|
|
||||||||
CUTTING EDGE |
Institute of Immunology, University of Munich, Munich, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It has been demonstrated that the tyrosine kinase receptors trkA, trkB, and trkC mediate functions of several neurotrophin family members including nerve growth factor (NGF),3 brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and neurotrophin-4 (NT-4) (6, 7, 8). Furthermore, the presence of NGF receptor trkA on activated T cells (9) and basophils (10) and the contribution of NGF to inflammatory processes (11) have been proved.
With the exception of trkB expression during T cell development (12),
the information about the influence of the neurotrophins BDNF and NT-3
and their receptors on innate or acquired immunity is scarce. We
therefore investigated whether PBMC could receive neurotrophin messages
by expressing the specific receptors trkB and trkC and particularly
which immune cell subpopulations, cell lines, or T cell clones were
responsible for the receptor production. We were, furthermore, most
interested in whether cytokines or neurotrophins could regulate trkB or
trkC expression in bulk PBMC. This could indicate whether microbial
Ags, stimulating production of Th1 immune cytokines, e.g., IL-2 and
IFN-
, or Th2 immune cytokines (IL-4) could affect receptor
expression. Finally, we tested whether those cytokines could stimulate
immune cells to produce BDNF and NT-3 mRNA and thereby influence
neuronal adaptive responses.
| Materials and Methods |
|---|
|
|
|---|
Human PBMC were purified from whole blood by Ficoll gradient
(Amersham Pharmacia Biotech, Freiburg, Germany). Th cells were isolated
by using CD4 mAbs coupled to magnetic beads (Dynal, Hamburg, Germany).
T cells or PBMC were cultured at 12 x 106 cells/ml
either in the presence of 1% PHA (Difco, Hamburg, Germany), 20 µg of
anti-CD3 (OKT-3, Cilag, Sulzbach, Germany)-precoated plates in
combination with IL-2 (20 U/ml) or IL-4 (100 U/ml), or with 100 ng/ml
neurotrophins (Prepro, London, England), 20 U/ml IL-2 (Chiron,
Ratingen, Germany), 100 U/ml IL-4 (Genzyme, Ruesselsheim, Germany) or
500 U/ml IFN-
(Thomae, Bicherach an der Riss, Germany) alone. RPMI
1640 culture medium (Life Technologies, Eggenstein, Germany) was
supplemented with 10% FCS (Life Technologies).
Cloning of T lymphocytes
Alloprimed PBMC were seeded at 0.4 cell/well on allogeneic specific feeder layer. Clonality was confirmed by FACS analysis; T cell clones 234 and 305 and EM-17 were also recloned at a cell concentration of 0.1 cell/well. Constitutive expression in immune cell bulk cultures was assessed immediately after cell separation, in cloned T lymphocytes after 3 days without further addition of IL-2.
ELISA
For cytokine-ELISA assays, 2.5 x 105
CD4+ clone cells were cultured together with 2.5 x
105, 80-Gy-irradiated, specific stimulating EBV-transformed
lymphoblastoid B cell lines (B-LCL)3 in 2 ml of RPMI 1640
containing 10% FCS. Cell culture supernatants were collected after
24 h. IL-4 and IFN-
ELISA (PharMingen, Hamburg, Germany) was
performed according to the manufacturers protocols. For BDNF ELISA,
cells were irradiated with different doses (0, 5, 10, 20, 30, 40, 60
Gy) and cultured at a density of 5 x 105 per 2 ml of
RPMI 1640 containing 10% FCS. Cell culture supernatants were collected
after 1 and 3 days. BDNF ELISA kit was purchased from Promega
(Mannheim, Germany).
Reverse transcription and amplification of cDNA
Total RNA from cultured cells was prepared following RNAzol B (Biozol, Eching, Germany) protocol. After treating RNA with DNase I (Boehringer Mannheim, Mannheim, Germany) for 30 min of repeated precipitation, first-strand cDNA was synthesized from 7 µg of total RNA in a 50-µl final incubation volume by using RAV-2 reverse transcriptase (Pharmacia Amersham Biotech) and oligo(dT)1218 primer (Life Technologies). PCR was conducted in a 50-µl reaction mixture containing 3 µl of the above first-strand cDNA, 5 µl of 10x PCR buffer (Amersham Pharmacia Biotech), 3 µl of 10 mM dNTP mix, 2 µl of each primer (10 pmol/µl), 2 µl of standard primers (1 pmol/µl), and 2 U of Taq DNA polymerase (Amersham Pharmacia Biotech). The sequence of the primers (5'3') and length of the product were as follows. trkB gp145: upstream primer, CAACCCGCCCACGGAACTGA; downstream primer, CTCATGTGGGGCTCTCGCTG, 464 bp; trkB gp95: upstream primer, GTTTCATAAGATCCCACTGGATGG; downstream primer, TGCTGCTTAGCTGCCTGAGAGTTA, 260 bp; trkC: upstream primer, GGAGTCCAAGATCATCCATGTGGA; downstream primer, CATTCCAAATTTGGACCGTCGACC; 336, 363 bp; BDNF: upstream primer, TACTTTGGTTGCATGAAGGCTGCC; downstream primer, ACTTGACTACTGAGCATCACCCTG; 266 bp; NT-3: upstream primer, GTATCTCATGGAGGATTACGTGGG; downstream primer, TGTTCTCTGAAGTCAGTGCTCGGA; 343 bp; GAPDH: upstream primer, AATTCCATGGCACCGTCAAG; downstream primer, GCCTGCTTCACCACCTTCTT, 631 bp.
Conditions for the PCR were 94°C for 1 min, 65°C for 30 s, and 72°C for 30 s (35 cycles) using a PTC-200 Thermocycler (Biozym, Oldendorf, Germany).
Sequencing
DNA/cDNA sequencing was performed with an automated sequencer (ALF, Amersham Pharmacia Biotech) to confirm the identity of the PCR products trkB gp145, trkC, BDNF, and NT-3.
FACS analysis
Cells were incubated for 30 min with 2 µg/ml CD4-Tri-color-labeled Ab (Medac, Hamburg, Germany) in PBS containing 1% FCS and 0.1% sodium azide. After the cells were washed with PBS, they were fixed for 1 h in 4% paraformaldehyde, washed 4 times in PBS containing 0.1% saponin (Sigma, Deisenhofen, Germany), and incubated with 10 µg/ml anti-trkB gp95 (Santa Cruz, Ismaning, Germany) polyclonal rabbit Ab, or alternatively with 10 µg/ml rabbit IgG (Sigma) at 4°C for 30 min. After four washings with 0.1% saponin/PBS, the cells were incubated with 8.8 µg/ml fluorescein-conjugated goat anti-rabbit IgG (Dianova, Hamburg, Germany) for 30 min. All Abs were suspended in PBS with 0,1% saponin. After fixation with 1% paraformaldehyde, cells were analyzed in a flow cytometer (Becton Dickinson, Heidelberg, Germany).
| Results |
|---|
|
|
|---|
Our experiments with human bulk immune cells using
unstimulated and stimulated PBMC showed that unstimulated PBMC
expressed only the tyrosine kinase-lacking form (gp95) of the BDNF high
affinity receptor trkB. The full length (gp145) trkB receptor was not
expressed (not shown). FACS analysis for gp95 trkB revealed that 12%
of all unstimulated PBL were positive (Fig. 1
a). This gp95 trkB-stained
cell fraction was at the same time positive for CD4 (Fig. 1
a). To confirm the gp95 trkB expression in CD4+
Th cells, PBMC subpopulations were separated by using Abs against
cluster-defined molecules coupled to magnetic beads. The isolated
CD4-positive (+) Th cells, CD8+ cytotoxic cells,
CD14+ monocytes, and CD19+ B lymphocytes were
subsequently analyzed by RT-PCR, and the resulting PCR products were
sequenced. Among these unstimulated subpopulations, only
CD4+ T cells constitutively expressed gp95 trkB mRNA (Fig. 1
b). This picture changed dramatically when PBMC were
stimulated with PHA or anti-CD3 Abs; PBMC, even if depleted from
CD4+ T cells, expressed now the truncated trkB receptor
(Fig. 1
b). After activation with anti-CD3 or PHA,
separated CD8+, CD14+, as well as
CD19+ cells were able to produce the gp95 trkB mRNA (data
not shown).
|

+ T
cell clone EM-17 and in B-LCL (Fig. 2
|
Induction of the full-length trkB receptor in bulk cultures
required stimulation of immune cells with PHA or anti-CD3 Abs in
combination with IL-2. To investigate whether IL-2 alone, other
cytokines, or neurotrophins could regulate full-length trkB expression
in PBMC, immune cells were incubated with IL-2, IL-4, IFN-
, BDNF or
NT-4 for 1 day. Only IL-2, but not IL-4, IFN-
, BDNF, or NT-4, could
up-regulate the full-length trkB receptor in PBMC (Fig. 3
).
|
Following this observation, we examined whether gp145 trkB
receptor expression differed between Th1 and Th2 T cell clones.
Interestingly, only five of eight T cell clones showed constitutive
trkB gp145 mRNA expression. These five clones (200, 305, 407, 411, and
425) were identified as Th1 clones, producing very little or no IL-4
but high levels of IFN-
(Fig. 4
). The
remaining three trkB gp145-negative Th clones exhibited Th2-type (401)
or Th0-type (234, 403) cytokine profiles (Fig. 4
). The full-length trkB
receptor was furthermore expressed by the 
T cell clone EM-17 and
the B-LCL but not by the monocyte line MM1 (Fig. 2
b).
|
According to current documentation, the NT-3 receptor trkC is
found to be in almost all tissues of the body except in PBMC (14).
However, in our findings, trkC was discovered in immune cells. We
analyzed the presence of trkC by RT-PCR using a primer pair, with one
primer binding to the extracellular and the other to the intracellular
domain of trkC. On sequencing the PCR products, we detected both forms
of trkC that have been described within this region, one with an
additional insert of 24 amino acids (14). Neither form was detectable
in unstimulated PBMC, and addition of IL-2 or IL-4 alone had no effect
on trkC up-regulation (not shown). However, stimulation of PBMC with
PHA or with anti-CD3 Abs induced trkC mRNA levels (not shown).
Stimulation of the CD3 coreceptor up-regulated trkC expression in all T
cell clones tested (Fig. 2
c). Only two of the
CD4+ T cell clones, 407 and 411, showed constitutively weak
expression of trkC (Fig. 2
c). T cell clone 411 expressed the
trkC-splicing variant that lacks the 24-amino acid insert (Fig. 2
c). The 
+ T cell clone EM-17, B-LCLs, and
the monocyte line MM1 did not express trkC (Fig. 2
c).
BDNF and NT-3 production in immune cell subpopulations
We found NT-3 mRNA expression in PHA-stimulated and IL-4 treated
PBMC, but not in anti-CD3-stimulated, IL-2-treated, or unstimulated
immune cells (not shown). NT-3 mRNA expression was detectable neither
in T cell clones nor in the monocyte cell line MM1 (Fig. 2
d). As indicated by the NT-3 mRNA production in PBMC after
IL-4 treatment, NT-3 mRNA was expressed in B-LCL (Fig. 2
d).
From the strong expression of BDNF mRNA in immune cells, we hoped
to find sufficient BDNF concentrations in cell culture supernatants to
be recorded by ELISA. We had to consider, however, autocrine
consumption of BDNF by cells constitutively expressing truncated trkB,
e.g., CD4+ T cell clones and B-LCL. Production of cytokines
coupled with the prevention of autocrine consumption has been reported
by using low dose irradiation of immune cells (15). We therefore
irradiated immune cells at the beginning of various culture periods
using different irradiation doses (only 3-day culture period and 0 and
20 Gy shown (Fig. 5
)). In most T cell
clones, irradiation with 20 Gy did not change cell culture supernatant
BDNF levels (Fig. 5
), indicating that in these T cell clones BDNF was
probably not only produced for autocrine but also for paracrine
consumption. Conversely, BDNF was first detectable in B-LCL R.E. and in
T cell clone 411 following irradiation, indicating that autocrine
consumption of low BDNF concentrations was prevented by irradiation.
Similarly, higher concentrations of BDNF were detectable in 3-day cell
culture supernatants of MM1 cells after irradiation (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
Since immune cells could secrete BDNF or NT-3, they could possibly communicate back to neurons expressing trkB or trkC. Neurotrophin-secreting immune cells might show autocrine and paracrine effects in the local microenvironment in which there are produced; e.g., it has been observed that BDNF plays a role in the repair of peripheral nerve injury (18). Therefore, neurotrophin-secreting immune cells that can be recruited after nerve injury might effect nerve repair.
Furthermore, it has been demonstrated that environmental factors, such as microbial Ags, can dictate on one hand development and expansion of distinct T helper subsets and on the other hand induce secretion of distinct ILs (19) and influence adaptive neuronal responses (20, 21). Our finding that only Th1 but not Th0/Th2 clones constitutively expressed full-length trkB, and the divergent influence of the Th1 cytokine IL-2 and the Th2 cytokine IL-4 on neurotrophin and receptor expression, might be one possibility to explain this phenomenon.
In addition, we could show that expression of BDNF and NT-3 mRNA and of their receptors can be influenced by ILs: IL-2 stimulates production of trkB gp145 mRNA but not of trkC mRNA, whereas IL-4 stimulates expression of NT-3 mRNA but not of BDNF. Furthermore, it has been demonstrated that BDNF and NT-3 enhance the release of transmitters from neurons (22, 23) and that their influence on synaptic efficacy and neuronal plasticity affects behavior in rats (24, 25). This might shed new light on the importance of elevated IL-2 concentrations in cerebrospinal fluid of schizophrenic patients (26), the predictive value for relapses of such elevated IL-2 concentrations after neuroleptic treatment (27), and the increased IL-4 concentrations in pediatric neuropsychiatric cases (28). Symptoms of paranoia and dementia in AIDS could be influenced by the depletion of CD4 T lymphocytes, constitutively expressing the gp95 trkB receptor.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Rudolf Wank, Institute of Immunology, University of Munich, Goethestrasse 31, D-80336 Munich, Germany. E-mail address: ![]()
3 Abbreviations used in this paper: NGF, nerve growth factor; BDNF, brain-derived neurotrophic factor; B-LCL, EBV-transformed lymphoblastoid B cell line; NT-3 (-4), neurotrophin-3 (-4). ![]()
Received for publication November 30, 1998. Accepted for publication March 29, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A.-L. Fauchais, F. Lalloue, M.-C. Lise, A. Boumediene, J.-L. Preud'homme, E. Vidal, and M.-O. Jauberteau Role of Endogenous Brain-Derived Neurotrophic Factor and Sortilin in B Cell Survival J. Immunol., September 1, 2008; 181(5): 3027 - 3038. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jiang, G. Chen, Y. Zhang, L. Lu, S. Liu, and X. Cao Nerve Growth Factor Promotes TLR4 Signaling-Induced Maturation of Human Dendritic Cells In Vitro through Inducible p75NTR 1 J. Immunol., November 1, 2007; 179(9): 6297 - 6304. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hohlfeld, M. Kerschensteiner, and E. Meinl Dual role of inflammation in CNS disease Neurology, May 29, 2007; 68(22_suppl_3): S58 - S63. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sarchielli, M. Zaffaroni, A. Floridi, L. Greco, A. Candeliere, A. Mattioni, S. Tenaglia, M. Di Filippo, and P. Calabresi Production of brain-derived neurotrophic factor by mononuclear cells of patients with multiple sclerosis treated with glatiramer acetate, interferon-{beta} 1a, and high doses of immunoglobulins Multiple Sclerosis, April 1, 2007; 13(3): 313 - 331. [Abstract] [PDF] |
||||
![]() |
R. N. Pearse, S. L. Swendeman, Y. Li, D. Rafii, and B. L. Hempstead A neurotrophin axis in myeloma: TrkB and BDNF promote tumor-cell survival Blood, June 1, 2005; 105(11): 4429 - 4436. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bradl, J. Bauer, A. Flugel, H. Wekerle, and H. Lassmann Complementary Contribution of CD4 and CD8 T Lymphocytes to T-Cell Infiltration of the Intact and the Degenerative Spinal Cord Am. J. Pathol., May 1, 2005; 166(5): 1441 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cha-Molstad, D. M. Keller, G. S. Yochum, S. Impey, and R. H. Goodman Cell-type-specific binding of the transcription factor CREB to the cAMP-response element PNAS, September 14, 2004; 101(37): 13572 - 13577. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Benner, R. L. Mosley, C. J. Destache, T. B. Lewis, V. Jackson-Lewis, S. Gorantla, C. Nemachek, S. R. Green, S. Przedborski, and H. E. Gendelman Therapeutic immunization protects dopaminergic neurons in a mouse model of Parkinson's disease PNAS, June 22, 2004; 101(25): 9435 - 9440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Bradl and R Hohlfeld Molecular pathogenesis of neuroinflammation J. Neurol. Neurosurg. Psychiatry, October 1, 2003; 74(10): 1364 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reinshagen and M. Steinkamp NGF---not just a nerve growth factor in the gut Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2003; 284(5): R1322 - R1322. [Full Text] [PDF] |
||||
![]() |
Y. Ganor, M. Besser, N. Ben-Zakay, T. Unger, and M. Levite Human T Cells Express a Functional Ionotropic Glutamate Receptor GluR3, and Glutamate by Itself Triggers Integrin-Mediated Adhesion to Laminin and Fibronectin and Chemotactic Migration J. Immunol., April 15, 2003; 170(8): 4362 - 4372. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kappos and P. Duda The Janus face of CNS-directed autoimmune response: a therapeutic challenge Brain, November 1, 2002; 125(11): 2379 - 2380. [Full Text] [PDF] |
||||
![]() |
T. Ziemssen, T. Kumpfel, W. E. F. Klinkert, O. Neuhaus, and R. Hohlfeld Glatiramer acetate-specific T-helper 1- and 2-type cell lines produce BDNF: implications for multiple sclerosis therapy Brain, November 1, 2002; 125(11): 2381 - 2391. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Kohm and V. M. Sanders Norepinephrine and beta 2-Adrenergic Receptor Stimulation Regulate CD4+ T and B Lymphocyte Function in Vitro and in Vivo Pharmacol. Rev., December 1, 2001; 53(4): 487 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sirim, L. Zeitlmann, B. Kellersch, C. S. Falk, D. J. Schendel, and W. Kolanus Calcium Signaling through the beta 2-Cytoplasmic Domain of LFA-1 Requires Intracellular Elements of the T Cell Receptor Complex J. Biol. Chem., November 9, 2001; 276(46): 42945 - 42956. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Neuhaus, C. Farina, H. Wekerle, and R. Hohlfeld Mechanisms of action of glatiramer acetate in multiple sclerosis Neurology, March 27, 2001; 56(6): 702 - 708. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weber, K. S. C. Weber, C. Klier, S. Gu, R. Wank, R. Horuk, and P. J. Nelson Specialized roles of the chemokine receptors CCR1 and CCR5 in the recruitment of monocytes and TH1-like/CD45RO+ T cells Blood, February 15, 2001; 97(4): 1144 - 1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fisher, H. Levkovitch-Verbin, H. Schori, E. Yoles, O. Butovsky, J. F. Kaye, A. Ben-Nun, and M. Schwartz Vaccination for Neuroprotection in the Mouse Optic Nerve: Implications for Optic Neuropathies J. Neurosci., January 1, 2001; 21(1): 136 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hauben, O. Butovsky, U. Nevo, E. Yoles, G. Moalem, E. Agranov, F. Mor, R. Leibowitz-Amit, E. Pevsner, S. Akselrod, et al. Passive or Active Immunization with Myelin Basic Protein Promotes Recovery from Spinal Cord Contusion J. Neurosci., September 1, 2000; 20(17): 6421 - 6430. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hammarberg, O. Lidman, C. Lundberg, S. Y. Eltayeb, A. W. Gielen, S. Muhallab, A. Svenningsson, H. Linda, P. H. van der Meide, S. Cullheim, et al. Neuroprotection by Encephalomyelitis: Rescue of Mechanically Injured Neurons and Neurotrophin Production by CNS-Infiltrating T and Natural Killer Cells J. Neurosci., July 15, 2000; 20(14): 5283 - 5291. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Goebels, H. Hofstetter, S. Schmidt, C. Brunner, H. Wekerle, and R. Hohlfeld Repertoire dynamics of autoreactive T cells in multiple sclerosis patients and healthy subjects: Epitope spreading versus clonal persistence Brain, March 1, 2000; 123(3): 508 - 518. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |