|
|
||||||||

*
Laboratory of Immunology, Istituto Dermopatico dellImmacolata, IRCCS, Rome, Italy; and
Institute of Molecular Genetics, Academy of Science of the Czech Republic, Prague, Czech Republic
| Abstract |
|---|
|
|
|---|
,
IL-12, and IL-10. CD43 ligation inhibited the endocytic activity of DC,
and enhanced the capacity of DC to stimulate T cell proliferation in
the primary allogeneic and autologous MLR assay. In addition,
anti-CD43-treated DC were less efficient at presenting native HIV-1
reverse transcriptase to a specific CD4+ T cell clone,
whereas presentation of the reverse transcriptase 5572 peptide to the
same clone was increased. Finally, MEM-59 or its F(ab')2
fragments elicited a rise in intracellular free calcium and tyrosine
phosphorylation of a 25-kDa protein in DC. The results thus indicate
that CD43 cross-linking with specific ligands induces activation and
functional maturation of DC. | Introduction |
|---|
|
|
|---|
B/TNF-related activation-induced cytokine (RANK/TRANCE) receptor
(2, 3, 4, 5). In addition, selected DC functions can be activated through
ligation of other membrane molecules, including MHC class II (6, 7),
FcR (8), and chemokine receptors (9). DC can be generated from peripheral blood or bone marrow progenitors. In particular, circulating CD14+ monocytes cultured in the presence of GM-CSF and IL-4 acquire many phenotypical and functional features of primary DC (10, 11). These monocyte-derived DC may have a normal counterpart in certain pathological states. For example, monocyte-derived DC are similar to a subset of DC that infiltrates lesional skin of atopic dermatitis patients (12), a condition in which resident skin cells or immigrating inflammatory cells have a propensity to produce higher levels of GM-CSF and IL-4 (13).
CD43 (leukosialin/sialophorin) is a membrane sialomucin expressed on the surface of most hemopoietic cells (14, 15). Because of its strongly negative charge and the long unfolded structure, this molecule is thought to limit cell interactions and reduce the chance of cell-cell adhesion (15, 16), and leukocytes lacking the CD43 gene or treated with anti-CD43 Ab display increased homotypic and heterotypic aggregation (17, 18, 19). Although a well-defined receptor for CD43 has not been characterized yet, CD43 triggering with specific mAbs can also mediate cytoplasmic signals leading to cell activation (17, 20, 21, 22) or apoptosis (23). We have previously reported that both epidermal Langerhans cells and monocyte-derived DC express high levels of membrane CD43, and that incubation of DC with anti-CD43 mAbs removes the molecule from the membrane, and strongly enhances the capacity of DC to cluster and activate T lymphocytes (24). In the present work, we show that cross-linking of CD43 on DC induces calcium mobilization and stimulates a higher expression of membrane molecules important for Ag presentation as well as synthesis of immunoregulatory cytokines. Moreover, CD43 ligation reduces DC endocytic capacity and increases their T cell stimulatory functions. Thus, CD43 can mediate activation signals in DC, leading to their functional maturation.
| Materials and Methods |
|---|
|
|
|---|
The anti-human CD43 mAb MEM-59 (IgG1) and its Fab and
F(ab')2 fragments were prepared as described previously
(25). FITC-conjugated anti-HLA-DR (L243, IgG2a), anti-CD3
(SK-7, IgG1), anti-CD14 (M
P9, IgG2b), anti-CD16 (GO22,
IgG1), anti-CD19 (4G7, IgG1), and FITC-conjugated anti-CD25
(2A3, IgG1) mAbs were obtained from Becton Dickinson (San Jose, CA);
FITC-conjugated anti-CD1a (BB5, IgG1), anti-CD40 (BB20, IgG1),
and anti-CD54 (15.2, IgG1) from Ylem (Avezzano, Italy); PE-labeled
anti-CD83 (HB15, IgG2b) and FITC-conjugated anti-CD80 (MAB104,
IgG1) from Immunotech (Marseilles, France); biotin-conjugated
anti-CD86 (IT2.2, IgG2b) was purchased from PharMingen (San Diego,
CA), and FITC-conjugated Streptavidin from Dako (Glostrup, Denmark).
Control mouse Ig were from Becton Dickinson.
DC and DC stimulation
DC were generated from peripheral blood monocytes of healthy individuals, following a defined protocol (10). Briefly, PBMC isolated by standard density gradient centrifugation were separated on multistep Percoll gradients (Pharmacia, Uppsala, Sweden), and cells from the light density fraction (42.550%; >90% CD14+) were recovered and cultured at 1 x 106 cells/ml in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS (Hyclone Laboratories, Logan, UT), 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 2 mM L-glutamine, 25 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin (all Life Technologies), and 0.05 mM 2-ME (Merck, Darmstadt, Germany) (complete medium) at 37°C with 5% CO2, in the presence of 200 ng/ml human rGM-CSF (Mielogen; Schering-Plough, Milan, Italy) and 200 U/ml human rIL-4 (Genzyme, Cambridge, MA). Medium was changed after 3 days, and at day 67 of culture, cells were recovered and depleted of CD2+ and CD19+ cells by means of immunomagnetic beads coated with specific mAbs (Dynabeads M450; Dynal, Oslo, Norway). This procedure resulted in >97% pure CD1a+ DC preparation. DC were incubated with MEM-59, or its monovalent or bivalent Fab fragments, in complete medium for 30 min on ice. After extensive washing, cells were cultured (1 x 106 cells/well) in six-well plates at 37°C. Anti-CD43 mAb and medium had undetectable endotoxin levels (less than 10 pg/mg) by Limulus amebocyte lysate assay (BioWhittaker, Walkersville, MD). Based on the results of preliminary dose-response experiments (Ref. 24; and data not shown), a fixed concentration (50 µg/ml) of anti-CD43 mAb was employed in most of the following experiments. As control, DC were incubated with an equal amount of mouse IgG1 or left untreated. LPS from Escherichia coli (055:B5; Sigma, St. Louis, MO) was used at 10 µg/ml. In some experiments, whole or F(ab')2 fragments of anti-CD43 were heat denatured (90°C in a 5 mM phosphate buffer at pH 6.0) prior to their use.
Flow cytometry analysis
After 24 h stimulation, cells were washed with PBS containing 2% FBS and 0.01% NaN3, and then stained with FITC-conjugated mAbs or biotin-conjugated mAb followed by FITC-conjugated Streptavidin. In control samples, the mAb was substituted with matched isotype control Ig. Cells (104 cells/sample) were analyzed in a FACScan equipped with Cell Quest software (Becton Dickinson, Mountain View, CA).
Cytokine release
DC treated as described above were cultured in 24-well plates
(1 x 106 cells/well) for 2448 h at 37°C, and then
supernatants collected and stored at -80°C. IL-1ß, TNF-
, IL-6,
IL-12 (p70), and IL-10 were measured by ELISA (R&D Systems,
Minneapolis, MN), according to the manufacturers instructions and
using an ELISA reader, model 3550 UV Bio-Rad (Hercules, CA).
RNA isolation and analysis
Total cellular RNA was extracted from overnight-stimulated DC
using the guanidinium thiocyanate-phenol-chloroform protocol (26). For
RT-PCR analysis, 1 µg of total RNA was reverse-transcribed with
oligo(dT) primers and then amplified using a Perkin-Elmer RNA PCR kit
(Roche Molecular Systems, Branchburg, NJ). The following synthetic
oligonucleotides (listed 5'-3') were used: IL-1ß,
ATGGCAGAAGTACCTAAGCTCGC and ACACAAATTGCATGGTGAAGTCAGTT (801-bp
amplificate); IL-6, AAATTCGGTACATCCTCGAC and CAGGAACTGGATCAGGACTT
(295-bp amplificate); IL-10, GAAGGATCAGCTGGACAACTTGTTG and
CTCATGGCTTTGTAGATGCCTTTCTC (306-bp amplificate); IL-12 p40
TCACAAAGGAGGCGAGGTTC and ATCAGAACCTAACTGCAGGG (378-bp amplificate);
and TNF-
, ATGAGCACTGAAAGCATGATCCGG and CTACAACATGGGCTACAGGCTTGT
(280-bp amplificate). As an internal control for the amount of RNA
used, the GAPDH housekeeping gene was employed with primers
TGAAGGTCGGAGTCAACGGATTTGGT and CATGTGGGCCATGAGGTCCACCAC (983-bp
amplificate). To verify the absence of genomic DNA contamination in the
RNA samples, in some PCR reactions reverse transcriptase was omitted.
For semiquantitative analysis, RNA concentrations, primers, and PCR
cycles were titrated to obtain standard curves to verify linearity, and
to permit analysis of signal strength. Films were subjected to
densitometry using an Imaging Densitometer model GS-670 (Bio-Rad,
Richmond, CA) supported by the Molecular Analyst image analysis
software. The densitometry units were calculated by dividing the values
of specific bands to the values of GAPDH bands, and then normalized to
the densitometry values obtained with DC incubated with medium
alone.
Quantitation of endocytosis
DC stimulated as reported above were cultured for 24 h, washed, resuspended in complete medium, and finally pulsed with Texas Red-conjugated BSA (Molecular Probes, Eugene, OR) at a concentration of 1 mg/ml. Thereafter cells were incubated at 37°C or 4°C, and at selected time points, uptake was stopped by adding cold PBS containing 2% FBS and 0.01% NaN3. Cells were then washed four times and analyzed in a FACScan. Surface-binding values obtained by incubating cells at 4°C were subtracted from values measured at 37°C.
Ag presentation assays
For the MLR assay, T lymphocytes were purified from the heavy density fraction (5060%) of Percoll gradients by two rounds of immunomagnetic depletion using a mixture of anti-MHC class II and anti-CD19 mAb-conjugated beads (Dynal). The purity of T cells was >95%, as assessed by flow cytometry using an anti-CD3 mAb. Twenty-four hours after stimulation, DC were washed and then cultured in 96-well microculture plates together with 2 x 105/well allogeneic or autologous T lymphocytes in complete medium containing 5% autologous plasma instead of 10% FBS. Cocultures were pulsed at day 5 with 1 µCi/well [3H]thymidine (Amersham, Little Chalfont, U.K.) for about 16 h at 37°C, and then harvested onto fiber-coated 96-well plates (Packard Instruments, Groningen, The Netherlands). Radioactivity was measured in a beta counter (Topcount, Packard Instruments). Results are given as mean cpm ± SD of triplicate cultures. For the Ag-specific presentation assay, CD4+ T cell clones specific for HIV-1IIIB reverse transcriptase (RT) were prepared by limiting dilution of a RT-specific CD4+ T cell line generated from a HIV-seronegative individual. Graded numbers of DC were cultured in triplicate with 5 x 104/well specific CD4+ T cells (clone AC22) in the presence of 5 µg/ml RT (Intracell, Cambridge, MA) or 5 µg/ml of the peptide RT 5572 (Chiron, San Diego, CA) with the amino acid sequence PYNTPVFAIKKKDSTKWR recognized by the same RT-specific T cell clone. Cocultures were pulsed with 1 µCi/well [3H]thymidine at day 2 or 3. Statistical analysis was performed using Students t test.
Measurement of cytosolic calcium
DC (510 x 106 cells/ml) were resuspended in Iscoves medium (Sigma) containing 1% FBS, and then incubated with 5 µM Fluo3-AM and 1 µM Pluronic F127 (Molecular Probes) for 35 min at 37°C. Cells were then washed twice and kept at 18°C during incubation (20 min) with MEM-59, its fragments, or control IgG1 (all at 50 µg/ml). Samples were then warmed at 37°C and analyzed on a FACScan. Calibration procedure to convert the mean of fluorescence into absolute [Ca2+]i was performed as described (27). In brief, the [Ca2+]i was calculated by using the following formula: [Ca2+]i = Kd x [F - Fmin]/[Fmax - F] where Kd of Fluo 3-AM was 400 nM, F was the sample mean fluorescence, and Fmax was obtained by exposing the cells at 5 µg/ml of ionomycin (Sigma). To obtain Fmin, ionomycin-treated cells were exposed to 2 mM manganese chloride.
Western blot analysis of tyrosine-phosphorylated proteins
DC (106 cells/sample) were treated with MEM-59 F(ab')2, MEM-59 Fab, mouse IgG1, LPS, or left untreated for 15 min at 37°C. Cells were then washed twice with cold PBS and lysed in the presence of protease inhibitors. Lysates were separated on 12% SDS-PAGE, and then transferred to nitrocellulose membranes (Hybond-C, Amersham). After blocking with 5% nonfat dry milk, proteins containing phosphotyrosine were identified using a mouse anti-phosphotyrosine mAb (P-TYR-01, IgG1) and visualized with a peroxidase-conjugated goat anti-mouse Ig Ab, followed by an enhanced chemiluminescence Western blot detection system (ECL, Amersham). Samples pretreated for 2 h with 0.17 µM herbimycin A (Calbiochem, San Diego, CA) served as control.
| Results |
|---|
|
|
|---|
Transitory treatment of DC with MEM-59 or its bivalent
F(ab')2 fragments determined, after 24 h, an increased
surface expression of HLA-DR, ICAM-1, CD80, and CD86, all molecules
actively involved in Ag presentation and T cell activation, as well as
of CD40, which is an important receptor for DC activation and survival
(1, 2). CD83, a specific marker of mature DC, and CD25 (not shown) were
also enhanced (Fig. 1
). Changes in
membrane molecule expression induced by anti-CD43 were similar to
those obtained with LPS, and were not promoted by control isotype IgG1,
monovalent Fab fragments or heat-denaturated bivalent Ab (not shown).
In contrast to the above-mentioned surface Ags, CD1a was slightly
down-regulated in anti-CD43 or LPS-treated DC. Semiquantitative
RT-PCR analysis showed that CD43 cross-linking induced after 16 h
a 2- to 3-fold increase in ICAM-1, CD80, and CD86 mRNA levels (not
shown), thus suggesting that the enhanced staining for membrane
molecules was due to increased synthesis and not to increased
detection.
|
|
are potent DC maturation
signals (1), and DC-derived IL-12 is crucial for driving Th1 responses.
After CD43 ligation, DC produced high amounts of IL-1ß, TNF-
,
IL-6, and IL-12 (Table I
|
|
Down-regulation of the ability to capture exogenous Ags is an
early event during DC maturation, and has been demonstrated for fluid
phase tracers and receptor-mediated endocytosis, as well as for the
uptake of particulates and bacteria (1). In keeping with these
observations, DC that have been treated with bivalent anti-CD43 or
LPS showed a strongly reduced uptake of a model protein Ag (BSA) (Fig. 4
). The APC functions of DC were
investigated in the primary allogeneic and autologous MLR, and in an
Ag-specific presentation assay. DC that were transiently incubated with
MEM-59 or its F(ab')2 fragments, but not DC treated with
mouse IgG1 or MEM-59 monovalent Fab fragment, exhibited a higher T
cell-activating capacity in the allogeneic MLR assay (Fig. 5
A). On a per cell basis,
anti-CD43 treatment induced a 2- to 3-fold increase in the T cell
response. This effect was dose dependent, being also evident at a
MEM-59 or MEM-59 F(ab')2 fragment concentration of 100
ng/ml (not shown). Anti-CD43-activated DC also significantly increased
their stimulatory capacity in the autologous MLR assay (Fig. 5
B). To exclude the possibility of a direct action of MEM-59
on T cells, allogeneic CD4+ T cells transiently treated
with anti-CD43 have been used as responders in the MLR assay
together with untreated DC. This procedure did not lead to enhanced T
cell proliferation (not shown). Moreover, DC stimulated with
anti-CD43 or LPS exhibited a substantial decrease in their ability
to present native protein Ags (HIV-1 RT) to a specific CD4+
T cell clone (Fig. 5
C), whereas the presentation of a RT
peptide (residues 5572) to the same T cell clone was augmented (Fig. 5
D).
|
|
To definitively demonstrate that CD43 triggering is associated
with cell activation, Ca2+ fluxes and protein tyrosine
phosphorylation were studied. Fig. 6
A shows the results of a
representative experiment in which DC were stimulated with
anti-CD43. A rapid increase in cytosolic Ca2+ was
observed upon incubation with bivalent anti-CD43, but not when
monovalent Fab fragments were used. Finally, CD43 cross-linking
consistently induced tyrosine phosphorylation of a 25-kDa protein (Fig. 6
B), which was completely prevented by preincubation with
the protein tyrosine kinase inhibitor, herbimycin A, and not observed
in LPS-treated DC (not shown). The nature of this 25-kDa protein is at
present unknown, and it may well deserve further studies.
|
| Discussion |
|---|
|
|
|---|
, and IL-6, CD43 cross-linking augmented
IL-12 production, although not to the levels reported after CD40
triggering, which probably represents the most potent stimulus for
induction of this cytokine in DC (7, 30, 31). Interestingly enough,
both CD43 cross-linking and LPS were also capable of inducing IL-10
production. IL-10 is a key regulator of DC functions as it maintains DC
in an immature state by enhancing mechanisms of Ag capturing,
inhibiting costimulatory molecule expression, as well as reducing IL-12
synthesis (1, 6, 7, 31). IL-10 production by DC can thus represent a
feedback regulatory mechanism that counteracts excessive DC activation
and, consequently, exaggerated DC-driven immune responses. The capacity
of CD43 cross-linking to activate DC is also supported by the
observation that it stimulated rapid induction of Ca2+
fluxes and tyrosine phosphorylation of a 25-kDa protein. Indeed, the
association of CD43 with the activity of protein tyrosine kinases has
been previously described in T cells, and is thought to be involved in
the signal propagation generated by CD43 (21, 22). CD43 belongs to a family of membrane mucins that bind to selectins and are implicated in cell activation, as well as in cell adhesion and migration (15, 32, 33, 34). CD43 is considered to function primarily as an anti-adhesion molecule, but its binding to specific ligands can mediate proadhesive activities (15). We previously showed that CD43 engagement induces removal of the molecule from the DC surface and increases formation of DC-T cell conjugates (24). Here, we found that bivalent anti-CD43 determines also DC homotypic aggregation. Although the physiological relevance of this phenomenon has not been investigated, it may be important in the context of DC-T cell interactions for augmenting the total DC surface available for T cells, and thus for the delivery of costimulatory signals from bystander DC. CD43 can increase cell-cell adhesion through different mechanisms (15). For example, CD43 regulates integrin-mediated signaling (35), and its cytoplasmic domain is associated with the actin-based cytoskeleton (36). Additionally, it has been reported that preincubation of T cells with anti-CD43 increases T cell adhesiveness to DC by transactivating CD2 binding to CD58 (36). Recent experiments demonstrated that, as a consequence of TCR triggering, CD43 is redistributed on the T cell membrane and uniquely excluded at the T cell-APC contact site (37). It is thus possible that CD43 actively participates in the T cell-APC dialogue in several ways. CD43 can, in fact, limit nonspecific T cell-APC interactions, but once it has been triggered by specific ligands or modulated via signals generated from the TCR-Ag-MHC engagement, it may move away from the T cell-DC contact zone on both the T cell and DC sides, and at the same time deliver activation signals to both the T cell and DC (24, 37). The natural ligands of CD43 have not yet been identified. However, both ICAM-1 and MHC class I molecules have been suggested to be directly involved in leukocyte aggregation induced by anti-CD43 Abs (38, 39), and galectin-1 has been indicated as a physiological ligand for CD43 in mediating binding of thymic epithelial cells to T cells (40). Our study suggests that ligation of CD43 with a specific mAb leads to DC maturation, as defined by phenotypical and functional criteria. In view of the present and previously published results (24), we thus postulate that CD43 has an important role in regulating both the maturation of DC and their adhesive interactions with T lymphocytes.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Giampiero Girolomoni, Laboratory of Immunology, Istituto Dermopatico dellImmacolata, IRCCS. Via Monti di Creta 104, 00167 Roma, Italy. E-mail address: ![]()
3 Abbreviations used in this paper: DC, dendritic cell; RT, HIV-1IIIB reverse transcriptase. ![]()
Received for publication November 9, 1998. Accepted for publication March 9, 1999.
| References |
|---|
|
|
|---|
RI. J. Immunol. 155:5184.[Abstract]
. J. Exp. Med. 179:1109.This article has been cited by other articles:
![]() |
J. A. Fulcher, M. H. Chang, S. Wang, T. Almazan, S. T. Hashimi, A. U. Eriksson, X. Wen, M. Pang, L. G. Baum, R. R. Singh, et al. Galectin-1 Co-clusters CD43/CD45 on Dendritic Cells and Induces Cell Activation and Migration through Syk and Protein Kinase C Signaling J. Biol. Chem., September 25, 2009; 284(39): 26860 - 26870. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. A. M. Santegoets, S. Gibbs, K. Kroeze, R. van de Ven, R. J. Scheper, C. A. Borrebaeck, T. D. de Gruijl, and M. Lindstedt Transcriptional profiling of human skin-resident Langerhans cells and CD1a+ dermal dendritic cells: differential activation states suggest distinct functions J. Leukoc. Biol., July 1, 2008; 84(1): 143 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Srivastava, Ch. Varalakshmi, and A. Khar Cross-linking a mAb to NKR-P2/NKG2D on dendritic cells induces their activation and maturation leading to enhanced anti-tumor immune response Int. Immunol., May 1, 2007; 19(5): 591 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Perone, A. T. Larregina, W. J. Shufesky, G. D. Papworth, M. L. G. Sullivan, A. F. Zahorchak, D. B. Stolz, L. G. Baum, S. C. Watkins, A. W. Thomson, et al. Transgenic galectin-1 induces maturation of dendritic cells that elicit contrasting responses in naive and activated T cells. J. Immunol., June 15, 2006; 176(12): 7207 - 7220. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. de la Rosa, M. Yanez-Mo, R. Samaneigo, D. Serrano-Gomez, L. Martinez-Munoz, E. Fernandez-Ruiz, N. Longo, F. Sanchez-Madrid, A. L. Corbi, and P. Sanchez-Mateos Regulated recruitment of DC-SIGN to cell-cell contact regions during zymosan-induced human dendritic cell aggregation J. Leukoc. Biol., May 1, 2005; 77(5): 699 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sunderkotter, T. Nikolic, M. J. Dillon, N. van Rooijen, M. Stehling, D. A. Drevets, and P. J. M. Leenen Subpopulations of Mouse Blood Monocytes Differ in Maturation Stage and Inflammatory Response J. Immunol., April 1, 2004; 172(7): 4410 - 4417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Cruz-Munoz, E. Salas-Vidal, N. Salaiza-Suazo, I. Becker, G. Pedraza-Alva, and Y. Rosenstein The CD43 Coreceptor Molecule Recruits the {zeta}-Chain as Part of Its Signaling Pathway J. Immunol., August 15, 2003; 171(4): 1901 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wykes, K. P. A. MacDonald, M. Tran, R. J. Quin, P. X. Xing, S. J. Gendler, D. N. J. Hart, and M. A. McGuckin MUC1 epithelial mucin (CD227) is expressed by activated dendritic cells J. Leukoc. Biol., October 1, 2002; 72(4): 692 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Todeschini, M. P. Nunes, R. S. Pires, M. F. Lopes, J. O. Previato, L. Mendonca-Previato, and G. A. DosReis Costimulation of Host T Lymphocytes by a Trypanosomal trans-Sialidase: Involvement of CD43 Signaling J. Immunol., May 15, 2002; 168(10): 5192 - 5198. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cermak, S. Simova, A. Pintzas, V. Horejsi, and L. Andera Molecular Mechanisms Involved in CD43-mediated Apoptosis of TF-1 Cells. ROLES OF TRANSCRIPTION, Daxx EXPRESSION, AND ADHESION MOLECULES J. Biol. Chem., March 1, 2002; 277(10): 7955 - 7961. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Libraty, S. Pichyangkul, C. Ajariyakhajorn, T. P. Endy, and F. A. Ennis Human Dendritic Cells Are Activated by Dengue Virus Infection: Enhancement by Gamma Interferon and Implications for Disease Pathogenesis J. Virol., April 15, 2001; 75(8): 3501 - 3508. [Abstract] [Full Text] |
||||
![]() |
F. G. A. Delemarre, P. G. Hoogeveen, M. de Haan-Meulman, P. J. Simons, and H. A. Drexhage Homotypic cluster formation of dendritic cells, a close correlate of their state of maturation. Defects in the biobreeding diabetes-prone rat J. Leukoc. Biol., March 1, 2001; 69(3): 373 - 380. [Abstract] [Full Text] |
||||
![]() |
P. Martin, G. M. del Hoyo, F. Anjuere, S. R. Ruiz, C. F. Arias, A. R. Marin, and C. Ardavin Concept of lymphoid versus myeloid dendritic cell lineages revisited: both CD8alpha - and CD8alpha + dendritic cells are generated from CD4low lymphoid-committed precursors Blood, October 1, 2000; 96(7): 2511 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang, Q. Chen, S. Stoll, X. Chen, O. M. Z. Howard, and J. J. Oppenheim Differential Regulation of Responsiveness to fMLP and C5a Upon Dendritic Cell Maturation: Correlation with Receptor Expression J. Immunol., September 1, 2000; 165(5): 2694 - 2702. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kodaira, S. K. Nair, L. E. Wrenshall, E. Gilboa, and J. L. Platt Phenotypic and Functional Maturation of Dendritic Cells Mediated by Heparan Sulfate J. Immunol., August 1, 2000; 165(3): 1599 - 1604. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. la Sala, S. Corinti, M. Federici, H. U. Saragovi, and G. Girolomoni Ligand activation of nerve growth factor receptor TrkA protects monocytes from apoptosis J. Leukoc. Biol., July 1, 2000; 68(1): 104 - 110. [Abstract] [Full Text] |
||||
![]() |
S. Corinti, D. Medaglini, A. Cavani, M. Rescigno, G. Pozzi, P. Ricciardi-Castagnoli, and G. Girolomoni Human Dendritic Cells Very Efficiently Present a Heterologous Antigen Expressed on the Surface of Recombinant Gram-Positive Bacteria to CD4+ T Lymphocytes J. Immunol., September 15, 1999; 163(6): 3029 - 3036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Santana, G. Pedraza-Alva, N. Olivares-Zavaleta, V. Madrid-Marina, V. Horejsi, S. J. Burakoff, and Y. Rosenstein CD43-mediated Signals Induce DNA Binding Activity of AP-1, NF-AT, and NFkappa B Transcription Factors in Human T Lymphocytes J. Biol. Chem., September 29, 2000; 275(40): 31460 - 31468. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pedraza-Alva, S. Sawasdikosol, Y. C. Liu, L. B. Merida, M. E. Cruz-Munoz, F. Oceguera-Yanez, S. J. Burakoff, and Y. Rosenstein Regulation of Cbl Molecular Interactions by the Co-receptor Molecule CD43 in Human T Cells J. Biol. Chem., January 5, 2001; 276(1): 729 - 737. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |