The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nonaka, M.
Right arrow Articles by Fujita, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nonaka, M.
Right arrow Articles by Fujita, T.
The Journal of Immunology, 1999, 162: 387-391.
Copyright © 1999 by The American Association of Immunologists

Opsonic Complement Component C3 in the Solitary Ascidian, Halocynthia roretzi1

Masaru Nonaka2,*, Kaoru Azumi{dagger}, Xin Ji*, Chisato Namikawa-Yamada*, Makoto Sasaki*, Hidetosi Saiga{ddagger}, Alister W. Dodds§, Hideharu Sekine, Miwako K. Homma, Misao Matsushita, Yuichi Endo and Teizo Fujita

* Department of Biochemistry, Nagoya City University Medical School, Mizuho-ku, Japan; {dagger} Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Hokkaido University, Hokkaido, Japan; {ddagger} Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, Tokyo, Japan; § Medical Research Council Immunochemistry Unit, University of Oxford, Oxford, United Kingdom; and Department of Biochemistry, Fukushima Medical University School of Medicine, Fukushima, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The recent identification of two mannose-binding lectin-associated serine protease clones from Halocynthia roretzi, an ascidian, suggested the presence of a complement system in urochordates. To elucidate the structure and function of this possibly primitive complement system, we have isolated cDNA clones for ascidian C3 (AsC3) and purified AsC3 protein from body fluid. The deduced primary structure of AsC3 shows overall similarity to mammalian C3, including a typical thioester site with the His residue required for nucleophilic activation of the thioester. AsC3 has a two-subunit chain structure, and the {alpha}-chain is cleaved at a specific site near to the N terminus upon activation. Ascidian body fluid contains an opsonic activity which enhances phagocytosis of yeast by ascidian blood cells, and Ab against AsC3 inhibits this opsonic activity. These results indicate that the complement system played a pivotal role in innate immunity by enhancing phagocytosis before the emergence of the vertebrates and well ahead of the establishment of adaptive immunity, which is believed to have occurred at about the time of the appearance of cartilaginous fish.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Accumulating evidence indicates that acquired immunity became established at an early stage in vertebrate evolution, after the appearance of the cyclostomes but before the divergence of cartilaginous and bony fish, through genome-wide duplication events (1). Thus, the genes encoding several pivotal molecules involved in adaptive immunity, such as Ig (2), TCR (3), MHC class I (4) and MHC class II (5, 6), and recombination activating gene (7), are all found in cartilaginous fish, although attempts to identify cyclostome counterparts of these genes have so far failed. However, innate immune mechanisms successfully defend invertebrates against microbial infections. The molecular architecture of invertebrate innate immune systems and their possible connection to vertebrate innate immunity has not been fully elucidated. The recent identification of sea urchin C3 (SuC3)3 (8, 9) and ascidian mannose-binding lectin-associated serine protease (MASP) (10) cDNA clones suggests an ancient origin for the complement system. However, the function and multicomponent nature of invertebrate complement systems have still to be clarified.

Subphylum urochordata, to which ascidians belong, together with two other subphyla, vertebrata and cephalochordata, constitutes phylum chordata (11). Although the phylogenetic relationship between these three subphyla remains to be determined, ascidians provide us with a unique opportunity to search for ancestral characters of vertebrates that had been established before their divergence from the urochordates. We have previously isolated two different ascidian cDNA clones encoding MASP, and named them AsMASPa and AsMASPb (10). MASPs are key enzymes of one of the three activation pathways of the mammalian complement system, named the lectin pathway (12, 13, 14, 15). Activation of the lectin pathway is initiated by the binding of mannose-binding lectin to mannose or N-acetylglucosamine structures on the surfaces of pathogens, followed by the activation of the MASPs. Activation of the MASPs leads to proteolytic activation of C4 and C2, which form a C3 convertase. To a lesser extent, MASP can also activate C3 (16, 17). The identification of MASP in an ascidian suggests the presence of the complement lectin pathway in nonvertebrates. Here, we report the structural and functional analyses of ascidian C3 (AsC3), the central component of the vertebrate complement system.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Materials

Solitary ascidians, Halocynthia roretzi, were harvested in Mutsu Bay, Japan. Blood cells were obtained, as described previously (18), by centrifugation from hemolymph, which was collected by cutting the tunic matrix without injuring the internal organs. The hepatopancreas was removed from dissected ascidians immediately before use. Restriction enzymes were purchased from Toyobo (Osaka, Japan) and New England Biolabs (Beverly, MA). The ligation kit was from Takara (Kyoto, Japan). [{alpha}-32P]dCTP, [14C]methylamine hydrochloride, the Rediprime Random Primer labeling kit, and cDNA Synthesis Systems Plus were from Amersham (Tokyo, Japan). {lambda} Zap II and Gigapack Gold were from Stratagene (La Jolla, CA). DNA Sequencing System 373A Analysis Software Version 1.01 and the Prism Dye Terminator Cycle Sequencing kit were from Applied Biosystems (Tokyo, Japan). The EcoRI adapter was from Promega (Madison, WI). The TA cloning kit was from Invitrogen (San Diego, CA). (p-aminophenyl)methanesulfonylfluoride (p-APMSF), p-nitrophenyl-p-guanidinobenzoate, and Pefabloc were from Wako Pure Chemicals (Osaka, Japan), Merck (Darmstadt, Germany), and Pentepharm AG (Basel, Switzerland), respectively.

RNA extraction and cDNA library construction

RNA was isolated from blood cells and hepatopancreas using guanidine thiocyanate (19), and poly(A)+ RNA was selected on an oligo(dT)-cellulose column (20). Construction of an ascidian hepatopancreas cDNA library was as previously described (21).

RT-PCR amplification of candidate mRNA segments for AsC3

Degenerate PCR primers were the same as those used for the amplification of lamprey C3 (22). First strand cDNA synthesized from ascidian blood cell mRNA with Moloney murine leukemia virus reverse transcriptase (Life Technologies, Rockville, MD) was used as PCR templates. Thirty cycles of amplification were conducted in a PE Applied Biosystems GeneAmp PCR System 2400 (Urayasu, Japan) using the following parameters: 95°C for 0.5 min, 45°C for 1 min, and 72°C for 1 min (23). PCR products of the expected size (220 bp) were gel-purified and ligated into the pCRII vector (Invitrogen).

5'-Rapid amplification of cDNA ends (RACE)

Two cycles of 5'-RACE were performed using the Life Technologies 5'-RACE system Version 2.0, following the manufacturer’s instructions. For the first cycle, gene specific primer 1 (GSP1) and GSP2 were ATTGCCTCTCCAAAAGGTGA and AACAGGTTCACCATAACTGT, complementary to two nucleotide sequences at the 5'-terminal region of the clone 3 (see below) insert. For the second cycle, GSP1 and GSP2 were GAATACATAGCCATGTGTGG and GCTTTTGGGCACGTAAGTGA, respectively, complementary to two nucleotide sequences at the middle of the first 5'-RACE product.

Nucleotide sequence analysis

DNA sequence analysis was performed by the dideoxy chain termination method (24) using an Applied Biosystems 373A DNA sequencer. Each sequence was determined at least twice from both strands.

Northern and Southern blotting analyses

Total RNA from ascidian blood cells and hepatopancreas was denatured by glyoxal, separated on a 1% agarose gel and blotted onto a nylon membrane (Hybond-N, Amersham) (25). Hybridization with radiolabeled probes prepared using the Rediprime kit (Amersham) was performed in 10x Denhardt’s solution, 1 M sodium chloride, 50 mM Tris, 10 mM EDTA, 0.1% SDS, and 0.1 mg/ml denatured salmon sperm DNA at 65°C for 16–20 h. Membranes were washed twice for 30 min at 65°C in 0.1x SSC and 0.1% SDS. High m.w. DNA was isolated from adult mantle using Proteinase K (26). DNA was digested with EcoRI, HindIII, or BamHI, separated, blotted, and hybridized as described for Northern blotting.

Purification and characterization of AsC3

For C3 purification, body fluid was collected in the presence of protease inhibitors, 10 mM 6-amino-n-capronic acid, 10 mM benzamidine, 100 µM p-APMSF, 100 µM Pefabloc, and 20 µM p-nitrophenyl-p-guanidinobenzoate, together with 10 mM EDTA. A 7–14% PEG 4000 cut was loaded onto DEAE Toyopearl 650S in 25 mM Tris-HCl buffer (pH 7.8) containing 25 mM NaCl, 5 mM EDTA, 5 mM 6-amino-n-capronic acid, 2 mM benzamidine, 100 µM p-APMSF, and 100 µM Pefabloc and eluted with a linear NaCl gradient to 0.5 M. C3-containing fractions were monitored by [14C]methylamine incorporation (27) because the {alpha}-chain of C3 was the only band that incorporated methylamine. The C3 was concentrated and gel filtered on Asahi Pack 520P in PBS containing 2 mM benzamidine, 100 µM p-APMSF, and 100 µM Pefabloc, followed by Mono Q using the same buffers described for DEAE Toyopearl 650S. Monospecific antiserum to AsC3 was raised by immunizing rabbits with purified proteins in CFA; IgG was isolated on protein A-Sepharose and was dialyzed against PBS. This Ab recognized a single band by Western blotting of ascidian body fluid under nonreducing conditions. To determine the amino acid sequences of the N termini of the {alpha}-, {alpha}'-, and ß-chains of C3, the proteins were run on SDS-PAGE and transferred to poly(vinylidene difluoride) membrane. Coomassie brilliant blue-stained bands were cut out and sequenced on a gas phase protein sequencer (Applied Biosystems).

Phagocytosis assay

Fresh body fluid was used in all assays. The C3-depleted reagent was prepared by treating body fluid with excess anti-AsC3 IgG. PBS, EDTA, and rabbit normal IgG treated body fluid were used as controls. Samples and controls were treated with protein A-Sepharose to remove Ig and Ag-Ab complexes. Each body fluid sample (500 µl) was incubated with 1 x 107 yeast (W303D) at 20°C for 30 min, and, after washing, the yeast was divided into two portions for analysis of phagocytosis and flow cytometry. The treated yeast (2 x 106) was mixed with the ascidian hemocytes (4 x 105), prepared as described previously (18), and incubated at 20°C for 30 min. Hemocytes that ingested one or more yeast cells were counted positive. The degree of phagocytosis was expressed as the ratio of the number of positive hemocytes to that of total hemocytes. Binding of AsC3 to yeast was analyzed by flow cytometry. The treated yeast (5 x 106) was washed once with gelatin veronal buffer containing 10 mM EDTA (EDTA-GVB) and incubated with 5 µl of anti-AsC3 Ab (1 mg/ml) at 4°C for 30 min. The yeast was then stained with 20 µl of 100 µg/ml FITC-conjugated goat anti-rabbit Igs at 4°C for 30 min and analyzed by FACScan flow cytometry. The yeast was washed three times between each reaction with EDTA-GVB.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
The elucidation of the entire protein sequence of AsC3 was performed by amplifying a part of AsC3 cDNA by RT-PCR of ascidian hepatopancreas mRNA, cDNA library screening, and 5'-RACE analysis. RT-PCR amplification of the ascidian hepatopancreas mRNA using primers corresponding to the two highly conserved amino acid sequences at the thioester site and ~60 amino acid residues C terminal in C3, C4, and {alpha}2-macroglobulin ({alpha}2M) (22) resulted in a single DNA band of the expected size (about 220 bp). The DNA was gel purified and subcloned into the plasmid using the TA cloning kit. Nucleotide sequence analysis indicated that there were three different clones, two different clones showing a closer similarity to mammalian {alpha}2M, and one clone with a closer similarity to mammalian C3. Amino acid sequences deduced from two {alpha}2M-like clones showed 50% and 42% identities to human {alpha}2M, whereas their identities to human C3 were 24% and 21%. In contrast, the C3-like clone showed 16% and 28% amino acid identities to human {alpha}2M and C3, respectively. Screening of the ascidian hepatopancreas cDNA library with about 5 x 105 independent clones (10) using the C3-like cDNA as a probe resulted in the isolation of 16 clones. The complete nucleotide sequence of clone 3, which contained the longest insert of ~5 kb, was determined, and one long open reading frame was identified. Comparison of the deduced N-terminal sequence of this clone with vertebrate C3 sequences indicated that ~200 amino acid residues at the N terminus of ß-chain were not covered. Thus, 5'-RACE of hepatopancreas RNA was performed using the 5'-RACE system (Life Technologies). A band of ~900 bp was identified. However, the size of AsC3 mRNA was estimated to be ~7 kb by Northern blotting analysis (see below), suggesting that a 1-kb or larger region remained to be cloned. Thus, the second cycle of 5'-RACE was performed to isolate a possible further 5' sequence. The putative initiation codon, preceded by an in-frame stop codon, was identified in the first 5'-RACE product. The entire amino acid sequence of AsC3 and the corresponding nucleotide sequence were composed from the cDNA clone and the 5'-RACE products (data not shown). The composition of preproAsC3, predicted from a comparison with the vertebrate C3 sequences and amino acid sequence analysis of the subunit chains of AsC3, is from the N terminus: a 21-amino acid (aa) leader sequence, a 653-aa ß-chain, a 4-aa ß-{alpha} processing site, and a 1062-aa {alpha}-chain. A typical thioester site, CGEQ, was found at positions 1013–1016, and a catalytic H residue (28) was recognized at position 1130. The entire amino acid sequence of preproAsC3 was aligned with that of C3 from various vertebrate species and the mammalian C4, C5, and {alpha}2M sequences using Clustal W software. A part of this alignment including only the AsC3 sequence and the human sequences is shown in Fig. 1Go. The AsC3 amino acid sequence showed 22.4, 19.2, 20.0, and 15.2% identity with human C3, C4, C5, and {alpha}2M, respectively. Amino acid sequence analysis of the N terminus of the {alpha}'-chain suggested that a 78-aa peptide AsC3a is cleaved from the N terminus of the {alpha}-chain upon activation (see below). The equivalent peptides from vertebrate complement components are anaphylatoxins and have important inflammatory roles. The AsC3a sequence is atypical in that 1) it has only four cystein residues whereas all vertebrate C3a, C4a, and C5a have six conserved cystein residues, and 2) the C terminus is VSR while all vertebrate C3a, C4a, and C5a have LXR. Sea urchin C3 has six cystein residues in this region, but only two of them occur at the same position as vertebrate C3a, C4a, and C5a (9). In addition, the C terminus of the putative SuC3a sequence is TSR. Thus, it is doubtful that invertebrate C3a binds to receptors similar to the vertebrate C3a receptor.



View larger version (122K):
[in this window]
[in a new window]
 
FIGURE 1. Amino acid sequence alignment of AsC3 with human (Hu) C3 (SwissProt accession number P01024), C4 (P01028), C5 (P01031), and {alpha}2M (P01023). The entire amino acid sequences of these proteins were aligned using the Clustal W software. The amino acid numbers of the rightmost residues of AsC3 are shown for each lane. Asterisks below the sequences indicate the positions where all of the compared sequences share a single amino acid residue. Dashes represent gaps inserted into the alignment. The # symbols at 675–678 indicate the ß/{alpha}-chain processing site except for Hu {alpha}2M, and the # symbols around 1410 are {alpha}/{gamma}-chain processing site of HuC4. The $ symbol at 1013 and 1016 and the downward arrow at 1131 mark the residues that form and determine the reactivity of thioester, respectively. Underlines indicate peptide sequences determined at the N termini of the ß-, {alpha}-, and {alpha}'-chains.

 
Based on the alignment, a phylogenetic tree of these proteins was constructed using the neighbor-joining method (Fig. 2Go). When human {alpha}2M was used as an outgroup, AsC3 and SuC3 are predicted to have diverged first from all other C3, C4, and C5 sequences, indicating that the gene duplications which led to C3, C4, and C5 occurred in the vertebrate lineage after their divergence from the urochordates. Since AsC3 and SuC3 have the basic characteristics of vertebrate C3, such as an {alpha}-ß subunit chain structure and a His-catalyzed thioester, it is concluded that the common ancestor of vertebrate C3, C4, and C5 was a C3-like molecule.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Phylogenetic tree of AsC3 and related proteins. The tree was constructed by the neighbor-joining method based on the alignment of amino acid sequences using Clustal W. Numbers indicate the percentage of bootstraps that support the partitioning shown. Abbreviation and SwissProt or GenBank accession numbers for each sequences are: Hu{alpha}2M, human {alpha}2-macroglobulin (P01023); HuC3, human C3 (P01024); MoC3, mouse C3 (P01027); ChC3, chicken C3 (U16848); CoC3, cobra C3 (L02365); XeC3, Xenopus C3 (U19253); RtC3, rainbow trout C3 (L24433); LaC3, lamprey C3 (D10087); HaC3, hagfish C3 (Z11595); SuC3, sea urchin C3 (AF025526); HuC4, human C4 (P01028); MoC4, mouse C4 (p01029); HuC5, human C5 (P01031); and MoC5, mouse C5 (P06684).

 
AsC3 mRNA is mainly expressed in hepatopancreas as an ~7-kb message, and a faint and longer band was detected from blood cells (Fig. 3GoA). A single band was detected upon genomic Southern hybridization analysis using EcoRI, HindIII, or BamHI, suggesting that AsC3 is encoded by a single copy gene (Fig. 3GoB).



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 3. Northern and Southern blot analyses of AsC3. A, Five micrograms of hepatopancreas (lane H) and blood cell (lane B) RNA were denatured with glyoxal, separated on a 1% agarose gel, and transferred to nylon membrane. B, Two micrograms of genomic DNA isolated from adult mantle were digested with EcoRI (lane 1), HindIII (lane 2), or BamHI (lane 3), separated on an agarose gel, and transferred to nylon membrane. The hybridization probe for both Northern and Southern hybridization was a 567 bp HincII fragment (residues 1458–2024) of clone 3.

 
Next, we isolated the AsC3 protein from body fluid, monitoring purification using [14C]methylamine incorporation into the thioester in the {alpha}-chain (27). As shown in Fig. 4Go, the purified C3 is composed of two polypeptide chains, {alpha} (130 kDa) and ß (85 kDa), and [14C]methylamine was incorporated into the {alpha}-chain. These observed sizes are significantly larger than the sizes deduced from the cDNA sequence (120 kDa and 73 kDa, respectively), suggesting that both chains are glycosylated during posttranslational processing. The N-terminal amino acid sequences of the two chains were determined and shown to be identical to those deduced by cDNA sequencing (Fig. 1Go, underlined). During the purification of C3 from ascidian body fluid, a small proportion of the {alpha}-chain was cleaved into a smaller-sized chain similar to the mammalian {alpha}'-chain. The determined N-terminal amino acid sequence of the AsC3 {alpha}'-chain is also shown by the underline in Fig. 1Go. Its N-terminal amino acid sequence indicates that proteolytic activation had occurred on the C-terminal side of the Arg residue, which is predicted as the C terminus of the C3a fragment from the Clustal W alignment (Fig. 1Go). Although the activating protease is still to be clarified, two ascidian MASPs, AsMASPa and AsMASPb, identified by cDNA cloning (10) are obvious candidate. However, AsMASPa is a more probable candidate responsible for C3 activation because a trypsin-like specificity is predicted to be absent from AsMASPb (10).



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 4. SDS-PAGE analysis of purified AsC3. Ascidian (lane 1) and human (lane 2) C3 were analyzed by SDS-PAGE under reducing conditions and stained with Coomassie brilliant blue. The same materials (lanes 3 and 4; ascidian and human C3, respectively) were incubated with [14C]methylamine and analyzed by SDS-PAGE, followed by radioautography.

 
To clarify the role of the complement system in ascidians, we performed phagocytosis assays (18). In controls, 20–30% of blood cells (hemocytes) from Halocynthia roretzi ingested at least one untreated yeast cell. When the yeast was preincubated with ascidian body fluid, 40–60% of the hemocytes ingested one or more yeast cells, indicating that the ascidian body fluid contains a factor which binds to yeast and enhances phagocytosis (Fig. 5GoA). The opsonic activity was completely abolished when body fluid depleted of C3 by anti-AsC3 IgG was tested. We also found that the effect disappeared when divalent cations were removed by the addition of EDTA. To confirm these results, C3 binding was analyzed by flow cytometry (Fig. 5GoB). The removal of either C3 or divalent cations from the body fluid abolished the binding of C3 to the yeast. Thus, it was concluded that the opsonic component is C3 and that divalent cations are required for C3 activation.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 5. The binding of AsC3 to yeast and phagocytosis by ascidian hemocytes. Yeast was incubated with buffer alone, or with fresh ascidian body fluid that had been treated with PBS, EDTA, rabbit IgG, or rabbit anti-C3 IgG, followed by protein A-Sepharose treatment. A, The untreated and treated yeast were analyzed by phagocytosis by ascidian hemocytes. The degree of phagocytosis against yeast alone was defined as 100%. Bars are mean ± SD (n = 3). B, Flow cytometry was used to show the degree of C3 binding to the yeast detected by anti-AsC3 IgG.

 
The mammalian complement components are encoded by several sets of genes believed to have been generated by gene duplication. Thus, C3/C4/C5, B/C2, and C1r/C1s/MASP-1/MASP-2 are examples of gene duplication products involved in the three activation pathways. Although it is still not clear when these gene duplications occurred, one possibility is that they happened at an early stage of vertebrate evolution when the genome-wide duplication occurred (1). Upon phylogenetic tree analysis, cyclostome C3 (22, 29) and B (30), ascidian MASP (10) and C3 (this report), and SuC3 (8, 9) show a branching pattern that supports the idea that these gene duplications occurred in the vertebrate lineage after the divergence of the cyclostomes. If this is the actual case, the increase in complexity of the complement system coincided with the appearance of adaptive immunity. Thus, the original complement system should be considered as a constituent of innate immunity, and its activation mechanism is of much interest.


    Footnotes
 
1 This work was supported in part by a Grants-in-Aid from the Ministry of Education (M.N. and X.J.). The nucleotide sequence data of AsC3 will appear in the DDBJ, EMBL, and GenBank nucleotide sequence databases under the accession number AB006964. Back

2 Address correspondence and reprint requests to Dr. Masaru Nonaka, Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan. E-mail address: Back

3 Abbreviations used in this paper: SuC3, sea urchin C3; MASP, mannose-binding lectin-associated serine protease; AsC3, ascidian C3; p-APMSF, (p-aminophenyl)-methanesulfonylfluoride; RACE, rapid amplification of cDNA ends; GSP, gene specific primer; {alpha}2M, {alpha}2-macroglobulin; aa, amino acid. Back

Received for publication June 25, 1998. Accepted for publication September 21, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Kasahara, M., J. Nakaya, Y. Satta, N. Takahata. 1997. Chromosomal duplication and the emergence of the adaptive immune system. Trends Genet. 13:90.[Medline]
  2. Litman, G. W., J. P. Last, M. J. Shamblott, R. N. Haire, M. Hulst, W. Roess, R. T. Litman, K. R. Hinds-Frey, A. Zilch, C. T. Amemiya. 1993. Phylogenetic diversification of immunoglobulin genes and the antibody repertoire. Mol. Biol. Evol. 10:60.[Abstract]
  3. Rast, J. P., G. W. Litman. 1994. T-cell receptor gene homologs are present in the most primitive jawed vertebrates. Proc. Natl. Acad. Sci. USA 91:9248.[Abstract/Free Full Text]
  4. Hashimoto, K., T. Nakanishi, Y. Kurosawa. 1992. Identification of a shark sequence resembling the major histocompatibility complex class I {alpha}3 domain. Proc. Natl. Acad. Sci. USA 89:2209.[Abstract/Free Full Text]
  5. Kasahara, M., M. Vazquez, K. Sato, E. C. McKinney, M. F. Flajnik. 1992. Evolution of the major histocompatibility complex: isolation of class II A cDNA clones from the cartilaginous fish. Proc. Natl. Acad. Sci. USA 89:6688.[Abstract/Free Full Text]
  6. Bartl, S., I. L. Weissman. 1994. Isolation and characterization of major histocompatibility complex class IIB genes from nurse shark. Proc. Natl. Acad. Sci. USA 91:262.[Abstract/Free Full Text]
  7. Greenhalgh, P, L. A. Steiner. 1995. Recombination activating gene 1 (Rag1) in zebrafish and shark. Immunogenetics 41:54.[Medline]
  8. Smith, L. C., L. Chang, R. J. Britten, E. H. Davidson. 1996. Sea urchin genes expressed in activated coelomocytes are identified by expressed sequence tags: complement homologues and other putative immune response genes suggest immune system homology within the deuterostomes. J. Immunol. 156:539.[Abstract]
  9. Al-Sharif, W. Z., J. O. Sunyer, J. D. Lambris, L. C. Smith.. 1998. Sea urchin coelomocytes specifically express a homologue of the complement component C3. J. Immunol. 160:2983.[Abstract/Free Full Text]
  10. Ji, X, K. Azumi, M. Sasaki, M. Nonaka. 1997. Ancient origin of the complement lectin pathway revealed by molecular cloning of mannan binding protein-associated serine protease from a urochordate, the Japanese ascidian, Halocynthia roretzi. Proc. Natl. Acad. Sci. USA 94:6340.[Abstract/Free Full Text]
  11. Satoh, N., W. R. Jeffery. 1995. Chasing tails in ascidians: developmental insights into the origin and evolution of chordates. Trends Genet. 11:354.[Medline]
  12. Matsushita, M., T. Fujita. 1992. Activation of the classical complement pathway by mannose-binding protein in association with a novel C1s-like serine protease. J. Exp. Med. 176:1497.[Abstract/Free Full Text]
  13. Ji, Y. H., T. Fujita, H. Hatsuse, A. Takahashi, M. Matsushita, M. Kawakami. 1993. Activation of the C4 and C2 components of complement by a proteinase in serum bactericidal factor, Ra reactive factor. J. Immunol. 150:571.[Abstract]
  14. Thiel, S., T. Vorup-Jensen, C. M. Stover, W. Schwaeble, S. B. Laursen, K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, U. Holmskov, K. B. Reid, J. C. Jensenius. 1997. A second serine protease associated with mannan-binding lectin that activates complement. Nature 386:506.[Medline]
  15. Sato, T., Y. Endo, M. Matsushita, T. Fujita. 1994. Molecular characterization of a novel serine protease involved in activation of the complement system by mannose-binding protein. Int. Immunol. 6:665.[Abstract/Free Full Text]
  16. Matsushita, M., T. Fujita. 1995. Cleavage of the third component of complement (C3) by mannose-binding protein-associated serine protease (MASP) with subsequent activation. Immunobiology 194:443.[Medline]
  17. Ogata, R. T., P. J. Low, M. Kawakami. 1995. Substrate specificities of the protease of mouse serum Ra-reactive factor. J. Immunol. 154:2351.[Abstract]
  18. Azumi, K., N. Satoh, H. Yokosawa. 1993. Functional and structural characterization of hemocytes of the solitary ascidian, Halocynthia roretzi. J. Exp. Zool. 265:309.
  19. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294.[Medline]
  20. Aviv, H., P. Leder. 1972. Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69:1408.[Abstract/Free Full Text]
  21. Kato, Y., L. Salter-Cid, M. F. Flajnik, M. Kasahara, C. Namikawa, M. Sasaki, M. Nonaka. 1994. Isolation of the Xenopus complement factor B complementary DNA and linkage of the gene to the frog MHC. J. Immunol. 153:4546.[Abstract]
  22. Nonaka, M., M. Takahashi. 1992. Complete complementary DNA sequence of the third component of complement of lamprey: implication for the evolution of thioester containing proteins. J. Immunol. 148:3290.[Abstract]
  23. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487.[Abstract/Free Full Text]
  24. Sanger, F., S. Nicklen, A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463.[Abstract/Free Full Text]
  25. Thomas, P. S.. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201.[Abstract/Free Full Text]
  26. Blin, N, D. Stafford. 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3:2303.
  27. Auerbach, H. S., R. Burger, A. W. Dodds, H. R. Colten. 1990. Molecular basis of complement C3 deficiency in guinea pigs. J. Clin. Invest. 86:96.
  28. Dodds, A. W., X. D. Ren, A. C. Willis, S. K. Law. 1996. The reaction mechanism of the internal thioester in the human complement component C4. Nature 379:177.[Medline]
  29. Ishiguro, H., K. Kobayashi, M. Suzuki, K. Titani, S. Tomonaga, Y. Kurosawa. 1992. Isolation of a hagfish gene that encodes a complement component. EMBO J. 11:829.[Medline]
  30. Nonaka, M., M. Takahashi, M. Sasaki. 1994. Molecular cloning of a lamprey homologue of the mammalian MHC class III gene, complement factor B. J. Immunol. 152:2263.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Nakao, T. Kajiya, Y. Sato, T. Somamoto, Y. Kato-Unoki, M. Matsushita, M. Nakata, T. Fujita, and T. Yano
Lectin Pathway of Bony Fish Complement: Identification of Two Homologs of the Mannose-Binding Lectin Associated with MASP2 in the Common Carp (Cyprinus carpio)
J. Immunol., October 15, 2006; 177(8): 5471 - 5479.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Melillo, G. Sfyroera, R. De Santis, R. Graziano, R. Marino, J. D. Lambris, and M. R. Pinto
First Identification of a Chemotactic Receptor in an Invertebrate Species: Structural and Functional Characterization of Ciona intestinalis C3a Receptor
J. Immunol., September 15, 2006; 177(6): 4132 - 4140.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Takahashi, D. Iwaki, A. Matsushita, M. Nakata, M. Matsushita, Y. Endo, and T. Fujita
Cloning and characterization of mannose-binding lectin from lamprey (agnathans).
J. Immunol., April 15, 2006; 176(8): 4861 - 4868.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Matsushita, A. Matsushita, Y. Endo, M. Nakata, N. Kojima, T. Mizuochi, and T. Fujita
Origin of the classical complement pathway: Lamprey orthologue of mammalian C1q acts as a lectin
PNAS, July 6, 2004; 101(27): 10127 - 10131.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
L. A. Clow, D. A. Raftos, P. S. Gross, and L. C. Smith
The sea urchin complement homologue, SpC3, functions as an opsonin
J. Exp. Biol., May 15, 2004; 207(12): 2147 - 2155.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Pinto, C. M. Chinnici, Y. Kimura, D. Melillo, R. Marino, L. A. Spruce, R. De Santis, N. Parrinello, and J. D. Lambris
CiC3-1a-Mediated Chemotaxis in the Deuterostome Invertebrate Ciona intestinalis (Urochordata)
J. Immunol., November 15, 2003; 171(10): 5521 - 5528.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
S. Bartl, M. Baish, I. L. Weissman, and M. Diaz
Did the Molecules of Adaptive Immunity Evolve from the Innate Immune System?
Integr. Comp. Biol., April 1, 2003; 43(2): 338 - 346.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Sekine, A. Kenjo, K. Azumi, G. Ohi, M. Takahashi, R. Kasukawa, N. Ichikawa, M. Nakata, T. Mizuochi, M. Matsushita, et al.
An Ancient Lectin-Dependent Complement System in an Ascidian: Novel Lectin Isolated from the Plasma of the Solitary Ascidian, Halocynthia roretzi
J. Immunol., October 15, 2001; 167(8): 4504 - 4510.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Miyazawa, K. Azumi, and M. Nonaka
Cloning and Characterization of Integrin {{alpha}} Subunits from the Solitary Ascidian, Halocynthia roretzi
J. Immunol., February 1, 2001; 166(3): 1710 - 1715.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Lagueux, E. Perrodou, E. A. Levashina, M. Capovilla, and J. A. Hoffmann
Constitutive expression of a complement-like protein in Toll and JAK gain-of-function mutants of Drosophila
PNAS, October 10, 2000; 97(21): 11427 - 11432.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Matsushita, S. Thiel, J. C. Jensenius, I. Terai, and T. Fujita
Proteolytic Activities of Two Types of Mannose-Binding Lectin-Associated Serine Protease
J. Immunol., September 1, 2000; 165(5): 2637 - 2642.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kenjo, M. Takahashi, M. Matsushita, Y. Endo, M. Nakata, T. Mizuochi, and T. Fujita
Cloning and Characterization of Novel Ficolins from the Solitary Ascidian, Halocynthia roretzi
J. Biol. Chem., June 1, 2001; 276(23): 19959 - 19965.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nonaka, M.
Right arrow Articles by Fujita, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nonaka, M.
Right arrow Articles by Fujita, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS