|
|
||||||||

*
Howard Hughes Medical Research Institute, Cancer Research Laboratory, Department of Molecular and Cellular Biology, University of California, Berkeley, CA 94720; and
Central Division, Pfizer Inc., Groton, CT 06340
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The stage at which CTLA-4 exerts its inhibitory effects has not been clearly defined. CD28 is constitutively expressed on T cells, whereas CTLA-4 is expressed at low, undetectable levels on naive T cells and is induced upon T cell activation (7, 8, 29, 30, 31, 32, 33). The fact that CTLA-4 is not readily detectable on resting cells and is not expressed at maximal amounts on the cell surface until about 48 h after T cell activation has led to the notion that its function is to regulate ongoing T cell responses (34). However, CTLA-4 mRNA is already detectable within 1 h after activation in previously activated human T cells (30) and is detectable by PCR in samples prepared from purified naive murine CD4+ T cells (M.C.B. and J.P.A., unpublished observations). Also, CTLA-4 has a unique intracellular localization, with the majority of the CTLA-4 protein being retained inside the activated T cells (3, 4, 33). These observations suggest that CTLA-4 is present at physiologically significant levels and may regulate T cell responses much earlier than indicated by cell surface expression.
Although it was initially reported that CTLA-4 cross-linking induced
apoptosis (35), other studies showed that CTLA-4 engagement during T
cell activation prevents progression through the cell cycle without
causing apoptosis (16, 17). Rather, it appears that CTLA-4 engagement
inhibits early T cell activation events, including the induction of
IL-2R
-chain and CD69 expression, the increase in T cell volume, and
the production of IL-2 (16, 17, 18). The mechanisms involved in the
inhibition of these responses are unknown. Optimal IL-2 secretion
requires CD28-mediated costimulation (reviewed in 36). Two
mechanisms have been reported to account for the enhanced IL-2 mRNA
accumulation upon costimulation: prolongation of the IL-2 mRNA
half-life (37, 38) and transcriptional activation of the IL-2 gene
(39), perhaps as a result of increased levels of the transcription
factors NF-AT and AP-1 in the nucleus (40). Cell cycle progression is
regulated by a series of cyclins, cyclin kinases, and inhibitors
(reviewed in 41). In T cells, the G0/G1 to
S transition is mediated early in G1, mostly through a
combination of cyclin D2/D3 with cyclin-dependent kinase
(cdk)4 4/cdk6 and cyclin E/cdk2
in late G1 (see Refs. 56, 57, 6264). How CTLA-4
cross-linking affects these pathways at the molecular levels is not
known.
In this study, we examine the mechanisms involved in CTLA-4-mediated inhibition of T cell activation. Using Ab-coated microspheres, we demonstrate that CTLA-4 cross-linking inhibits anti-CD3/CD28 Ab-induced IL-2 mRNA accumulation. CTLA-4 engagement inhibits luciferase production by CD4+ T cells from mice bearing a luciferase reporter gene under the control of the IL-2 promoter, indicating that IL-2 gene transcription is inhibited. This effect appears to be at least partially due to the inhibition of NF-AT nuclear translocation. Conversely, the CD28-mediated IL-2 mRNA stabilization does not appear to be affected by CTLA-4 cross-linking. CTLA-4 engagement also prevents progression through the cell cycle, by inhibiting the production of the cell cycle proteins cyclin D3 and cdk4, which are partially IL-2-dependent, and cdk6, which is IL-2-independent, and altering the degradation of the cell cycle inhibitor p27. Interestingly, CTLA-4-mediated effects on cell cycle proteins were observed when the cells were stimulated via CD3 alone, suggesting CTLA-4 can inhibit CD28-independent pathways in T cell activation.
| Materials and Methods |
|---|
|
|
|---|
BALB/c mice were purchased from The Jackson Laboratory (Bar
Harbor, ME). The IL-2P-luc transgene was generated by inserting a
2160-bp genomic fragment from the human growth hormone gene (42) into
pBluescript SK(-) (Stratagene, La Jolla, CA), and the firefly
luciferase gene was cloned upstream of the hgh gene to yield
vector pSKluxhgh. The promoter region of the murine IL-2 gene
(positions -590 bp to +40 bp) (43) was PCR-amplified from murine
genomic DNA (Clontech, Palo Alto, CA) and inserted upstream of the
luciferase gene. The mouse
globulin gene matrix association region
(positions 28493764; kindly provided by William Garrard, University
of Texas Southwestern, Dallas, TX (44)) was inserted upstream of the
IL-2 promoter to ensure stable integration into the genomic DNA. The
transgene was excised from the final vector, purified, and injected
into embryos by standard techniques. Transgene incorporation was
assessed by Southern blot analysis. To test for appropriate transgene
expression, splenocytes from the transgenic mice were stimulated with
PMA (20 ng/ml) and ionomycin (2 µM; both from Sigma, St. Louis, MO)
or anti-CD3 Ab (100 ng/ml; Cappel, Durham, NC) plus PMA. The cells
were isolated at various time points after activation and tested for
luciferase expression. In all experiments, the transgene responded to
the stimuli similarly to the endogenous IL-2 gene (data not shown).
Mice were maintained in accordance with the Animal Care and Use
regulations of the University of California (Berkeley, CA).
Abs and reagents
RPMI 1640 (BioWhittaker, Walkersville, MD) was supplemented with 10% calf serum (HyClone, Logan, UT), 2 µM 2-ME (Sigma), 2 µM L-glutamine, and 100 U/ml antibiotics (Life Technologies, Gaithersburg, MD).
The Abs used for activation were: anti-CD3 (hybridoma 500A2 (45)),
anti-CD28 (hybridoma 37.N.51.1 (46)), anti-CTLA-4 (hybridoma
9H10.11G3 (8)), and aV
3 (hybridoma 536 (47)). Anti-class II MHC
(hybridomas 28-16-8s (48)) and BP107 (49)), and anti-CD8 (50), and
complement (Sigma) were used for CD4+ T cell purification.
Anti-CD4-613 (Life Technologies), anti-CD8-FITC, CD44-PE,
B220-FITC, anti-TCR
ß (H57)-FITC (all from PharMingen, San
Diego, CA) were used for flow cytometry. Anti-IL-2 and
anti-IL-2-biotin Abs (PharMingen) were used for the ELISA. Sulfate
polystyrene latex microspheres of 5 µm ± 0.1 µm mean
diameters were obtained from Interfacial Dynamics (Portland, OR).
Cyclosporin A (CsA) was a gift from Sandoz (East Hanover, NJ).
RNA preparation and quantitative RT-PCR
RNA samples were obtained from single-cell suspensions of CD4+ T cells (1 x 106 cells/sample) using guanidinium isothiocyanate by standard techniques. A total of 14 µg of RNA was reverse-transcribed using Superscript II Reverse Transcriptase (Life Technologies/BRL) and oligo(dT) primer (Boehringer Mannheim, Indianapolis, IN). The cDNA equivalent of 5 ng RNA was amplified containing 250 mM each of dNTP (dATP, dCTP, dGTP, dTTP), 200 nM specific oligo primers (Cancer Research Lab, University of California Berkeley) and 1 U Taq Polymerase (AmpliTaq; Perkin-Elmer/Cetus, Norwalk, CT) for 35 cycles: 1 min at 95°C, 2 min at 60°C, and 2 min at 72°C. PCR products were run on a 1.2% agarose gel by electrophoresis. Amplification products were analyzed for specificity by restriction analysis with two enzymes indicative of the expected amplified sequence. The primer sequences specific for ß-actin and IL-2 were used as described (51). The DNA competitor fragments were obtained from the plasmid pMCQ, kindly provided by Dr. T. Blankenstein (Max-Delbrück Center for Molecular Medicine, Berlin, Germany) (52). Each cDNA aliquot was adjusted to contain an equal amount of ß-actin (5 x 106 molecules) based on a comparison to the competitor DNA. Amplification with IL-2-specific primers was performed in the presence of serial dilutions (1:2) of competitor fragments, to estimate the amount required to achieve equal band intensities for both fragments (52, 53). For mRNA stabilization experiments, the cDNA was normalized by calculation to the same amounts of ß-actin (5 x 106 molecules), and values were plotted as log10 molecules of competitor fragment.
Preparation of CD4+ T lymphocytes
Single cell suspensions were prepared from the lymph node cells. CD4+ T cells were isolated by treatment with complement, anti-MHC class II Abs, and anti-CD8 Abs, as described (17). Typically, the cell preparations were >96% CD4+ cells. In some experiments, CD4+ T cells were isolated by cell sorting from CD4+ cells enriched spleen and lymph node cells using an ELITE (Coulter Electronics, Hialeah, FL). The recovered cell population was >99% CD4+ T cells.
Activation of CD4+ T cells
Latex microspheres were coated as described (17). Briefly,
1 x 107 beads/ml were suspended in PBS with the
indicated Abs and incubated for 1.5 h at 37°C, followed by
washing with PBS and blocking with 10% FCS. Anti-CD3 (1 µg/ml),
anti-CD28 (1.2 µg/ml), and anti-CTLA-4 (2 µg/ml) were added
and control hamster anti-V
3 (536) Ab was added to maintain a
constant total Ab concentration of 5 µg/ml. T cells (1 x
105) were incubated in a ratio of 1:1 with beads in 96-well
plates. Cultures were incubated for indicated lengths of time and
pulsed with [3H]thymidine (1 µCi) 12 h before
harvesting. Plates were harvested to glass filter mats and
3H incorporation was measured using a gas-phase counter
(Packard, Meriden, CT). For all of the experiments that required the
cells to be collected at early time points of T cell activation,
proliferation assays were performed in duplicate to ensure that beads
performed appropriately. Ab-coated beads were also tested using
CD4+ CTLA-4-/- T cells (25), and the presence
of anti-CTLA-4 Ab did not alter the proliferative response to
CD3/28 cross-linking in these experiments.
Luciferase assay
Luciferase assays were performed according to the luminometer manufacturers instructions, as described (Luciferase Assay Guide Book, Analytical Luminescence Laboratory, 1992; 54). Cell extracts were prepared by lysing the cell pellets (3 x 106 cell/sample) in lysis buffer and, after 15 min at room temperature, were centrifuged for 5 min at 1000 x g to remove cell debris. The samples were divided into three 100-µl aliquots to which 0.2 mM enzyme coenzyme A, 300 µl luciferase assay buffer, and 100 µl 1 mM luciferin substrate were added. The luciferase activity was assayed using the Dynatech (Chantilly, VA) luminometer on integrated flash mode. Values presented are relative light units gained by integrating over 20-s minus light units of wells with buffer plus luciferin alone.
Measurement of lymphokine production
IL-2 in cell supernatants was detected by ELISA, as described (17). The standard curve was generated using rIL-2 (Boehringer Mannheim), and the level of detection was 2 ng/ml.
Western blot analysis
CD4+ primary T lymphocytes cells were pelleted and lysed in Triton buffer (150 mM NaCl, 10 mM Tris (pH 8.0), 1% Triton X-100, and 1 mM PMSF) for 10 min on ice. The lysates were spun down at 4°C for 5 min. The resulting supernatants were harvested, and protein concentration was determined by the Bradford assay (Bio-Rad, Richmond, CA). Forty micrograms of each sample was loaded onto a 12% SDS-polyacrylamide gel and resolved electrophoretically. The gel was then transferred to nitrocellulose membrane and stained with Ponseau S to ensure equivalent loading and transfer. Western blot analysis was performed using 1 µg/ml of anti-cdk4, anti-cdk6, anti-cyclin D3, anti-p27 Abs (all from Santa Cruz Biotechnology, Santa Cruz, CA), or 1 µg of a polyclonal rabbit anti-p19 Ab (55). The bound Ab was detected by the appropriate HRP-conjugated secondary Ab. Blots were developed with the Renaissance Chemiluminescence Reagent (Dupont NEN, Wilmington, DE).
Gel mobility shift assays
Nuclear extracts of CD4+ T cells were prepared as reported (54). Based on the kinetics of cyclin D3 expression reported using human T cells (56, 57), the extracts were prepared 22 h after activation. The oligonucleotides for NF-AT (GTTGCCCAAAGAGGAAAATTTGTTTCATACAG) and AP-1 (CGCTTGATGACTCAGCCGGAA) were synthesized in the Microchemical Facility of the Cancer Research Laboratory (University of California). Binding reactions of the 32P-labeled probe (Amersham, Arlington Heights, IL) with 4 µg of nuclear extracts were performed at room temperature for 20 min. Binding of the radioactive probe was completely blocked by the addition of 20-fold excess nonradiolabeled probe, whereas addition of a sequence from an irrelevant site (NBRE) did not alter the binding of the radioactive probes. Bound and unbound probes were resolved electrophoretically on a 4% native polyacrylamide gel. For NF-AT binding, the reaction mix contained 10 mM HEPES (pH 7.4), 100 mM NaCl, 1 mM DTT, and 10% glycerol. For AP-1 binding, reaction mix contains 10 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM DTT, 100 mM KCl, and 10% glycerol.
| Results |
|---|
|
|
|---|
CD4+ lymph node T cells (LNT) were stimulated with
Ab-coated beads, and proliferation assays were performed as previously
described (8, 17). As reported (17), CD4+ LNT proliferation
and IL-2 secretion to submitogenic doses of anti-CD3 was augmented
by CD28-mediated costimulation, and this response was inhibited by
cross-linking CTLA-4 (data not shown). To detect early effects of
CTLA-4 engagement on IL-2 transcription, IL-2 mRNA levels in
CD4+ LNT cells stimulated under these conditions were
assessed by competitive PCR. Competitor DNA fragments are included in
the samples, and the same primers amplify both fragments, thus the
amount of cDNA/sample can be quantitated by comparison to known amounts
of the competitor fragment over a series of dilutions (52, 53). The
product from the competitor fragment can be distinguished from the
endogenous IL-2 mRNA by gel electrophoresis (Fig. 1
) and by digestion with unique
restriction enzymes. In the first step, the cDNA concentrations are
normalized using ß-actin as a standard. The cDNA concentration that
was required to achieve equal band intensities for both the cDNA and
the competitor fragments was determined by coamplifying serial
dilutions of the competitor fragment and constant amounts of cDNA, thus
ensuring that equal amounts of cDNA were compared in subsequent
experiments. In the second step, the calibrated cDNAs were used for
IL-2 cDNA amplification in the presence of serial dilutions of
competitor fragments containing IL-2 primers-specific sequences (Fig. 1
A).
|
CTLA-4 cross-linking does not appear to interfere with the stabilization of IL-2 mRNA by CD28
One effect of CD28 costimulation is to stabilize the mRNA of a
number of cytokine genes, including IL-2, all of which have an AU-rich
sequence in the 3' noncoding region (37, 38). Therefore, we sought to
determine whether the inhibitory effect of CTLA-4 ligation on IL-2 mRNA
accumulation was a result of mRNA destabilization (Fig. 2
). To do this, CsA was added to the
cultures 4 h after T cell stimulation with Ab-coated beads, and
competitive RT-PCR was used to follow the IL-2 mRNA levels. As shown in
Fig. 2
, only minimal amounts of IL-2 mRNA were produced in
anti-CD3-stimulated cells, and levels began to decrease rapidly 70
min after CsA addition. These results are comparable to that reported
for a Th1 clone stimulated with plate-bound anti-CD3 (38). In
cultures activated with anti-CD3 and anti-CD28, there was a
500-fold increase in the absolute amount of IL-2 mRNA, and only a minor
decay of IL-2 mRNA was detected following the addition of CsA. When T
cells were stimulated with anti-CTLA-4 in conjunction with
anti-CD3/28, the absolute amount of IL-2 mRNA was <1/50th of that
observed with CD3 plus CD28 cross-linking alone (Fig. 2
). However, the
slope of the curves of the IL-2 mRNA levels appears similar, suggesting
that the rates of decay are unchanged. Thus, CTLA-4 engagement does not
appear to accelerate the decay of IL-2 mRNA and does not appear to
reverse the stabilization mediated by CD28 cross-linking.
|
To examine the effects of CTLA-4 ligation on the IL-2 promoter, we used a transgenic mouse bearing a luciferase reporter gene under the transcriptional regulation of the IL-2 promoter and enhancer (IL-2P-luc). The transgene behaved similarly to the endogenous IL-2 gene, as determined by examining the effects of PMA/ionomycin and anti-CD3/PMA on luciferase activity in CD4+ T cells from these mice. These stimuli led to the rapid induction of luciferase activity, and the effect was inhibited by CsA (data not shown). Proliferation and IL-2 production by CD4+ T cells from IL-2P-luc transgenic mice and control mice were similar (data not shown), indicating that the transgenic T cells behaved normally in response to polyclonal stimulation.
CD4+ lymph node T cells from IL-2P-luc mice were stimulated
with the various combinations of anti-CD3-, anti-CD28-, and
anti-CTLA-4-coated beads, and luciferase activity was assayed after
4.5 h. As shown in Fig. 3
, minimal
luciferase activity was induced by stimulation with anti-CD3 only,
but this was enhanced >60-fold by CD28 costimulation, consistent with
the data obtained by competitive PCR. As with endogenous IL-2
expression (data not shown), the induction of luciferase activity by
anti-CD3 plus anti-CD28 was largely inhibited by CsA (Fig. 3
).
Cross-linking CTLA-4 during stimulation resulted in an almost complete
(90%) inhibition of luciferase production by the T cells. These
results indicate that CTLA-4 inhibits IL-2 production by altering the
transcriptional regulation of the IL-2 promoter and that this occurs
very early after T cell activation.
|
Five NF-AT sites have been reported to be essential for full
induction of the IL-2 promoter (reviewed in 58), four of which
bind AP-1 in association with NF-AT. Upon activation, NF-AT and AP-1
translocate from the cytoplasm to the nucleus. Gel shift assays were
performed to assess the affects of CTLA-4 engagement on the nuclear
accumulation of NF-AT and AP-1. As shown in Fig. 4
A, stimulation with
anti-CD3 alone increased the accumulation of NF-AT in the nucleus
over the basal levels, which was further augmented upon coligation of
CD28. This increase paralled enhancement of IL-2 mRNA transcription
initiation (Fig. 3
), IL-2 mRNA accumulation (Fig. 1
), and ultimately,
IL-2 production (data not shown, and 17). Coligation of CTLA-4 in
conjunction with anti-CD3/28 inhibited NF-AT translocation to
levels similar to those observed when T cells were stimulated with
anti-CD3 alone (Fig. 4
A). The induction of NF-AT was
CsA-sensitive, regardless of the stimulation conditions (Fig. 4
A). Since only the translocation of the factor to the
nucleus is shown to be CsA-sensitive (59), only NF-AT that had
translocated from the cytoplasm to the nuclear extracts was measured.
In contrast, no obvious changes in the AP-1 translocation to the
nuclear fraction upon CTLA-4 engagement could be detected in these
assays (Fig. 4
B). Levels of the Sp1 family binding to the
GT-box element of the IL-2 promoter were also unaltered under all
culture conditions (data not shown).
|
Entry into the S phase of the cell cycle is regulated by complex
interactions between cyclin/cdks and cell cycle inhibitors (reviewed in
41). Initial activation of cyclin D2/3 complexed to cdk4/6,
followed by the induction of cyclin E/cdk2 activity are required for
the entry into S phase. The p16 family of the cell cycle inhibitors
(p16, p15, p18, and p19) can regulate the activity of cyclin D/cdk4/6,
while p27 inhibits the kinase activity of cyclin E/cdk2. Stimulation of
resting T cells through the TCR complex results in transcriptional
activation of cyclin D2, D3, cdk4, and cdk6, as well as degradation of
p27 (60, 61). Induction of cdk6, cdk4, and cyclins in normal T cells is
partially dependent on IL-2 (56, 62, 63). In contrast, degradation of
p27 is completely dependent on IL-2 (60, 61). To examine the effects of
CTLA-4 cross-linking on these proteins, the induction of these
regulatory elements was examined in CD4+ LNT cells 22
h after stimulation under various conditions. As previously reported
with human T cells (56, 57, 64), CD3 engagement alone leads to cyclin
D3, cdk4, and cdk6 protein expression, which are barely detectable in
resting T cells (Fig. 5
). CD28
cross-linking in the presence of anti-CD3 further up-regulates
expression of these G1 kinases (Fig. 5
). Interestingly,
engagement of CTLA-4 dramatically inhibited the induction of these
kinase components when cross-linked in conjunction with CD3/CD28- and
by CD3-ligation (Fig. 5
). Degradation of the inhibitor p27 also occurs
during the transition from G1 to S phase of the cell cycle
upon T cell activation (60). p27 degradation initiated by anti-CD3
stimulation is inhibited by CTLA-4 cross-linking (Fig. 5
). CTLA-4
engagement in conjunction with anti-CD3 plus anti-CD28, did not
prevent the degradation of inhibitor p27 induced by anti-CD3 plus
anti-CD28 (Fig. 5
). Since p27 degradation is IL-2-dependent (60),
this is most likely due to the remaining amounts of IL-2 produced in
these cultures that leads to its degradation. Expression of p19, a p16
family member (55), was not affected by any of the stimulation
conditions tested (Fig. 5
).
|
10 U/ml IL-2. However, the
addition of IL-2 (1080 U/ml) did not reverse the inhibition of
proliferation by CTLA-4. Indeed, despite the presence of excess IL-2,
CTLA-4 engagement resulted in 5080% inhibition of proliferation.
|
| Discussion |
|---|
|
|
|---|
Our results clearly demonstrate that CTLA-4 inhibits the anti-CD3/CD28-stimulated accumulation of IL-2 mRNA by freshly isolated murine CD4+ T cells. Further, this inhibition is due to a block in IL-2 gene transcription and may be a consequence of inhibition of the activation and nuclear translocation of the transcription factor NF-AT. An important consequence of CD28-mediated costimulation is stabilization of mRNA of IL-2 and several other cytokines (38). Our results suggest that CTLA-4 ligation does not lead to IL-2 mRNA destabilization. This finding is consistent with the observation that CTLA-4 does not reverse CD28-mediated induction of Bcl-xL (18). These results strongly suggest that CTLA-4 does not merely counteract the costimulatory effects of CD28, but may act at different or additional points in T cell activation. The notion that CTLA-4 and CD28 costimulation may have independent effects is further supported by recent reports demonstrating that CTLA-4 can function in the absence of CD28 (21, 22).
Since CTLA-4 ligation can result in a very early inhibition of
production of IL-2, this might suggest that the inhibition of T cell
proliferation by CTLA-4 ligation might be attributed entirely to a lack
of this essential growth factor (65). However, our observation that the
addition of excess exogenous IL-2 failed to completely restore
proliferation suggested that CTLA-4 might be inhibiting T cell
proliferation independent of IL-2-mediated effects (Fig. 6
, and 8). Indeed, we found that CTLA-4 ligation inhibits the production of
components of the cell cycle machinery necessary for progression
through the G0/G1 check point. This result
indicates that CTLA-4 can inhibit T cell proliferation at two stages,
production of an essential growth factor and induction of critical
components of the cell cycle machinery. It is of interest that CTLA-4
does not appear to interfere with the ability of scant amount of IL-2
produced upon cross-linking of CD3/CD28/CTLA-4 to support the
degradation of the cell cycle inhibitor p27 (Fig. 5
).
Our results were obtained by cross-linking CD3, CD28, and CTLA-4 using Ab-coated microspheres. Although the results clearly demonstrate an inhibitory role for CTLA-4, it will be important to examine the role of CTLA-4 in regulating T cell responses using physiological ligands. Recently, it has been reported that lymphocytic choriomeningitis virus-specific and 2C TCR transgene-expressing naive CD8+ T cells from CTLA-4-/- and littermate control mice generated similar peptide-specific proliferative responses in vitro (66, 67). However, upon restimulation of the 2C TCR+ CD8+ T cells, the CTLA-4-deficient cells generated a dramatically greater proliferative response compared with the CTLA-4 wild-type T cells (67). In contrast, the proliferative response, IL-2 secretion, and the up-regulation of CD69 and CD25 by naive 2C TCR+ T cells stimulated by anti-CD3 and B7-transfected chinese hamster ovary cells were inhibited by CTLA-4 cross-linking (7, 68). These seemingly disparate results suggest that the role of CTLA-4 in regulating T cell activation may depend on the availability of B7 ligands, strength of the TCR signal, and the activational history of the T cells.
Thus, CTLA-4 can exert its inhibitory effects at multiple points in T cell activation, including induction of transcription of an essential growth factor gene and interference with the production of critical components required for cell cycle progression. The mechanism appears to be more complex than mere reversal of CD28-mediated costimulation. The cyclin-dependent kinases cdk4 and cdk6 are induced by anti-CD3 alone, but can be further augmented upon CD28 costimulation (56, 57, 62, 63, 64). CTLA-4 engagement can completely block anti-CD3-mediated induction. Finally, CTLA-4 ligation inhibits the induction of cyclin D3, which appears to be independent of CD28 costimulation.
It is clear that CD28 and CTLA-4 can influence the TCR/CD3-mediated signal. The molecular stage at which this occurs is unclear. There are several possibilities. It has been proposed that CD28 mediates a separate and parallel pathway that augments IL-2 transcription and T cell responses (69). Another possibility is that CD28 and TCR/CD3 signaling intersect distally at Jnk, thereby augmenting IL-2 transcription (70). However, recently it has been shown that CD28/B7 interaction augments tyrosine phosphorylation levels of ZAP-70, vav, and cbl proteins, indicating that CD28 signaling affects the CD3 signaling pathway directly (Ref. (71), and Y. Zhang and J.P.A., unpublished observations). Regardless of the mechanism, the results presented here support the notion that signals mediated by the TCR, CD28, and CTLA-4 are not discrete, but interact in a complex and dynamic way to influence the outcome of T cell stimulation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Deutsches Rheuma-Forschungszentrum Berlin, Hannoversche Str. 27, 10115 Berlin, Germany ![]()
3 Address correspondence and reprint requests to Dr. James P. Allison, 447 LSA, University of California, Berkeley, CA 94720. E-mail address: ![]()
4 Abbreviations used in this paper: cdk, cyclin-dependent kinase; CsA, cyclosporin A; LNT, lymph node T cells. ![]()
Received for publication November 24, 1998. Accepted for publication February 26, 1999.
| References |
|---|
|
|
|---|
immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II. Cell 44:273.[Medline]
-chain expression of murine Thy-1+ dendritic epidermal cells revealed by V
3-specific monoclonal antibody. Proc. Natl. Acad. Sci. USA 86:4185.
and ZAP70. J. Exp. Med. 186:1645.This article has been cited by other articles:
![]() |
H. Hoff, K. Knieke, Z. Cabail, H. Hirseland, G. Vratsanos, G.-R. Burmester, G. Jorch, S. G. Nadler, B. Broker, K. Hebel, et al. Surface CD152 (CTLA-4) Expression and Signaling Dictates Longevity of CD28null T Cells J. Immunol., May 1, 2009; 182(9): 5342 - 5351. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kurtz, F. Raval, C. Vallot, J. Der, and M. Sykes CTLA-4 on alloreactive CD4 T cells interacts with recipient CD80/86 to promote tolerance Blood, April 9, 2009; 113(15): 3475 - 3484. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Friedline, D. S. Brown, H. Nguyen, H. Kornfeld, J. Lee, Y. Zhang, M. Appleby, S. D. Der, J. Kang, and C. A. Chambers CD4+ regulatory T cells require CTLA-4 for the maintenance of systemic tolerance J. Exp. Med., February 16, 2009; 206(2): 421 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yuan, S. Gnjatic, H. Li, S. Powel, H. F. Gallardo, E. Ritter, G. Y. Ku, A. A. Jungbluth, N. H. Segal, T. S. Rasalan, et al. CTLA-4 blockade enhances polyfunctional NY-ESO-1 specific T cell responses in metastatic melanoma patients with clinical benefit PNAS, December 23, 2008; 105(51): 20410 - 20415. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Q. Phan, J. S. Weber, and V. K. Sondak CTLA-4 Blockade with Monoclonal Antibodies in Patients with Metastatic Cancer: Surgical Issues Ann. Surg. Oncol., November 1, 2008; 15(11): 3014 - 3021. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Huber, F. Menconi, S. Corathers, E. M. Jacobson, and Y. Tomer Joint Genetic Susceptibility to Type 1 Diabetes and Autoimmune Thyroiditis: from Epidemiology to Mechanisms Endocr. Rev., October 1, 2008; 29(6): 697 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. King, J. Waxman, and H. Stauss Advances in tumour immunotherapy QJM, September 1, 2008; 101(9): 675 - 683. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Menard, F. Ghiringhelli, S. Roux, N. Chaput, C. Mateus, U. Grohmann, S. Caillat-Zucman, L. Zitvogel, and C. Robert CTLA-4 Blockade Confers Lymphocyte Resistance to Regulatory T-Cells in Advanced Melanoma: Surrogate Marker of Efficacy of Tremelimumab? Clin. Cancer Res., August 15, 2008; 14(16): 5242 - 5249. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Quandt, H. Hoff, M. Rudolph, S. Fillatreau, and M. C. Brunner-Weinzierl A New Role of CTLA-4 on B Cells in Thymus-Dependent Immune Responses In Vivo J. Immunol., December 1, 2007; 179(11): 7316 - 7324. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Downey, J. A. Klapper, F. O. Smith, J. C. Yang, R. M. Sherry, R. E. Royal, U. S. Kammula, M. S. Hughes, T. E. Allen, C. L. Levy, et al. Prognostic Factors Related to Clinical Response in Patients with Metastatic Melanoma Treated by CTL-Associated Antigen-4 Blockade Clin. Cancer Res., November 15, 2007; 13(22): 6681 - 6688. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Joshi, G. V. Hegde, J. D. Dickinson, A. K. Mittal, J. C. Lynch, J. D. Eudy, J. O. Armitage, P. J. Bierman, R. G. Bociek, M. P. Devetten, et al. ATM, CTLA4, MNDA, and HEM1 in High versus Low CD38 Expressing B-Cell Chronic Lymphocytic Leukemia Clin. Cancer Res., September 15, 2007; 13(18): 5295 - 5304. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kim, M. Levin, S. P. Schoenberger, A. Sharpe, and M. Kronenberg Paradoxical Effect of Reduced Costimulation in T Cell-Mediated Colitis J. Immunol., May 1, 2007; 178(9): 5563 - 5570. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Preller, A. Gerber, S. Wrenger, M. Togni, D. Marguet, J. Tadje, U. Lendeckel, C. Rocken, J. Faust, K. Neubert, et al. TGF-beta1-Mediated Control of Central Nervous System Inflammation and Autoimmunity through the Inhibitory Receptor CD26 J. Immunol., April 1, 2007; 178(7): 4632 - 4640. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pandiyan, J. K. E. Hegel, M. Krueger, D. Quandt, and M. C. Brunner-Weinzierl High IFN-{gamma} Production of Individual CD8 T Lymphocytes Is Controlled by CD152 (CTLA-4) J. Immunol., February 15, 2007; 178(4): 2132 - 2140. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Engelhardt, T. J. Sullivan, and J. P. Allison CTLA-4 Overexpression Inhibits T Cell Responses through a CD28-B7-Dependent Mechanism J. Immunol., July 15, 2006; 177(2): 1052 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Lockhart and J. Miller Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription. J. Immunol., April 15, 2006; 176(8): 4778 - 4784. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mesri, G. Smithson, A. Ghatpande, A. Chapoval, S. Shenoy, F. Boldog, C. Hackett, C. E. Pena, C. Burgess, A. Bendele, et al. Inhibition of in vitro and in vivo T cell responses by recombinant human Tim-1 extracellular domain proteins Int. Immunol., March 1, 2006; 18(3): 473 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Homann, W. Dummer, T. Wolfe, E. Rodrigo, A. N. Theofilopoulos, M. B. A. Oldstone, and M. G. von Herrath Lack of Intrinsic CTLA-4 Expression Has Minimal Effect on Regulation of Antiviral T-Cell Immunity J. Virol., January 1, 2006; 80(1): 270 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Maker, G. Q. Phan, P. Attia, J. C. Yang, R. M. Sherry, S. L. Topalian, U. S. Kammula, R. E. Royal, L. R. Haworth, C. Levy, et al. Tumor Regression and Autoimmunity in Patients Treated With Cytotoxic T Lymphocyte-Associated Antigen 4 Blockade and Interleukin 2: A Phase I/II Study Ann. Surg. Oncol., December 1, 2005; 12(12): 1005 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Maker, P. Attia, and S. A. Rosenberg Analysis of the Cellular Mechanism of Antitumor Responses and Autoimmunity in Patients Treated with CTLA-4 Blockade J. Immunol., December 1, 2005; 175(11): 7746 - 7754. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Attia, G. Q. Phan, A. V. Maker, M. R. Robinson, M. M. Quezado, J. C. Yang, R. M. Sherry, S. L. Topalian, U. S. Kammula, R. E. Royal, et al. Autoimmunity Correlates With Tumor Regression in Patients With Metastatic Melanoma Treated With Anti-Cytotoxic T-Lymphocyte Antigen-4 J. Clin. Oncol., September 1, 2005; 23(25): 6043 - 6053. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mukherjee, A. Ahmed, and D. Nandi CTLA4-CD80/CD86 interactions on primary mouse CD4+ T cells integrate signal-strength information to modulate activation with Concanavalin A J. Leukoc. Biol., July 1, 2005; 78(1): 144 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Merlo, C. Tenca, F. Fais, L. Battini, E. Ciccone, C. E. Grossi, and D. Saverino Inhibitory Receptors CD85j, LAIR-1, and CD152 Down-Regulate Immunoglobulin and Cytokine Production by Human B Lymphocytes Clin. Vaccine Immunol., June 1, 2005; 12(6): 705 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Treschow, J. Backlund, R. Holmdahl, and S. Issazadeh-Navikas Intrinsic Tolerance in Autologous Collagen-Induced Arthritis Is Generated by CD152-Dependent CD4+ Suppressor Cells J. Immunol., June 1, 2005; 174(11): 6742 - 6750. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Riley and C. H. June The CD28 family: a T-cell rheostat for therapeutic control of T-cell activation Blood, January 1, 2005; 105(1): 13 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Lockhart, E. Marin, B. Graf, R. Abe, Y. Harada, C. E. Sedwick, and J. Miller Cutting Edge: CD28-Mediated Transcriptional and Posttranscriptional Regulation of IL-2 Expression Are Controlled through Different Signaling Pathways J. Immunol., December 15, 2004; 173(12): 7120 - 7124. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inobe and R. H. Schwartz CTLA-4 Engagement Acts as a Brake on CD4+ T Cell Proliferation and Cytokine Production but Is Not Required for Tuning T Cell Reactivity in Adaptive Tolerance J. Immunol., December 15, 2004; 173(12): 7239 - 7248. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kwon, H.-S. Jun, L.-Y. Khil, and J.-W. Yoon Role of CTLA-4 in the Activation of Single- and Double-Positive Thymocytes J. Immunol., December 1, 2004; 173(11): 6645 - 6653. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Borkow and Z. Bentwich Chronic Immune Activation Associated with Chronic Helminthic and Human Immunodeficiency Virus Infections: Role of Hyporesponsiveness and Anergy Clin. Microbiol. Rev., October 1, 2004; 17(4): 1012 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Martins, C. E. Tadokoro, R. B. Silva, J. S. Silva, and L. V. Rizzo CTLA-4 Blockage Increases Resistance to Infection with the Intracellular Protozoan Trypanosoma cruzi J. Immunol., April 15, 2004; 172(8): 4893 - 4901. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pandiyan, D. Gartner, O. Soezeri, A. Radbruch, K. Schulze-Osthoff, and M. C. Brunner-Weinzierl CD152 (CTLA-4) Determines the Unequal Resistance of Th1 and Th2 Cells against Activation-induced Cell Death by a Mechanism Requiring PI3 Kinase Function J. Exp. Med., March 15, 2004; 199(6): 831 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Murillo, A. Arina, I. Tirapu, C. Alfaro, G. Mazzolini, B. Palencia, A. L.-D. De Cerio, J. Prieto, M. Bendandi, and I. Melero Potentiation of Therapeutic Immune Responses against Malignancies with Monoclonal Antibodies Clin. Cancer Res., November 15, 2003; 9(15): 5454 - 5464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Agadjanyan, M. A. Chattergoon, M. J. Holterman, B. Monzavi-Karbassi, J. J. Kim, T. Dentchev, D. Wilson, V. Ayyavoo, L. J. Montaner, T. Kieber-Emmons, et al. Costimulatory Molecule Immune Enhancement in a Plasmid Vaccine Model Is Regulated in Part Through the Ig Constant-Like Domain of CD80/86 J. Immunol., October 15, 2003; 171(8): 4311 - 4319. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Maszyna, H. Hoff, D. Kunkel, A. Radbruch, and M. C. Brunner-Weinzierl Diversity of Clonal T Cell Proliferation Is Mediated by Differential Expression of CD152 (CTLA-4) on the Cell Surface of Activated Individual T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3459 - 3466. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Q. Phan, J. C. Yang, R. M. Sherry, P. Hwu, S. L. Topalian, D. J. Schwartzentruber, N. P. Restifo, L. R. Haworth, C. A. Seipp, L. J. Freezer, et al. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte-associated antigen 4 blockade in patients with metastatic melanoma PNAS, July 8, 2003; 100(14): 8372 - 8377. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mohrs, D. A. Lacy, and R. M. Locksley Stat Signals Release Activated Naive Th Cells from an Anergic Checkpoint J. Immunol., February 15, 2003; 170(4): 1870 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Steel and T. B. Nutman CTLA-4 in Filarial Infections: Implications for a Role in Diminished T Cell Reactivity J. Immunol., February 15, 2003; 170(4): 1930 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. K. Walker, L. J. Ausubel, A. Chodos, N. Bekarian, and A. K. Abbas CTLA-4 Differentially Regulates T Cell Responses to Endogenous Tissue Protein Versus Exogenous Immunogen J. Immunol., December 1, 2002; 169(11): 6202 - 6209. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Borron, E. A. Mostaghel, C. Doyle, E. S. Walsh, M. G. McHeyzer-Williams, and J. R. Wright Pulmonary Surfactant Proteins A and D Directly Suppress CD3+/CD4+ Cell Function: Evidence for Two Shared Mechanisms J. Immunol., November 15, 2002; 169(10): 5844 - 5850. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mukherjee, P. K. Maiti, and D. Nandi Role of CD80, CD86, and CTLA4 on mouse CD4+ T lymphocytes in enhancing cell-cycle progression and survival after activation with PMA and ionomycin J. Leukoc. Biol., November 1, 2002; 72(5): 921 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Riley, M. Mao, S. Kobayashi, M. Biery, J. Burchard, G. Cavet, B. P. Gregson, C. H. June, and P. S. Linsley Modulation of TCR-induced transcriptional profiles by ligation of CD28, ICOS, and CTLA-4 receptors PNAS, September 3, 2002; 99(18): 11790 - 11795. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Darlington, M. L. Baroja, T. A. Chau, E. Siu, V. Ling, B. M. Carreno, and J. Madrenas Surface Cytotoxic T Lymphocyte-associated Antigen 4 Partitions Within Lipid Rafts and Relocates to the Immunological Synapse under Conditions of Inhibition of T Cell Activation J. Exp. Med., May 20, 2002; 195(10): 1337 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haspot, F. Villemain, G. Laflamme, F. Coulon, D. Olive, J. Tiollier, J.-P. Soulillou, and B. Vanhove Differential effect of CD28 versus B7 blockade on direct pathway of allorecognition and self-restricted responses Blood, March 15, 2002; 99(6): 2228 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Saverino, A. Merlo, S. Bruno, V. Pistoia, C. E. Grossi, and E. Ciccone Dual Effect of CD85/Leukocyte Ig-Like Receptor-1/Ig-Like Transcript 2 and CD152 (CTLA-4) on Cytokine Production by Antigen-Stimulated Human T Cells J. Immunol., January 1, 2002; 168(1): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Vanasek, A. Khoruts, T. Zell, and D. L. Mueller Antagonistic Roles for CTLA-4 and the Mammalian Target of Rapamycin in the Regulation of Clonal Anergy: Enhanced Cell Cycle Progression Promotes Recall Antigen Responsiveness J. Immunol., November 15, 2001; 167(10): 5636 - 5644. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Abraham and J. Miller Molecular Mechanisms of IL-2 Gene Regulation Following Costimulation Through LFA-1 J. Immunol., November 1, 2001; 167(9): 5193 - 5201. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Merlo, D. Saverino, C. Tenca, C. E. Grossi, S. Bruno, and E. Ciccone CD85/LIR-1/ILT2 and CD152 (Cytotoxic T Lymphocyte Antigen 4) Inhibitory Molecules Down-Regulate the Cytolytic Activity of Human CD4+ T-Cell Clones Specific for Mycobacterium tuberculosis Infect. Immun., October 1, 2001; 69(10): 6022 - 6029. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Doyle, A. C. Mullen, A. V. Villarino, A. S. Hutchins, F. A. High, H. W. Lee, C. B. Thompson, and S. L. Reiner Induction of Cytotoxic T Lymphocyte Antigen 4 (CTLA-4) Restricts Clonal Expansion of Helper T Cells J. Exp. Med., September 24, 2001; 194(7): 893 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-N. Avice, M. Rubio, M. Sergerie, G. Delespesse, and M. Sarfati Role of CD47 in the Induction of Human Naive T Cell Anergy J. Immunol., September 1, 2001; 167(5): 2459 - 2468. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Riley, P. J. Blair, J. T. Musser, R. Abe, K. Tezuka, T. Tsuji, and C. H. June ICOS Costimulation Requires IL-2 and Can Be Prevented by CTLA-4 Engagement J. Immunol., April 15, 2001; 166(8): 4943 - 4948. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Huang and M. L. Tykocinski CTLA-4-Fas ligand functions as a trans signal converter protein in bridging antigen-presenting cells and T cells Int. Immunol., April 1, 2001; 13(4): 529 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. da Rocha Dias and C. E. Rudd CTLA-4 blockade of antigen-induced cell death Blood, February 15, 2001; 97(4): 1134 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, V. A. Lawless, and M. H. Kaplan Cytokine-Stimulated T Lymphocyte Proliferation Is Regulated by p27Kip1 1 J. Immunol., December 1, 2000; 165(11): 6270 - 6277. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kouki, Y. Sawai, C. A. Gardine, M.-E. Fisfalen, M.-L. Alegre, and L. J. DeGroot CTLA-4 Gene Polymorphism at Position 49 in Exon 1 Reduces the Inhibitory Function of CTLA-4 and Contributes to the Pathogenesis of Graves' Disease J. Immunol., December 1, 2000; 165(11): 6606 - 6611. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pioli, L. Gatta, V. Ubaldi, and G. Doria Inhibition of IgG1 and IgE Production by Stimulation of the B Cell CTLA-4 Receptor J. Immunol., November 15, 2000; 165(10): 5530 - 5536. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. McGaha and J. W. Murphy CTLA-4 Down-Regulates the Protective Anticryptococcal Cell-Mediated Immune Response Infect. Immun., August 1, 2000; 68(8): 4624 - 4630. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Griffin, D. K. Hong, P. O. Holman, K.-M. Lee, M. J. Whitters, S. M. O'Herrin, F. Fallarino, M. Collins, D. M. Segal, T. F. Gajewski, et al. Blockade of T Cell Activation Using a Surface-Linked Single-Chain Antibody to CTLA-4 (CD152) J. Immunol., May 1, 2000; 164(9): 4433 - 4442. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Chambers, M. S. Kuhns, and J. P. Allison Cytotoxic T lymphocyte antigen-4 (CTLA-4) regulates primary and secondary peptide-specific CD4+ T cell responses PNAS, July 20, 1999; 96(15): 8603 - 8608. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.A. CHAMBERS and J.P. ALLISON CTLA-4 -- The Costimulatory Molecule That Doesn't: Regulation of T-cell Responses by Inhibition Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 303 - 312. [Abstract] [PDF] |
||||
![]() |
T. J. Sullivan, J. J. Letterio, A. van Elsas, M. Mamura, J. van Amelsfort, S. Sharpe, B. Metzler, C. A. Chambers, and J. P. Allison Lack of a role for transforming growth factor-beta in cytotoxic T lymphocyte antigen-4-mediated inhibition of T cell activation PNAS, February 27, 2001; 98(5): 2587 - 2592. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Luhder, C. Chambers, J. P. Allison, C. Benoist, and D. Mathis Pinpointing when T cell costimulatory receptor CTLA-4 must be engaged to dampen diabetogenic T cells PNAS, October 24, 2000; 97(22): 12204 - 12209. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kuhns, V. Epshteyn, R. A. Sobel, and J. P. Allison Cytotoxic T lymphocyte antigen-4 (CTLA-4) regulates the size, reactivity, and function of a primed pool of CD4+ T cells PNAS, November 7, 2000; 97(23): 12711 - 12716. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |