|
|
||||||||
and TNF-
1
Laboratory of Immunology, Istituto Dermopatico dellImmacolata, IRCCS, Rome, Italy
| Abstract |
|---|
|
|
|---|
or TNF-
on the immune
activation of keratinocytes. Skin affected with ACD to nickel and
skin-derived, nickel-specific CD4+ T cell lines expressed
IFN-
, TNF-
, and IL-17 mRNAs. Four of seven nickel-specific
CD4+ T cell clones positive for the skin-homing receptor,
cutaneous lymphocyte-associated Ag, were shown to corelease IL-17,
IFN-
, and TNF-
. In contrast, two nickel-specific CD8+
T cell clones failed to synthesize IL-17. Normal human keratinocytes
were found to express constitutively the IL-17 receptor gene. IL-17
specifically and dose-dependently augmented IFN-
-induced ICAM-1
expression on keratinocytes at both the mRNA and the protein level,
whereas HLA-DR, MHC class I, and CD40 levels were not modulated by
IL-17. On the other hand, IL-17 alone did not affect ICAM-1 or
enhance TNF-
-induced ICAM-1. In addition, IL-17, both
directly and in synergism with IFN-
and/or TNF-
, stimulated
synthesis and release of IL-8 by keratinocytes. In contrast, IFN-
-
and TNF-
-induced production of RANTES was markedly inhibited by
IL-17, and the synthesis of macrophage chemotactic protein 1 was not
changed. Taken together, the results suggest that IL-17 is an important
player of T cell-mediated skin immune responses, with synergistic or
antagonist effects on IFN-
- and TNF-
-stimulated keratinocyte
activation. | Introduction |
|---|
|
|
|---|
, and TNF-
released by
CD4+ and CD8+ T cells exert mostly
proinflammatory effects, whereas IL-4 and IL-10 released by
CD4+ Th2 and other T-regulatory cells inhibit the reaction
(4, 5, 6). In particular, IFN-
and TNF-
are primarily involved in
amplifying inflammation by stimulating resident skin cells to
synthesize chemokines that attract inflammatory cells and membrane
molecules important for the retention and activation of T cells.
Epidermal keratinocytes are a major target of IFN-
and TNF-
.
These cytokines induce the release of IL-8, monocyte Chemotactic
protein (MCP)-1, and RANTES from keratinocytes in vitro (7, 8).
Moreover, IFN-
and, to a lower degree, TNF-
stimulate the
expression of ICAM-1 and MHC class II Ags on keratinocytes both in
vitro and in vivo (7, 9, 10). ICAM-1 plays a critical role in T
lymphocyte adhesion to keratinocytes by acting as the ligand for LFA-1-
and Mac-1-bearing leukocytes (11). In addition, ICAM-1 expression can
be important for an efficient lysis of keratinocytes by cytotoxic T
cells (12). In ACD, keratinocyte ICAM-1 expression is markedly
increased and correlates with the infiltration of LFA-1-positive cells
(13). Similarly, in the lymph derived from skin sites affected by ACD,
large amounts of soluble ICAM-1 (sICAM-1) can be measured (14).
Moreover, fluid from suction blisters raised over ACD lesions, but not
on normal skin, contains T cell chemoattractants, with keratinocytes
being the likely source of these factors (15, 16).
IL-17 is a novel cytokine, apparently secreted only by
CD4+-activated memory T cells, that induces the release of
cytokines and prostaglandins from stromal cells and macrophages
(17, 18, 19). Both TNF-
and IFN-
had an additive effect on the
IL-17-induced secretion of IL-6, and the combination of IL-17 plus
TNF-
was effective in promoting GM-CSF release by synovial
fibroblasts (18). Furthermore, IL-17 was shown to enhance cell surface
expression of ICAM-1 on human fibroblasts (17). Thus, a broad set of
effects are induced by IL-17, and its action can be potentiated by
other cytokines. In the present study, we investigated whether
hapten-specific skin-homing T cells produce IL-17, and the influences
of IL-17 alone or in combination with IFN-
or TNF-
on the immune
activation of keratinocytes.
| Materials and Methods |
|---|
|
|
|---|
Recombinant human (rh) IFN-
and TNF-
were obtained from
Genzyme (Cambridge, MA); rhIL-17 from R&D Systems (Abingdon, Oxon,
U.K.). Mouse anti-human IFN-
receptor (IgG1) and polyclonal
rabbit anti-human TNF-
were from Genzyme; anti-TNF-
receptor type I (htr 9, IgG1) mAb was from Biomedicals (Augst,
Switzerland); goat anti-IL-17 polyclonal Ab was purchased from R&D
Systems and rabbit anti-IL-17 polyclonal Ab was from Peprotech
(Rocky Hill, NJ). The HECA-452 mAb (rat IgM) was kindly provided by Dr.
Louis J. Picker (Lab. of Experimental Pathology, Dept. of Pathology,
University of Texas Southwestern Medical Center, Dallas, TX).
Phycoerythrin (PE)-conjugated anti-CD8 (SK1, IgG1), FITC-conjugated
anti-HLA-DR (L243, IgG2a), anti-CD4 (SK3 and SK4, IgG1) and
anti-CD28 (Leu-28, IgG1) mAbs were purchased from Becton Dickinson
(San Jose, CA); FITC-conjugated anti-CD54 (84H10, IgG1),
anti-CD80 (MAB104, IgG1), PE-conjugated anti-TCR-
ß
(BMA031, IgG2b), FITC-conjugated anti-TCR-
(IMMU510, IgG1),
and anti-CD3 (UCHT-1, IgG1) mAbs were from Immunotech (Marseille,
France). Anti-CD40 (BE-1, IgG1) and anti-MHC class I (W6-32, IgG2a)
mAbs were from Ancell (Bayport, MN) and Dako (Glostrup, Denmark),
respectively; PE-conjugated anti-CD86 (IT2.2, IgG2b) was from
PharMingen (San Diego, CA). F(ab')2 fragments of
FITC-conjugated anti-mouse Ig came from Silenus (Hawthorn,
Australia), and PE-conjugated anti-rat IgM from PharMingen. Control
unconjugated and FITC-conjugated mouse IgG1, IgG2a were purchased from
Becton Dickinson, and rat IgM from PharMingen.
Generation of nickel-specific T cell lines and clones
Biopsies of normal skin and 48-h positive patch test reactions to 5% NiSO4 from two patients allergic to nickel were either frozen or used to isolate nickel-specific T cell lines. To this end, skin was washed with PBS and then placed in culture in RPMI 1640 complemented with 2 mM glutamine, 1 mM sodium pyruvate, 1% nonessential amino acids, 0.05 mM 2-ME, 100 U/ml penicillin, 100 µg/ml streptomycin (all from Life Technologies, Chagrin Falls, OH) (complete RPMI), 5% FCS (HyClone, Logan, UT), and 20 U/ml rIL-2 (kindly provided by Chiron Italia, Siena, Italy) for 12 days, with fresh medium and IL-2 replaced every 3 days. T cell clones were prepared from short term nickel-specific CD4+ and CD8+ T cell lines obtained from the peripheral blood as previously described (6). T cell lines were cloned by limiting dilution (0.6 cell/well) in the presence of 2 x 105 PBMC, 20 U/ml rIL-2, and 1% PHA (Life Technologies) in U-bottom 96-well microplates. T cell cultures were performed in complete RPMI supplemented with 10% FCS and 3% human plasma. Clones were grown by adding rIL-2 (20 U/ml) twice a week and were periodically stimulated with 1% PHA in the presence of feeder cells. Skin-derived T cell lines and resting T cell clones were assayed for Ag specificity after extensive washing to remove IL-2, using autologous EBV-transformed B cell lines as APC and 10 µg/ml NiSO4 (Sigma, St. Louis, MO). After 48 h, the cultures were pulsed overnight with 5 µCi/ml [3H]thymidine (Amersham, Little Chalfont, U.K.) at 37°C and then harvested onto fiber-coated 96-well plates (Packard Instruments, Groningen, The Netherlands). Radioactivity was measured in a beta counter (Topcount, Packard Instruments). Supernatants from the nickel-specific CD4+ T cell clone, OC2, were collected after 48 h of culture (106 cells/ml in 24 wells) in complete RPMI supplemented with 5% human serum in the presence of coated anti-CD3 (1 µg/ml) and soluble anti-CD28 (1 µg/ml) mAbs, filtered, and then stored at -80°C.
Keratinocyte cultures
Samples of normal human skin were obtained from adult donors (n = 3) undergoing abdominoplasty or mammoplasty surgery. Epidermal cell suspensions were prepared as previously described (20). In brief, epidermal sheets were separated from dermis using 0.5% dispase (Boehringer Mannheim, Mannheim, Germany) and then disaggregated to single-cell suspensions using 0.25% trypsin (Biochrom, Berlin, Germany). Keratinocyte primary cultures were established by seeding epidermal cells (1.22 x 104 cells/cm2) on a feeder layer of irradiated 3T3/National Institutes of Health fibroblasts (2 x 104 cells/cm2) and cultured in a modified Greens medium, as described before (20). At 7080% confluence, keratinocytes were detached with 0.05% trypsin/0.02% EDTA and then aliquoted and cryopreserved in liquid nitrogen. Second- or third-passage keratinocytes were used in all experiments, with cells cultured in the serum-free medium, keratinocyte growth medium (Clonetics, San Diego, CA), for at least 35 days before the experiments were performed. During incubation with cytokines, hydrocortisone was omitted from the culture medium. Keratinocyte cultures were devoid of any contaminating leukocyte as assessed by flow cytometry analysis using mAbs against dendritic cell, monocyte, and T cell markers (not shown). The HaCaT keratinocyte cell line (gift from Dr. N. Fusenig, Deutsches Krebsforschungszentrum, Heidelberg, Germany) and A431 keratinocytes were cultured in DME medium supplemented with 10% FCS.
Flow cytometry analysis
The immunophenotype of the nickel-specific T cell lines and
clones was evaluated by double-color flow cytometry analysis using
anti-CD4, anti-CD8, anti-TCR-
ß, and
anti-TCR-
PE- or FITC-conjugated mAbs. CLA expression was
studied using the HECA-452 mAb followed by PE-conjugated anti-rat
IgM. Keratinocytes were stained with FITC-conjugated mAbs or
unconjugated primary mAbs followed by FITC-conjugated anti-mouse
Ig. In control samples, staining was performed using isotype-matched
control Abs or omitting primary mAbs. Cells were analyzed with a
FACScan equipped with Cell Quest software (Becton Dickinson, Mountain
View, CA).
ELISA
Media conditioned for 48 h by T cell clones stimulated with
10 ng/ml PMA and 1 µg/ml ionomycin (Sigma) in 24 wells at
106 cells/ml were harvested and filtered. IL-4, IFN-
,
and TNF-
content was measured with commercially available sandwich
ELISA kits (R&D Systems), following the manufacturers instructions.
IL-17 release was determined in supernatants by using microtiter plates
coated with 4 µg/ml goat anti-IL-17 diluted in 50 mM carbonate
buffer, pH 9.0. Staining was performed with 2 µg/ml rabbit
anti-IL-17 in PBS containing 1% BSA followed by an anti-rabbit
IgG horseradish peroxidase-conjugated Ab (Santa Cruz Biotech, Santa
Cruz, CA). Chemokines and sICAM-1 were measured on cell-free
supernatants collected after a 48-h treatment of subconfluent
keratinocyte cultures performed in 6-well plates. The following ELISA
kits were used: ICAM-1 Predicta kits from Genzyme; RANTES, IL-8, and
MCP-1 Quantikine kits from R&D Systems. An ELISA reader model 3550 UV
Bio-Rad (Hercules, CA) was used. T cell and keratinocyte cultures were
conducted in triplicate for each condition.
RNA isolation and analysis
Total cellular RNA was extracted from skin samples, T cells, and
keratinocytes using the acid guanidinium thiocyanate-phenol-chloroform
method (21). For Northern blot experiments, 15 µg of RNA were
fractionated on 1% formaldehyde-agarose gel, blotted to nylon
membranes (Amersham), and fixed by UV irradiation. Blots were
hybridized with PCR-amplified probes, corresponding to ICAM-1, MCP-1,
and IL-8 (22, 23, 24), and labeled by random priming (Boehringer Mannheim)
with [32P]dCTP. After 20 min of prehybridization in
Quickhyb solution (Stratagene, La Jolla, CA), denatured probe was
added, and hybridization was conducted for 1 h at 68°C. Blots
were washed under highly stringent conditions and subjected to
autoradiography. Equal loading and integrity of RNA were assessed
either by ethidium bromide staining of the gels or hybridizing the
membrane with a probe specific for 28S rRNA. For RT-PCR analysis,
0.51 µg of total RNA was converted in cDNA using oligo(dT) primers
and then amplified with a GeneAmp RNA PCR kit (Perkin-Elmer, Roche
Molecular Systems, Branchburg, NJ) according to the manufacturers
instructions. The following synthetic oligonucleotides were used: for
IFN-
amplification, primers TGCAGGTCATTCAGATGTAG and
AGCCATCACTTGGATGAGGG (306-bp amplification product); for
TNF-
, ATGAGCACTGAAAGCATGATCCGG and CTACAACATGGGCTACAGGCTTGT
(295-bp amplification product); for IL-17, primers TGGAGGCCATAGTGAAGG
and GGCCACATGGTGGACAAT (415-bp amplification product) (17); for IL-17
receptor extracellular domain, primers CTAAACTGCACGGTCAAGAAT and
ATGAACCAGTACACCCAC (833-bp amplification product); for IL-17 receptor
intracellular domain, primers ATGGACAGGTTCGAGGAG and
TTCACGATGCCGGTTCCC (276-bp amplification product) (25); for RANTES,
primers TCATTGCTACTGCCCTCTGGG and CGTCGTGGTCAGAATCTGGG (373-bp
amplification product) (26). As an internal control for the amount of
RNA used, the glyceraldehyde-3-phosphate dehydrogenase housekeeping
gene was used with primers TGAAGGTCGGAGTCAACGGATTTGGT and
CATGTGGGCCATGAGGTCCACCAC (expected cDNA product, 983 bp). For
semiquantitative analysis of RANTES, RNA concentrations, primers, and
PCR cycles were titrated to obtain standard curves to verify linearity
and to permit analysis of signal strength.
Immunoprecipitation
Supernatants were collected from T cell clones stimulated or not for 48 h with PMA and ionomycin. Supernatants corresponding to 106 cells and rhIL-17 were immunoprecipitated with goat anti-IL-17 polyclonal Ab and protein G-Sepharose beads (Pharmacia Biotech, Uppsala, Sweden) before analysis on 12% SDS-PAGE. After tranferring to PVDF membrane, immunoprecipitates were probed with goat anti-IL-17 Ab at 1:500 dilution. Blots were developed with anti-goat horseradish peroxidase-conjugated IgG (Santa Cruz), using the ECL-Plus immunodetection system (Amersham) followed by autoradiography.
Statistical analysis
Wilcoxons signed rank test was used (SigmaStat, Jandel, San
Rafael, CA). p values
0.05 were considered
significant.
| Results |
|---|
|
|
|---|
In the first set of experiments, we determined whether skin
affected with ACD to nickel and hapten-specific T cells expressed
IL-17. Skin biopsies from positive patch tests to nickel performed in
two allergic patients showed the simultaneous presence of mRNA for
IFN-
, TNF-
, and IL-17. IL-17 mRNA could also be detected in skin
affected by psoriasis, a chronic inflammatory disease with prominent
CD4+ T cell infiltration, thus suggesting that
IL-17-producing T cells can accumulate in the skin during different
inflammatory conditions. In contrast, normal skin did not express
TNF-
and IL-17 mRNAs and showed limited IFN-
mRNA expression
(Fig. 1
). Nickel-specific T cell lines
generated from the same ACD biopsies were >90% CD4+ and
showed, upon 12-h stimulation with autologous APC and
NiSO4, a similar pattern of cytokine expression, which
included IFN-
, TNF-
, and IL-17 (Fig. 1
). To investigate IL-17
production at the single-cell level, T cell clones specific for nickel
were prepared from the peripheral blood of allergic patients and
characterized for their Ag specificity, surface phenotype, cytokine
release profile, and expression of the skin-homing receptor, CLA. Eight
TCR-
ß+,
/
-CD4+, and two
CD8+ T cell clones were included in the study. They were
strictly nickel specific, as assessed in proliferation assays performed
in the presence of autologous APC cells and NiSO4 (Table I
). According to the relative IFN-
and
IL-4 release following activation with PMA and ionomycin, four Th1, two
Th0, two Th0/Th2, one Tc0, and one Tc1 clones were defined. All
CD4+ clones released also substantial amounts of TNF-
,
with the two CD8+ clones being less productive. In
addition, with the exception of the TM35, all nickel-specific T cell
clones analyzed were found to express the CLA receptor (Table I
), thus
possessing the potential to recirculate in the skin. Supernatants from
four of eight activated CD4+ clones contained IL-17
protein, ranging from 0.5 to 1.9 ng/106 cells, as assessed
by ELISA (Fig. 2
A), whereas
none of the two CD8+ clones released detectable amounts of
IL-17. IL-17 release, albeit at slight lower levels, was also observed
when CD4+ T cell clones were stimulated with soluble
anti-CD3 mAb and PMA, coated anti-CD3 and soluble
anti-CD28, or autologous APC and NiSO4 (data not
shown). The IL-17-releasing clones comprised three Th1 and one Th0/2
clones, and were isolated from two different nickel-allergic
patients. RT-PCR analysis confirmed that IL-17 mRNA was expressed after
5 h of activation with PMA/ionomycin by the four IL-17 releasing
CD4+ clones (Fig. 2
B). In contrast, activated
CD8+ T cells did not show detectable IL-17 transcripts even
after performing a nested PCR analysis. IL-17 has been shown to be
secreted as a mixture of glycosylated and nonglycosylated homodimers
which dissociate in two compounds of 22 and 15 kDa, respectively, under
reducing conditions (18). Therefore, supernatants from two activated
CD4+ T cell clones (OC2 and TM34) with the higher
IL-17-releasing capacity were immunoprecipitated with a specific
anti-IL-17 Ab and then analyzed on reduced SDS-PAGE. Both
glycosylated and nonglycosylated forms were released by OC2 and TM34
cells, with the levels of IL-17 detected by
immunoprecipitation-SDS-PAGE comparable with those measured by ELISA
(Fig. 2
C).
|
|
|
Next, we evaluated whether normal human keratinocytes and
keratinocyte cell lines expressed the IL-17 receptor. IL-17 receptor
cDNA has been recently cloned and characterized from a human T cell
library. It does not share homology with previously identified cytokine
receptor families and exhibits a broad tissue distribution (25). RT-PCR
analysis performed with two couples of primers specific for the
extracellular and intracellular portion revealed that normal
keratinocytes as well as A431 and HaCaT keratinocytes express
constitutively the IL-17 receptor. Treatment of normal keratinocytes
with TNF-
, IFN-
, or IL-17 for 14 h did not seem to change
IL-17 receptor gene expression (data not shown).
IL-17 enhances IFN-
-induced membrane ICAM-1 and release of
sICAM-1 by keratinocytes
The capacity of IL-17 to modulate the expression of cell
surface-immunomodulatory molecules on keratinocytes was investigated at
both protein and mRNA levels using IL-17 alone or in combination with
IFN-
and/or TNF-
. Treatment of cultured human keratinocytes for
2472 h with IFN-
(20200 U/ml) induced de novo expression of
ICAM-1 and HLA-DR as well as up-regulated MHC class I and CD40
molecules, whereas TNF-
(50 ng/ml) promoted weak ICAM-1 expression
but did not induce MHC and CD40 molecules, as previously reported (7, 27). Incubation of keratinocytes with IL-17 alone (50 ng/ml) had no
effects on the expression of ICAM-1, HLA-DR, MHC class I, or CD40.
However, IL-17 could stimulate a marked and selective enhancement of
IFN-
-induced membrane ICAM-1 (Fig. 3
).
This activity was dose dependent, it was confirmed using different
doses of IFN-
(data not shown), and it was specific, given that it
could be completely abolished with an anti-IL-17 Ab but not with an
irrelevant matched isotype Ab (Fig. 3
). The cooperative action of IL-17
in increasing the IFN-
-induced ICAM-1 was similar to or higher than
that of TNF-
, and a dramatic increase of membrane ICAM-1 expression
was observed upon keratinocyte treatment with a mixture of IFN-
,
IL-17, and TNF-
(Fig. 3
). On the other hand, IL-17 did not change
keratinocyte expression of MHC and CD40 molecules induced by IFN-
,
and ICAM-1 expression stimulated by TNF-
(Fig. 3
). To more closely
reproduce the in vivo situation, culture supernatant from
IL-17-releasing nickel-specific CD4+ T cells was tested for
its effect on keratinocyte ICAM-1 expression. Supernatant from the
Th1-like clone, OC2, activated with coated anti-CD3 and soluble
anti-CD28 mAbs, was capable of strongly up-regulating ICAM-1 on
keratinocytes, an effect that could be markedly inhibited by treating
keratinocytes with a blocking anti-IFN-
receptor mAb. Addition
to the supernatant of neutralizing anti-TNF-
or anti-IL-17
Ab resulted in a less prominent, but still significant, reduction of
ICAM-1 expression. Blocking the activity of IFN-
and IL-17 or of all
three cytokines further inhibited, although not completely, ICAM-1 on
keratinocytes (Table II
).
|
|
(200 U/ml) or TNF-
(50 ng/ml) for 48 h released large amounts
of sICAM-1. In keeping with the membrane ICAM-1 data, IL-17 augmented
dose dependently the release of sICAM-1 induced by IFN-
, but not by
TNF-
, an effect that could be suppressed by the addition of
IL-17-neutralizing Ab. Again, sICAM-1 production was maximal when
keratinocytes were stimulated with a mixture of IFN-
, IL-17, and
TNF-
. Consistent with the results at the protein level, Northern
blot analysis revealed substantial amounts of ICAM-1 mRNA in
keratinocytes upon treatment with IFN-
for 14 h, and addition
of 50 ng/ml IL-17 to the cultures resulted in a significant increase in
ICAM-1 mRNA content (Fig. 5
|
|
and TNF-
, promotes
IL-8 but inhibits IFN-
- and TNF-
-induced production of RANTES by
keratinocytes
Keratinocytes can synthesize and release several chemokines active
on a variety of leukocytes (28). Among the C-X-C chemokines, IL-8 is a
powerful chemoattractant for neutrophils. RANTES and MCP-1
belong to the C-C family of chemokines, with RANTES being chemotactic
for T cells and eosinophils and MCP-1 mostly active on T cells,
monocytes, and dendritic cells (29, 30). Chemokine production by
keratinocytes is strongly regulated by proinflammatory cytokines. Both
IFN-
and TNF-
promote RANTES release, whereas IL-8 and MCP-1 are
preferentially induced by TNF-
and IFN-
, respectively (7, 8).
IL-17 has been reported to induce IL-8 release by skin and rheumatoid
synovial fibroblasts (17, 18), and therefore we studied the effects of
IL-17 on chemokine synthesis by keratinocytes. IL-17 alone increased
IL-8 mRNA (Fig. 5
, lane 3), and dose dependently augmented
IL-8 release by keratinocytes, with a potency higher than that of
IFN-
(Fig. 6
A). IL-17 also
synergized with both TNF-
and IFN-
in inducing IL-8 (Fig. 5
, lanes 5 and 6), with maximal mRNA expression
(Fig. 5
, lane 8) and protein release (Table III
) when keratinocytes were stimulated
with the three cytokines together. Addition of anti-IL-17 Ab could
abolish completely IL-17 activity. On the other hand, IL-17 had no
effect on MCP-1 production (Fig. 5
) and did not influence IFN-
- or
TNF-
-induced MCP-1 release (Fig. 6
B and Table III
).
Finally, IL-17 inhibited expression of RANTES mRNA induced by IFN-
and/or TNF-
(Fig. 5
, lanes 5 and 6). Northern
blot analysis was not sensitive enough to detect RANTES mRNA, and thus
semiquantitative RT-PCR analysis was performed. A dose-dependent
suppressive activity of IL-17 on RANTES production was confirmed at the
protein level (Fig. 6
C), it was also evident when
keratinocytes were stimulated with IFN-
plus TNF-
and could be
reversed with the addition of anti-IL-17 Ab (Table III
).
|
|
| Discussion |
|---|
|
|
|---|
50% of the clones produce IL-17, with the
IL-17-releasing clones belonging to the Th1 (50%), Th0 (32%) or Th2
(18%) subset. Thus, IL-17 production does not appear to segregate into
a distinct Th subset (C. Albanesi, A. Cavani, S. Sebastiani, C.
Scarponi, and G. Girolomoni) manuscript in preparation). The two
CD8+ T cell clones failed to synthesize IL-17, in agreement
with previous results on activated peripheral blood CD8+ T
cells (18). IL-17 receptor gene expression was shown to be constitutive
in cultured normal keratinocytes and in human keratinocyte cell lines,
consistently with its broad tissue distribution (25). Because the
majority of nickel-specific T cells examined released IFN-
and
TNF-
, IL-17 activity on keratinocytes was examined also in
combination with these two cytokines.
A prominent feature of a variety of immune-mediated skin disorders,
including ACD and psoriasis, is the intraepidermal presence of
lymphocytes, and ICAM-1 provides a major adhesion pathway by which T
lymphocytes bind to keratinocytes and are thus retained in the
epidermis (11). In addition, ICAM-1 can serve as a relevant accessory
signal for activation of both CD4+ and CD8+ T
lymphocytes (12, 31). ICAM-1 is induced on keratinocytes by a limited
set of cytokines, especially by IFN-
and TNF-
. Here we showed
that IL-17 did not induce ICAM-1 on keratinocytes per se but
efficiently cooperated with IFN-
in promoting the synthesis and
membrane expression of ICAM-1. IL-17 was as potent as TNF-
in
enhancing IFN-
-induced ICAM-1, and very high levels of this adhesion
molecule were measured on keratinocytes when the three cytokines were
used in combination. In parallel, IL-17 also increased IFN-
-induced
release of sICAM-1 in supernatants from keratinocyte cultures. The
function of sICAM-1 has not been thoroughly investigated, but
evidence exists suggesting that sICAM-1 can regulate LFA-1-mediated
events, providing a mechanism that may prevent adhesion or promote
deadhesion between leukocytes and ICAM-1-positive cells (22). A role
for sICAM-1 in vivo is suggested by the finding that the lymph derived
from skin sites affected by ACD contains elevated levels of sICAM-1
(14).
ACD is characterized by an inflammatory infiltrate mainly constituted
by CD4+ and, to a lower extent, by CD8+ T
lymphocytes, monocytes, and dendritic cells. In the acute phase, but
not in chronic ACD, neutrophils can also be present in the epidermis
(32). The recruitment and activation of these cells are under the
control of chemokines released by resident skin cells, and many studies
indicate that activated keratinocytes are an important source of these
factors (7, 8, 15, 16, 28). In ACD to urushiol, keratinocytes were
shown to produce IL-8 at 2448 h after hapten challenge, a time that
correlated with the migration of T cells toward the epidermis (33), and
IL-8 neutralization suppressed the development of delayed-type
hypersensitivity reactions in rabbit skin (34). Another chemokine
important for the expression of ACD is MCP-1. Transgenic mice with
basal layer keratinocytes expressing constitutively MCP-1 showed
enhanced contact hypersensitivity responses coupled with an exaggerated
infiltration of dendritic cells and Langerhans cells in the skin (30).
In addition, Abs against MCP-1 could almost completely abolish
immigration of T cells and monocytes in rats undergoing cutaneous
delayed-type hypersensitivity reactions (35). Finally, certain
chemokines, such as RANTES, other than attract inflammatory cells, can
mediate the adhesion of CD4+ T lymphocytes to
keratinocytes, thus retaining the targeted leukocytes in the epidermis
(36). An interesting result of our study was the selective regulatory
activity of IL-17 on chemokine production by keratinocytes. In
fact, IL-17, directly or in synergism with IFN-
and/or TNF-
,
stimulated IL-8 synthesis, whereas it inhibited IFN-
- and
TNF-
-induced production of RANTES and had no effect on MCP-1.
Through selective modulation of chemokine release by keratinocytes,
IL-17 may regulate the recruitment of distinct leukocyte and T cell
subsets (37, 38, 39, 40), and thus ultimately direct the outcome of
cell-mediated immune responses in the skin. When IFN-
, TNF-
, and
IL-17 were used in combination, they induced a considerably high
production of IL-8 compared with the lower amounts of RANTES and MCP-1.
Although T lymphocytes bear low levels of IL-8 receptors and the
ability of IL-8 to induce T cell migration is still controversial (29, 41, 42, 43), it has been reported that IL-8 is selectively involved in the
enhanced migration of CLA+ T cells across activated
endothelium (44). Moreover, IFN-
and TNF-
up-regulate IL-8
receptors on T cells (45), and IL-8 released from TNF-
-activated
keratinocytes promotes directed migrational responses of both
neutrophils and T lymphocytes (16). IL-8 may also act indirectly by
stimulating the release of T cell chemoattractants from neutrophils
(46). Therefore, IL-8 produced by endothelial cells and subsequently by
keratinocytes may have a role in the homing of specific T cells to
inflamed skin (33). The question remains of why the high production of
IL-8 by keratinocytes is not associated with a strong neutrophil
infiltration in the skin during ACD.
The mechanisms by which IL-17 modulates TNF-
and IFN-
activities
have not been investigated. It is unlikely that this modulation is
exerted at the receptor level because IFN-
and TNF-
did not
appear to modify IL-17 receptor gene expression and, conversely, IL-17
did not change keratinocyte membrane expression of IFN-
and TNF-
receptors (not shown). Studies with a variety of human cell types have
demonstrated that TNF-
and IFN-
coregulate in a synergistic
manner the expression of many inflammatory genes via the independent
activation of two distinct transcription factors, STAT1 and NF-
B,
activated preferentially by IFN-
and TNF-
, respectively (47).
IFN-
-induced STAT1 and TNF-
-induced NF-
B synergistically
stimulate the transcription of ICAM-1 and RANTES genes (47). IFN-
plus TNF-
can also synergistically induce the production of IL-8,
but in this case it appears that activator protein 1 (AP-1) and
NF-
B-like factor binding elements are involved in conferring
responsiveness (48). The direct and cooperative action of IL-17 in
inducing IL-8 synthesis and enhancing IFN-
-dependent ICAM-1
expression by keratinocytes may be related to the ability of IL-17 to
activate NF-
B and AP-1 (19, 49). On the other hand, IFN-
-and/or
TNF-
-dependent RANTES production may be down-regulated by IL-17
through the activation of inhibitory factor(s), and the upstream region
of RANTES gene presents inhibitory regulating elements the deletion of
which results in enhanced promoter activity (50). Likewise, IL-17 on
keratinocytes, IL-4 and IL-13 inhibit IFN-
- and TNF-
-induced
RANTES release from endothelial and smooth muscle cells (51, 52).
In conclusion, our results suggest that IL-17 is an important element
in regulating the outcome of skin immune responses to haptens, and
probably of other T cell-mediated skin immune responses, with
synergistic or antagonist effects on IFN-
- and TNF-
-stimulated
keratinocyte activation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Giampiero Girolomoni, Laboratory of Immunology, Istituto Dermopatico dellImmacolata, IRCCS. Via Monti di Creta 104, I-00167 Rome, Italy. E-mail address: ![]()
3 Abbreviations used in this paper: ACD, allergic contact dermatitis; CLA, cutaneous lymphocyte-associated Ag; MCP-1, monocyte chemotactic protein 1; sICAM-1, soluble ICAM-1; rh, recombinant human; PE, phycoerythrin. ![]()
Received for publication June 22, 1998. Accepted for publication September 22, 1998.
| References |
|---|
|
|
|---|
-producing (Tc1) effector CD8+ T cells and interleukin (IL)-4/IL-10-producing (Th2) negative regulatory CD4+ T cells. J. Exp. Med. 183:1001.
and interferon-
in regulation of keratinocyte-derived adhesion molecules and chemotactic factors. J. Clin. Invest. 85:605.
interferon and tumor necrosis factor. J. Am. Acad. Dermatol. 20:617.[Medline]
-stimulated human keratinocytes express the genes necessary for the production of peptide-loaded MHC class II molecules. J. Invest. Dermatol. 110:138.[Medline]
and is mediated by intercellular adhesion molecule-1 (ICAM-1). J. Exp. Med. 167:1323.
, by human macrophages. J. Immunol. 160:3513.
) in allergic contact dermatitis (Rhus dermatitis). Br. J. Dermatol. 124:519.[Medline]
, IL-4, IL-10, and IL-13. J. Immunol. 154:3742.[Abstract]
induces T lymphocyte chemotaxis: a process regulated via IL-8 receptors by IFN-
, TNF-
, IL-4, IL-10, and IL-13. J. Immunol. 155:5359.[Abstract]
and TNF
in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor
B. J. Biol. Chem. 272:14899.
and interferon
synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-kB-like binding sites of the interleukin 8 gene. J. Biol. Chem. 267:22506.
B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J. Immunol. 158:3483.[Abstract]
This article has been cited by other articles:
![]() |
S. Madonna, C. Scarponi, O. De Pita, and C. Albanesi Suppressor of cytokine signaling 1 inhibits IFN-{gamma} inflammatory signaling in human keratinocytes by sustaining ERK1/2 activation FASEB J, September 1, 2008; 22(9): 3287 - 3297. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mahanonda, P. Jitprasertwong, N. Sa-Ard-Iam, P. Rerkyen, O. Charatkulangkun, P. Jansisyanont, K. Nisapakultorn, K. Yongvanichit, and S. Pichyangkul Effects of IL-17 on Human Gingival Fibroblasts J. Dent. Res., March 1, 2008; 87(3): 267 - 272. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Scriba, B. Kalsdorf, D.-A. Abrahams, F. Isaacs, J. Hofmeister, G. Black, H. Y. Hassan, R. J. Wilkinson, G. Walzl, S. J. Gelderbloem, et al. Distinct, Specific IL-17- and IL-22-Producing CD4+ T Cell Subsets Contribute to the Human Anti-Mycobacterial Immune Response J. Immunol., February 1, 2008; 180(3): 1962 - 1970. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Linden A Role for the Cytoplasmic Adaptor Protein Act1 in Mediating IL-17 Signaling Sci. Signal., August 7, 2007; 2007(398): re4 - re4. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Annunziato, L. Cosmi, V. Santarlasci, L. Maggi, F. Liotta, B. Mazzinghi, E. Parente, L. Fili, S. Ferri, F. Frosali, et al. Phenotypic and functional features of human Th17 cells J. Exp. Med., August 6, 2007; 204(8): 1849 - 1861. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Hofstetter, K. V. Toyka, M. Tary-Lehmann, and P. V. Lehmann Kinetics and Organ Distribution of IL-17-Producing CD4 Cells in Proteolipid Protein 139-151 Peptide-Induced Experimental Autoimmune Encephalomyelitis of SJL Mice J. Immunol., February 1, 2007; 178(3): 1372 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. He, L. Wu, H. K. Kim, H. Li, C. A. Elmets, and H. Xu CD8+ IL-17-Producing T Cells Are Important in Effector Functions for the Elicitation of Contact Hypersensitivity Responses J. Immunol., November 15, 2006; 177(10): 6852 - 6858. [Abstract] [Full Text] [PDF] |