): 1587 - 1595. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Spach, L. B. Pedersen, F. E. Nashold, T. Kayo, B. S. Yandell, T. A. Prolla, and C. E. Hayes Gene expression analysis suggests that 1,25-dihydroxyvitamin D3 reverses experimental autoimmune encephalomyelitis by stimulating inflammatory cell apoptosis Physiol Genomics, July 8, 2004; 18(2): 141 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Mitsui, Y. Miyake, H. Kakeya, H. Osada, and T. Kataoka ECH, an Epoxycyclohexenone Derivative That Specifically Inhibits Fas Ligand-Dependent Apoptosis in CTL-Mediated Cytotoxicity J. Immunol., March 15, 2004; 172(6): 3428 - 3436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hayley, S. J. Crocker, P. D. Smith, T. Shree, V. Jackson-Lewis, S. Przedborski, M. Mount, R. Slack, H. Anisman, and D. S. Park Regulation of Dopaminergic Loss by Fas in a 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine Model of Parkinson's Disease J. Neurosci., February 25, 2004; 24(8): 2045 - 2053. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Djerbi, K.-B. Abdul-Majid, M. Abedi-Valugerdi, T. Olsson, R. A. Harris, and A. Grandien Expression of the Long Form of Human FLIP by Retroviral Gene Transfer of Hemopoietic Stem Cells Exacerbates Experimental Autoimmune Encephalomyelitis J. Immunol., February 15, 2003; 170(4): 2064 - 2073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bando, M. Hasegawa, Y. Tsuboi, Y. Miyake, M. Shiina, M. Ito, H. Handa, K. Nagai, and T. Kataoka The Mycotoxin Penicillic Acid Inhibits Fas Ligand-induced Apoptosis by Blocking Self-processing of Caspase-8 in Death-inducing Signaling Complex J. Biol. Chem., February 14, 2003; 278(8): 5786 - 5793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Zhu, L. Luo, Y. Chen, D. W. Paty, and M. S. Cynader Intrathecal Fas Ligand Infusion Strengthens Immunoprivilege of Central Nervous System and Suppresses Experimental Autoimmune Encephalomyelitis J. Immunol., August 1, 2002; 169(3): 1561 - 1569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chen, B. T. Huber, R. J. Grand, and W. Li Recombinant Adenovirus Coexpressing Covalent Peptide/MHC Class II Complex and B7-1: In Vitro and In Vivo Activation of Myelin Basic Protein-Specific T Cells J. Immunol., August 1, 2001; 167(3): 1297 - 1305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Choi, X. Xu, J.-W. Oh, S. J. Lee, G. Y. Gillespie, H. Park, H. Jo, and E. N. Benveniste Fas-induced Expression of Chemokines in Human Glioma Cells: Involvement of Extracellular Signal-regulated Kinase 1/2 and p38 Mitogen-activated Protein Kinase Cancer Res., April 1, 2001; 61(7): 3084 - 3091. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Tang, K. Chen, Y. Wei, G. C. Sharp, L. McKee, and H. Braley-Mullen Apoptosis of thyrocytes and effector cells during induction and resolution of granulomatous experimental autoimmune thyroiditis Int. Immunol., December 1, 2000; 12(12): 1629 - 1639. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Carrithers, I. Visintin, S. J. Kang, and C. A. Janeway Jr Differential adhesion molecule requirements for immune surveillance and inflammatory recruitment Brain, June 1, 2000; 123(6): 1092 - 1101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Lee, T. Zhou, C. Choi, Z. Wang, and E. N. Benveniste Differential Regulation and Function of Fas Expression on Glial Cells J. Immunol., February 1, 2000; 164(3): 1277 - 1285. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) mice were averaged. B,
Fifteen MBP-wt (•) and 13 MBP-lpr (
), and MBP-lpr (
) T cell
lines within the same culture are shown. Secretion of IFN-
) were averaged. The data in A are from one
representative experiment with five mice in each group.
B, The cumulative disease score was calculated by adding
the disease score from the day of onset to day 35. The values shown are
the mean ± SE of all mice in each group. The mean cumulative
disease score shown is the average of mice from three separate
experiments. The control transfer of MBP-wt T cells into B10.PL
recipients is shown with light diagonal stripes, B10.PL-gld mice
transferred with MBP-wt T cells are shown by dark diagonal stripes,
B10.PL mice transferred with MBP-gld T cells are shown by a stippled
bar, and B10.PL-gld mice transferred with MBP-gld T cells are shown by
a hatched bar. Groups contained three to five animals. The asterisk
above the bar indicates a statistically significant decrease
(p < 0.001) from the control group.