|
|
||||||||


*
Department of Biochemistry, Nagoya City University Medical School, Mizuho-ku, Japan;
Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Hokkaido University, Hokkaido, Japan;
Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, Tokyo, Japan;
§
Medical Research Council Immunochemistry Unit, University of Oxford, Oxford, United Kingdom; and
¶
Department of Biochemistry, Fukushima Medical University School of Medicine, Fukushima, Japan
| Abstract |
|---|
|
|
|---|
-chain is cleaved at a specific site near to the
N terminus upon activation. Ascidian body fluid contains an opsonic
activity which enhances phagocytosis of yeast by ascidian blood cells,
and Ab against AsC3 inhibits this opsonic activity. These results
indicate that the complement system played a pivotal role in innate
immunity by enhancing phagocytosis before the emergence of the
vertebrates and well ahead of the establishment of adaptive immunity,
which is believed to have occurred at about the time of the appearance
of cartilaginous fish. | Introduction |
|---|
|
|
|---|
Subphylum urochordata, to which ascidians belong, together with two other subphyla, vertebrata and cephalochordata, constitutes phylum chordata (11). Although the phylogenetic relationship between these three subphyla remains to be determined, ascidians provide us with a unique opportunity to search for ancestral characters of vertebrates that had been established before their divergence from the urochordates. We have previously isolated two different ascidian cDNA clones encoding MASP, and named them AsMASPa and AsMASPb (10). MASPs are key enzymes of one of the three activation pathways of the mammalian complement system, named the lectin pathway (12, 13, 14, 15). Activation of the lectin pathway is initiated by the binding of mannose-binding lectin to mannose or N-acetylglucosamine structures on the surfaces of pathogens, followed by the activation of the MASPs. Activation of the MASPs leads to proteolytic activation of C4 and C2, which form a C3 convertase. To a lesser extent, MASP can also activate C3 (16, 17). The identification of MASP in an ascidian suggests the presence of the complement lectin pathway in nonvertebrates. Here, we report the structural and functional analyses of ascidian C3 (AsC3), the central component of the vertebrate complement system.
| Materials and Methods |
|---|
|
|
|---|
Solitary ascidians, Halocynthia roretzi, were
harvested in Mutsu Bay, Japan. Blood cells were obtained, as described
previously (18), by centrifugation from hemolymph, which was
collected by cutting the tunic matrix without injuring the internal
organs. The hepatopancreas was removed from dissected ascidians
immediately before use. Restriction enzymes were purchased from Toyobo
(Osaka, Japan) and New England Biolabs (Beverly, MA). The ligation kit
was from Takara (Kyoto, Japan). [
-32P]dCTP,
[14C]methylamine hydrochloride, the Rediprime Random
Primer labeling kit, and cDNA Synthesis Systems Plus were from Amersham
(Tokyo, Japan).
Zap II and Gigapack Gold were from Stratagene (La
Jolla, CA). DNA Sequencing System 373A Analysis Software Version 1.01
and the Prism Dye Terminator Cycle Sequencing kit were from Applied
Biosystems (Tokyo, Japan). The EcoRI adapter was from
Promega (Madison, WI). The TA cloning kit was from Invitrogen (San
Diego, CA).
(p-aminophenyl)methanesulfonylfluoride
(p-APMSF),
p-nitrophenyl-p-guanidinobenzoate, and Pefabloc
were from Wako Pure Chemicals (Osaka, Japan), Merck (Darmstadt,
Germany), and Pentepharm AG (Basel, Switzerland), respectively.
RNA extraction and cDNA library construction
RNA was isolated from blood cells and hepatopancreas using guanidine thiocyanate (19), and poly(A)+ RNA was selected on an oligo(dT)-cellulose column (20). Construction of an ascidian hepatopancreas cDNA library was as previously described (21).
RT-PCR amplification of candidate mRNA segments for AsC3
Degenerate PCR primers were the same as those used for the amplification of lamprey C3 (22). First strand cDNA synthesized from ascidian blood cell mRNA with Moloney murine leukemia virus reverse transcriptase (Life Technologies, Rockville, MD) was used as PCR templates. Thirty cycles of amplification were conducted in a PE Applied Biosystems GeneAmp PCR System 2400 (Urayasu, Japan) using the following parameters: 95°C for 0.5 min, 45°C for 1 min, and 72°C for 1 min (23). PCR products of the expected size (220 bp) were gel-purified and ligated into the pCRII vector (Invitrogen).
5'-Rapid amplification of cDNA ends (RACE)
Two cycles of 5'-RACE were performed using the Life Technologies 5'-RACE system Version 2.0, following the manufacturers instructions. For the first cycle, gene specific primer 1 (GSP1) and GSP2 were ATTGCCTCTCCAAAAGGTGA and AACAGGTTCACCATAACTGT, complementary to two nucleotide sequences at the 5'-terminal region of the clone 3 (see below) insert. For the second cycle, GSP1 and GSP2 were GAATACATAGCCATGTGTGG and GCTTTTGGGCACGTAAGTGA, respectively, complementary to two nucleotide sequences at the middle of the first 5'-RACE product.
Nucleotide sequence analysis
DNA sequence analysis was performed by the dideoxy chain termination method (24) using an Applied Biosystems 373A DNA sequencer. Each sequence was determined at least twice from both strands.
Northern and Southern blotting analyses
Total RNA from ascidian blood cells and hepatopancreas was denatured by glyoxal, separated on a 1% agarose gel and blotted onto a nylon membrane (Hybond-N, Amersham) (25). Hybridization with radiolabeled probes prepared using the Rediprime kit (Amersham) was performed in 10x Denhardts solution, 1 M sodium chloride, 50 mM Tris, 10 mM EDTA, 0.1% SDS, and 0.1 mg/ml denatured salmon sperm DNA at 65°C for 1620 h. Membranes were washed twice for 30 min at 65°C in 0.1x SSC and 0.1% SDS. High m.w. DNA was isolated from adult mantle using Proteinase K (26). DNA was digested with EcoRI, HindIII, or BamHI, separated, blotted, and hybridized as described for Northern blotting.
Purification and characterization of AsC3
For C3 purification, body fluid was collected in the presence of
protease inhibitors, 10 mM 6-amino-n-capronic acid, 10 mM
benzamidine, 100 µM p-APMSF, 100 µM Pefabloc, and 20
µM p-nitrophenyl-p-guanidinobenzoate, together
with 10 mM EDTA. A 714% PEG 4000 cut was loaded onto DEAE Toyopearl
650S in 25 mM Tris-HCl buffer (pH 7.8) containing 25 mM NaCl, 5 mM
EDTA, 5 mM 6-amino-n-capronic acid, 2 mM benzamidine, 100
µM p-APMSF, and 100 µM Pefabloc and eluted with a linear
NaCl gradient to 0.5 M. C3-containing fractions were monitored by
[14C]methylamine incorporation (27) because the
-chain
of C3 was the only band that incorporated methylamine. The C3 was
concentrated and gel filtered on Asahi Pack 520P in PBS
containing 2 mM benzamidine, 100 µM p-APMSF, and 100 µM
Pefabloc, followed by Mono Q using the same buffers described for DEAE
Toyopearl 650S. Monospecific antiserum to AsC3 was raised by immunizing
rabbits with purified proteins in CFA; IgG was isolated on protein
A-Sepharose and was dialyzed against PBS. This Ab recognized a single
band by Western blotting of ascidian body fluid under nonreducing
conditions. To determine the amino acid sequences of the N termini of
the
-,
'-, and ß-chains of C3, the proteins were run on
SDS-PAGE and transferred to poly(vinylidene difluoride) membrane.
Coomassie brilliant blue-stained bands were cut out and sequenced on a
gas phase protein sequencer (Applied Biosystems).
Phagocytosis assay
Fresh body fluid was used in all assays. The C3-depleted reagent was prepared by treating body fluid with excess anti-AsC3 IgG. PBS, EDTA, and rabbit normal IgG treated body fluid were used as controls. Samples and controls were treated with protein A-Sepharose to remove Ig and Ag-Ab complexes. Each body fluid sample (500 µl) was incubated with 1 x 107 yeast (W303D) at 20°C for 30 min, and, after washing, the yeast was divided into two portions for analysis of phagocytosis and flow cytometry. The treated yeast (2 x 106) was mixed with the ascidian hemocytes (4 x 105), prepared as described previously (18), and incubated at 20°C for 30 min. Hemocytes that ingested one or more yeast cells were counted positive. The degree of phagocytosis was expressed as the ratio of the number of positive hemocytes to that of total hemocytes. Binding of AsC3 to yeast was analyzed by flow cytometry. The treated yeast (5 x 106) was washed once with gelatin veronal buffer containing 10 mM EDTA (EDTA-GVB) and incubated with 5 µl of anti-AsC3 Ab (1 mg/ml) at 4°C for 30 min. The yeast was then stained with 20 µl of 100 µg/ml FITC-conjugated goat anti-rabbit Igs at 4°C for 30 min and analyzed by FACScan flow cytometry. The yeast was washed three times between each reaction with EDTA-GVB.
| Results and Discussion |
|---|
|
|
|---|
60 amino acid residues C terminal in C3, C4, and
2-macroglobulin (
2M) (22) resulted in a single DNA band of the
expected size (about 220 bp). The DNA was gel purified and subcloned
into the plasmid using the TA cloning kit. Nucleotide sequence analysis
indicated that there were three different clones, two different clones
showing a closer similarity to mammalian
2M, and one clone with a
closer similarity to mammalian C3. Amino acid sequences deduced from
two
2M-like clones showed 50% and 42% identities to human
2M,
whereas their identities to human C3 were 24% and 21%. In contrast,
the C3-like clone showed 16% and 28% amino acid identities to human
2M and C3, respectively. Screening of the ascidian hepatopancreas
cDNA library with about 5 x 105 independent clones
(10) using the C3-like cDNA as a probe resulted in the isolation of 16
clones. The complete nucleotide sequence of clone 3, which contained
the longest insert of
5 kb, was determined, and one long open
reading frame was identified. Comparison of the deduced N-terminal
sequence of this clone with vertebrate C3 sequences indicated that
200 amino acid residues at the N terminus of ß-chain were not
covered. Thus, 5'-RACE of hepatopancreas RNA was performed using the
5'-RACE system (Life Technologies). A band of
900 bp was identified.
However, the size of AsC3 mRNA was estimated to be
7 kb by Northern
blotting analysis (see below), suggesting that a 1-kb or larger region
remained to be cloned. Thus, the second cycle of 5'-RACE was
performed to isolate a possible further 5' sequence. The putative
initiation codon, preceded by an in-frame stop codon, was identified in
the first 5'-RACE product. The entire amino acid sequence of AsC3 and
the corresponding nucleotide sequence were composed from the cDNA clone
and the 5'-RACE products (data not shown). The composition of
preproAsC3, predicted from a comparison with the vertebrate C3
sequences and amino acid sequence analysis of the subunit chains of
AsC3, is from the N terminus: a 21-amino acid (aa) leader sequence, a
653-aa ß-chain, a 4-aa ß-
processing site, and a 1062-aa
-chain. A typical thioester site, CGEQ, was found at positions
10131016, and a catalytic H residue (28) was recognized at position
1130. The entire amino acid sequence of preproAsC3 was aligned with
that of C3 from various vertebrate species and the mammalian C4, C5,
and
2M sequences using Clustal W software. A part of this alignment
including only the AsC3 sequence and the human sequences is shown in
Fig. 1
2M, respectively. Amino
acid sequence analysis of the N terminus of the
'-chain suggested
that a 78-aa peptide AsC3a is cleaved from the N terminus of the
-chain upon activation (see below). The equivalent peptides from
vertebrate complement components are anaphylatoxins and have important
inflammatory roles. The AsC3a sequence is atypical in that 1) it has
only four cystein residues whereas all vertebrate C3a, C4a, and C5a
have six conserved cystein residues, and 2) the C terminus is VSR while
all vertebrate C3a, C4a, and C5a have LXR. Sea urchin C3 has six
cystein residues in this region, but only two of them occur at the same
position as vertebrate C3a, C4a, and C5a (9). In addition, the C
terminus of the putative SuC3a sequence is TSR. Thus, it is
doubtful that invertebrate C3a binds to receptors similar to the
vertebrate C3a receptor.
|
2M was used as an
outgroup, AsC3 and SuC3 are predicted to have diverged first from all
other C3, C4, and C5 sequences, indicating that the gene duplications
which led to C3, C4, and C5 occurred in the vertebrate lineage after
their divergence from the urochordates. Since AsC3 and SuC3 have the
basic characteristics of vertebrate C3, such as an
-ß subunit
chain structure and a His-catalyzed thioester, it is concluded that the
common ancestor of vertebrate C3, C4, and C5 was a C3-like molecule.
|
7-kb message,
and a faint and longer band was detected from blood cells (Fig. 3
|
-chain (27). As shown in Fig. 4
(130 kDa) and ß (85 kDa), and
[14C]methylamine was incorporated into the
-chain.
These observed sizes are significantly larger than the sizes deduced
from the cDNA sequence (120 kDa and 73 kDa, respectively), suggesting
that both chains are glycosylated during posttranslational processing.
The N-terminal amino acid sequences of the two chains were determined
and shown to be identical to those deduced by cDNA sequencing (Fig. 1
-chain was cleaved into a smaller-sized
chain similar to the mammalian
'-chain. The determined N-terminal
amino acid sequence of the AsC3
'-chain is also shown by the
underline in Fig. 1
|
|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Masaru Nonaka, Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan. E-mail address: ![]()
3 Abbreviations used in this paper: SuC3, sea urchin C3; MASP, mannose-binding lectin-associated serine protease; AsC3, ascidian C3; p-APMSF, (p-aminophenyl)-methanesulfonylfluoride; RACE, rapid amplification of cDNA ends; GSP, gene specific primer;
2M,
2-macroglobulin; aa, amino acid. ![]()
Received for publication June 25, 1998. Accepted for publication September 21, 1998.
| References |
|---|
|
|
|---|
3 domain. Proc. Natl. Acad. Sci. USA 89:2209.This article has been cited by other articles:
![]() |
M. Nakao, T. Kajiya, Y. Sato, T. Somamoto, Y. Kato-Unoki, M. Matsushita, M. Nakata, T. Fujita, and T. Yano Lectin Pathway of Bony Fish Complement: Identification of Two Homologs of the Mannose-Binding Lectin Associated with MASP2 in the Common Carp (Cyprinus carpio) J. Immunol., October 15, 2006; 177(8): 5471 - 5479. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Melillo, G. Sfyroera, R. De Santis, R. Graziano, R. Marino, J. D. Lambris, and M. R. Pinto First Identification of a Chemotactic Receptor in an Invertebrate Species: Structural and Functional Characterization of Ciona intestinalis C3a Receptor J. Immunol., September 15, 2006; 177(6): 4132 - 4140. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takahashi, D. Iwaki, A. Matsushita, M. Nakata, M. Matsushita, Y. Endo, and T. Fujita Cloning and characterization of mannose-binding lectin from lamprey (agnathans). J. Immunol., April 15, 2006; 176(8): 4861 - 4868. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsushita, A. Matsushita, Y. Endo, M. Nakata, N. Kojima, T. Mizuochi, and T. Fujita Origin of the classical complement pathway: Lamprey orthologue of mammalian C1q acts as a lectin PNAS, July 6, 2004; 101(27): 10127 - 10131. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Clow, D. A. Raftos, P. S. Gross, and L. C. Smith The sea urchin complement homologue, SpC3, functions as an opsonin J. Exp. Biol., May 15, 2004; 207(12): 2147 - 2155. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Pinto, C. M. Chinnici, Y. Kimura, D. Melillo, R. Marino, L. A. Spruce, R. De Santis, N. Parrinello, and J. D. Lambris CiC3-1a-Mediated Chemotaxis in the Deuterostome Invertebrate Ciona intestinalis (Urochordata) J. Immunol., November 15, 2003; 171(10): 5521 - 5528. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bartl, M. Baish, I. L. Weissman, and M. Diaz Did the Molecules of Adaptive Immunity Evolve from the Innate Immune System? Integr. Comp. Biol., April 1, 2003; 43(2): 338 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sekine, A. Kenjo, K. Azumi, G. Ohi, M. Takahashi, R. Kasukawa, N. Ichikawa, M. Nakata, T. Mizuochi, M. Matsushita, et al. An Ancient Lectin-Dependent Complement System in an Ascidian: Novel Lectin Isolated from the Plasma of the Solitary Ascidian, Halocynthia roretzi J. Immunol., October 15, 2001; 167(8): 4504 - 4510. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyazawa, K. Azumi, and M. Nonaka Cloning and Characterization of Integrin {{alpha}} Subunits from the Solitary Ascidian, Halocynthia roretzi J. Immunol., February 1, 2001; 166(3): 1710 - 1715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lagueux, E. Perrodou, E. A. Levashina, M. Capovilla, and J. A. Hoffmann Constitutive expression of a complement-like protein in Toll and JAK gain-of-function mutants of Drosophila PNAS, October 10, 2000; 97(21): 11427 - 11432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsushita, S. Thiel, J. C. Jensenius, I. Terai, and T. Fujita Proteolytic Activities of Two Types of Mannose-Binding Lectin-Associated Serine Protease J. Immunol., September 1, 2000; 165(5): 2637 - 2642. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kenjo, M. Takahashi, M. Matsushita, Y. Endo, M. Nakata, T. Mizuochi, and T. Fujita Cloning and Characterization of Novel Ficolins from the Solitary Ascidian, Halocynthia roretzi J. Biol. Chem., June 1, 2001; 276(23): 19959 - 19965. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |