The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brooks, A. G.
Right arrow Articles by Coligan, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brooks, A. G.
Right arrow Articles by Coligan, J. E.
The Journal of Immunology, 1999, 162: 305-313.
Copyright © 1999 by The American Association of Immunologists

Specific Recognition of HLA-E, But Not Classical, HLA Class I Molecules by Soluble CD94/NKG2A and NK Cells

Andrew G. Brooks*, Francisco Borrego{dagger}, Phillip E. Posch*, Apisit Patamawenu*, Christopher J. Scorzelli*, Matthias Ulbrecht{ddagger}, Elizabeth H. Weiss{ddagger} and John E. Coligan1,{dagger}

* Structural Biology Section and {dagger} Laboratory of Immunogenetics, National Institute of Allergy and Infectious Disease, National Institutes of Health, Rockville, MD 20852; and {ddagger} Institut fur Anthropologie und Humangenetik der Universitat Munchen, Munich, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CD94/NKG2 receptors expressed by subpopulations of NK cells and T cells have been implicated as receptors for a broad range of both classical and nonclassical HLA class I molecules. To examine the ligand specificity of CD94/NKG2 proteins, a soluble heterodimeric form of the receptor was produced and used in direct binding studies with cells expressing defined HLA class I/peptide complexes. We confirm that CD94/NKG2A specifically interacts with HLA-E and demonstrate that this interaction is dependent on the association of HLA-E with peptide. Moreover, no interaction between CD94/NKG2A and classical HLA class I molecules was observed, as assayed by direct binding of the soluble receptor or by functional assays using CD94/NKG2A+ NK cells. The role of the peptide associated with HLA-E in the interaction between HLA-E and CD94/NKG2A was also assessed. All class I leader sequence peptides tested bound to HLA-E and were recognized by CD94/NKG2A. However, amino acid variations in class I leader sequences affected the stability of HLA-E. Additionally, not all HLA-E/peptide complexes examined were recognized by CD94/NKG2A. Thus CD94/NKG2A recognition of HLA-E is controlled by peptide at two levels; first, peptide must stabilize HLA-E and promote cell surface expression, and second, the HLA-E/peptide complex must form the ligand for CD94/NKG2A.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Natural Killer cells express a complex repertoire of receptors that interact with MHC class I proteins. The first such receptors identified on human NK cells were the killer cell inhibitory receptors (KIR)2 (1). Members of this group of receptors are composed of two or three Ig domains, and specific receptors interact with serologically defined groups of HLA class I molecules. Recently a related family of receptors, the Ig-like transcript (ILT) receptors (also known as Leukocyte Ig-like receptors (LIR), that are expressed by a wide variety of cells, including human NK cells, have also been shown to interact with HLA class I proteins (2, 3, 4). In addition, human NK cells express CD94/NKG2 receptors that interact with HLA class I molecules (5, 6, 7). The CD94/NKG2 receptors are heterodimers that consist of an invariant CD94 polypeptide disulfide bonded to a member of the NKG2 family of proteins.

The NKG2 proteins are a family of closely related polypeptides (NKG2A–F) that, like CD94, are type II integral membrane proteins of the C-type lectin superfamily (8, 9). Similar to other families of NK cell receptors that interact with class I molecules, such as KIR and the murine Ly49 receptors (10), some NKG2 family members appear to have diametrically opposed functions (11). NKG2A/B contains immunoreceptor tyrosine-based inhibitory motifs consistent with an inhibitory function, whereas NKG2C and E possess charged residues in their transmembrane domains that appear to be characteristic of other NK receptors, such as KIR2DS2, that interact with DAP12 to transmit an activation signal (12).

The first evidence that CD94/NKG2 receptors recognized HLA class I proteins came from transfection studies in which expression of certain HLA-B alleles protected target cells from NK cell-mediated lysis, and this protection was shown to be abrogated by CD94-specific mAb (5). Subsequent studies showed that transfection of many, but not all, HLA class I alleles, including the nonclassical HLA-G gene, could mediate protection from NK cell-mediated lysis that could be reversed by the addition of CD94-specific mAb or class I specific mAb (6, 7, 13, 14). Consequently, the CD94/NKG2 receptors were thought to interact with a large number of different HLA class I molecules. However, no obvious common structural features distinguish protective from nonprotective class I molecules. Recent studies have demonstrated an interaction between CD94/NKG2 receptors and HLA-E complexed with peptides derived from the leader sequence of some HLA class I heavy chains (15, 16, 17). These observations suggested that the CD94/NKG2 receptors specifically interact with HLA-E, but did not rule out the possibility of interactions with other class I molecules. The data presented here confirm a direct interaction between HLA-E and CD94/NKG2A and demonstrate that this interaction is peptide dependent and peptide specific. Moreover, no evidence of any interaction between CD94/NKG2A and HLA-A2, -A3, -B27, or -Cw3 was observed, suggesting that CD94/NKG2A does not recognize classical HLA class I Ags, but that HLA-E is its primary, if not sole, ligand.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and reagents

The NK leukocytosis 221707 cells, which lack inhibitory KIR and express the CD94/NKG2A receptor, have been described previously (15). RMA-S cells transfected with human ß2m (hß2m), or 2m together with HLA-E, HLA-A2, HLA-A3, and HLA-B27 and RMA-S cells transfected with HLA-Cw3 alone have been previously described (15, 18, 19). L cells transfected with HLA class I molecules were obtained from Centro di Biotecnologie (Avanzate, Italy) and were a gift from Dr. J. McCluskey (University of Melbourne, Melbourne, Australia). FITC-conjugated anti-HLA class I mAb (B9.12.1) was purchased from Immunotech (Westbrook, ME). Streptavidin-conjugated phycoerythrin (PE) was purchased from Molecular Probes (Eugene, OR), and streptavidin-conjugated horseradish peroxidase (HRP) was obtained from Amersham (Arlington Heights, IL). The NKG2A-specific mAb 1A12 (11) was provided by Dr. J. P. Houchins. Peptides were synthesized and purified as previously described (20).

Construction of baculovirus shuttle vectors

A cDNA encoding a hexahistidine sequence followed by a spacer region and the extracellular domain of NKG2A (amino acid residues 100–233) was amplified by PCR using the synthetic oligonucleotides GGGGGATCCCATCATCATCATCACCACGAAGGATCGGGAAGGCACAACAATTCTTCCCTG and GTGAATTCTAGATTACCTCTAAAGCTTATGCTTACAATG and was cloned into pAcGP67B (PharMingen, San Diego, CA) downstream of the GP67 leader sequence as a BamHI/EcoRI fragment to create pAc-sol2Ahis. The cDNA encoding the extracellular domain of CD94 (residues 34–179) was generated by PCR using the oligonucleotides GGGGGATCCTCTTTTACTAAACTGAGTATTGAGCCAGC and CCGGAATTCCCATGGAAACATTTAAATGAGCTGTTG and was also cloned into pAcGP67B as a BamHI/EcoRI fragment to create pAc-sol94. Annealed oligonucleotides encoding the substrate sequence for the BirA enzyme (GATCGCTGCATCATATTCTGGATGCACAGAAAATGGTGTGGAATCATCGTGGGTCCGGAA and GATCTTCCGGACCCACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGC) were then inserted by ligation into the BamHI site of pAc-sol94 to create pAc-sol94BirA. DNA fragments encoding both the entire GP67/BirA/CD94 and GP67/hexahistidine/NKG2A were then produced by PCR using the synthetic oligonucleotides GGGAGATCTATGCTAGTAAATCAGTCACACC and GGAAGATCTGGAAAGGATCAGATCTGCAGCGGC and were cloned into the dual promoter transfer vector pAcUW51 (PharMingen) at the BamHI and BglII sites, respectively, to create pAcsol2Ahis/94BirA. The sequence of the inserts was confirmed by dsDNA sequencing, and the transfer vector was cotransfected with Baculogold-linearized baculovirus DNA (PharMingen) into sf21 cells using Cellfectin (Life Technologies, Gaithersburg, MD) to create recombinant baculovirus. Recombinant baculovirus stock was obtained from the supernatant of cotransfected cells, and the recombinant baculovirus was cloned by limiting dilution. Cloned viral stocks were amplified and screened for expression of NKG2A by Western blot, and clones expressing the highest levels of NKG2A were selected for further amplification and production of recombinant protein.

Production of fluorescently labeled soluble CD94/NKG2A

Culture supernatants from sf21 cells infected with a recombinant baculovirus directing the expression of soluble CD94/NKG2A were concentrated through a hollow-fiber filter and initially purified using Ni-NTA agarose (Qiagen, Santa Clarita, CA). The recombinant protein was eluted in 10 mM Tris (pH 8.0), 50 mM NaCl, and 0.5 M imidazole; dialyzed against 10 mM Tris (pH 8.0); and further purified by gel filtration on a Superdex 200 HR column (Pharmacia, Uppsala, Sweden). Purified protein was biotinylated by incubation at 30°C for 16–24 h with BirA in a buffer containing 50 mM bicine (pH 8.3), 40 µM biotin, 10 mM magnesium acetate, and 10 mM ATP (Avidity, Denver, CO). The biotinylated heterodimer was separated from free biotin by gel filtration and then multimerized by the addition of streptavidin-coupled PE (Molecular Probes). Multimeric CD94/NKG2A/PE was purified from the heterodimeric species by gel filtration. The fluorescently labeled CD94/NKG2A/PE was titrated for activity, and a working dilution was established (generally corresponding to ~0.5 µg of protein/binding reaction).

Direct binding assay

RMA-S cells or their transfected derivatives were cultured with synthetic peptide (300 µM) at 26 or 37°C for 12–18 h. Cells were harvested, washed, and incubated with PE-labeled CD94/NKG2A/PE for 30 min on ice. Cells were then washed and analyzed by flow cytometry on a FACSort (Becton Dickinson, San Jose, CA). Experiments were performed at least four times, and single representative experiments are shown in the figures.

Cytotoxicity assays

Target cells were incubated overnight at the indicated temperature in the absence or presence of peptide (300 µM) and for the last 90 min were labeled with sodium [51Cr]chromate (DuPont, Boston, MA). The cytotoxic activity of 221707 NK cells was performed in 3-h chromium release assays as previously described using 2500 target cells/well and an E:T cell ratio of 60:1 (15). The radioactivity present in 100 µl of supernatant was measured using a 4/600 ME Plus gamma counter (ICN Biomedicals, Huntsville, AL). The percent specific cytotoxicity was calculated as previously described (19). Data shown are representative of multiple experiments at a variety of E:T cell ratios and are derived from the means of triplicate samples.

Immunoblot analyses

Western blots were performed as previously described (21). Purified protein preparations were separated by SDS-PAGE and transferred to nitrocellulose (Hybond C Extra, Amersham). To detect biotinylated proteins, membranes were blocked with 3% BSA in PBS before incubation with streptavidin-conjugated HRP (Amersham) diluted 1/3000 in PBS/0.1% Tween-20. The membranes were then washed with PBS containing 0.1% Tween-20/3% BSA. Biotinylated proteins were visualized using enhanced chemiluminescence (ECL, Amersham). To detect recombinant NKG2A, membranes were blocked with PBS containing 3% skim milk, before incubation with the NKG2A-specific mAb 1A12. Excess mAb was removed by washing the blot with PBS containing 0.1% Tween-20 and 3% skim milk before addition of goat anti-mouse IgG-conjugated HRP (Amersham). The blot was washed, and the proteins were visualized using enhanced chemiluminescence.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Soluble CD94/NKG2A binds HLA-E

To examine the ligand specificity of CD94/NKG2A, a soluble form of the receptor was produced. A recombinant baculovirus was engineered that expressed both the NKG2A extracellular domain linked to a hexahistidine sequence and the CD94 extracellular domain linked to a substrate sequence for the BirA enzyme, each inserted behind the GP67 leader sequence (Fig. 1GoA). Recombinant protein from the supernatant of infected sf21 cells was purified using immobilized metal chelate chromatography. The CD94 subunit of the purified recombinant protein was enzymatically labeled with biotin, and the labeled protein was subjected to SDS-PAGE and analyzed by Western blot (Fig. 1GoB). Incubation with streptavidin-conjugated HRP to detect the CD94 polypeptide revealed a single biotinylated protein of 24 kDa under reducing conditions and of about 43 kDa under nonreducing conditions. Under reducing conditions, parallel analysis with the NKG2A-specific mAb 1A12 revealed a single NKG2A-reactive species slightly smaller in molecular mass than the recombinant CD94. Under nonreducing conditions, a single band was observed of the same molecular size as the protein revealed by SA-HRP. These data indicate that the purified recombinant protein is a disulfide-linked 43-kDa heterodimer that consists of the extracellular domain of CD94 covalently associated with that of NKG2A.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of a recombinant soluble form of CD94/NKG2A. A, Schematic representation of recombinant baculovirus-expressed proteins. The ectodomain of CD94 (residues 34–179) and a BirA substrate sequence were cloned downstream of the baculovirus GP67 leader sequence. The ectodomain of NKG2A (residues 100–233) was modified to append six histidine residues at its amino terminus and was subcloned downstream of the GP67 leader sequence. B, Western blot analysis of enzymatically biotinylated, purified recombinant protein. Biotinylated CD94 protein was detected by incubation with streptavidin-conjugated HRP (SA-HRP); NKG2A was detected by incubation with the NKG2A-specific mAb 1A12 followed by an HRP-conjugated goat anti-mouse IgG. Reactive species were visualized by enhanced chemiluminescence.

 
CD94/NKG2A has been shown to interact with HLA-E complexed to HLA class I leader sequence peptides. Therefore, we tested the ability of recombinant CD94/NKG2A, which was multimerized and labeled by incubation with streptavidin-conjugated PE (CD94/NKG2A/PE), to bind to RMA-S cells transfected with HLA-E and hß2m after overnight culture with a synthetic peptide corresponding to residues 3–11 of the leader sequence of HLA-Cw3, VMAPRTLIL. This peptide has been shown to bind to and increase cell surface levels of HLA-E (15). The peptide-pulsed RMA-S/HLA-E transfectants were incubated with the labeled soluble receptor and analyzed by flow cytometry. Soluble CD94/NKG2A/PE clearly bound RMA-S/HLA-E transfectants cocultured with the HLA-Cw3 leader sequence peptide (Fig. 2Go). Moreover, binding of recombinant CD94/NKG2A/PE to HLA-E was inhibited by the addition of either HLA class I- or CD94-specific mAb. No binding of recombinant CD94/NKG2A/PE to RMA-S/HLA-E transfectants was observed when cells were cultured without synthetic peptide or in the presence of irrelevant peptide (see Figs. 5Go and 7Go). These data indicate that soluble recombinant CD94/NKG2A/PE retains the specificity of the native receptor.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 2. Recombinant CD94/NKG2A binds to HLA-E. RMA-S cells transfected with HLA-E and hß2m were incubated overnight at 26°C in the absence of peptide (no peptide) or in the presence of the HLA class I leader sequence-derived peptide VMAPRTLIL. Cells were incubated with either soluble CD94/NKG2A/PE alone (VMAPRTLIL or no peptide) or together with the CD94-specific mAb HP-3B1 (VMAPRTLIL + anti-CD94) or the HLA class I-specific mAb B9.12.1 (VMAPRTLIL + anti-HLA) and were analyzed by flow cytometry.

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. CD94/NKG2A interacts with HLA-E complexed to leader sequence peptides with Thr at P2. A, RMA-S/HLA-E cells were incubated at 37°C in the presence of the indicated peptides (300 µM) for 16 h. Cells were washed, incubated with either the HLA class I-specific mAb B9.12.1 (anti-HLA-class I) or soluble CD94/NKG2A/PE (CD94/NKG2A), and analyzed by flow cytometry. Results are indicated as the mean channel fluorescence intensity. B, RMA-S/HLA-E cells were incubated for 16 h at 26°C in the presence of the indicated signal sequence-derived peptide or the control peptide KLFEKVYNY (300 µM), excess peptide was removed, and the cells were returned to 37°C. Aliquots of cells were obtained at the indicated time points, stained with HLA class I-specific mAb, and analyzed by flow cytometry. The data are shown as the mean channel fluorescence intensity. C, RMA-S cells transfected with hß2m (ß2m) or HLA-E and hß2m (HLA-E) were incubated with the indicated peptides (300 µM) at 26°C for 16 h. Cells were washed and labeled with 51Cr. Cells were then washed and were added directly to cytotoxicity assays (-) or the original peptide was added back to the cells (+) before coculture with 221707 NK cells at an E:T cell ratio of 60:1.

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 7. CD94/NKG2A-mediated protection from lysis is dependent on the sequence of the peptide associated with HLA-E. RMA-S/HLA-E transfectants were incubated with the indicated peptides (300 µM) at 26°C for 16 h. Cells were labeled with 51Cr, washed, and were added directly to cytotoxicity assays (- peptide) or the original peptide was added back to the cells (+ peptide) before coculture with 221707 NK cells at an E:T cell ratio of 60:1.

 
Soluble CD94/NKG2A does not bind classical HLA class I molecules

While it is evident that CD94/NKG2 receptors can interact with HLA-E (15, 16, 17), an interaction with other HLA class I molecules, as suggested in earlier studies (5, 7), has not been excluded. To determine whether CD94/NKG2A interacts primarily with HLA-E complexed to HLA class I leader sequence peptides or is broadly reactive with a large number of HLA class I molecules, recombinant CD94/NKG2A/PE was used in cell binding experiments with a panel of RMA-S transfectants expressing different classical HLA class I molecules or HLA-E.

RMA-S/HLA-class I transfectants were incubated at 26°C with synthetic peptides and stained with either class I-specific mAb to detect cell surface levels of HLA-E or recombinant CD94/NKG2A/PE to analyze its ligand specificity. As expected, RMA-S/HLA class I transfectants after incubation at 26°C without peptide showed significant levels of cell surface HLA class I expression compared with cells expressing hß2m alone (Fig. 3Go and Table IGo). HLA class I expression was further enhanced by the addition of specific synthetic peptides known to bind to each HLA class I molecule (19, 20, 22). No binding of recombinant CD94/NKG2A/PE to RMA-S/HLA-E transfectants was observed in the absence of class I leader sequence peptides despite the induction of significant levels of cell surface HLA-E as a result of incubation at 26°C. Binding of recombinant CD94/NKG2A/PE to RMA-S cells expressing HLA-E was evident only when these cells were cocultured with an appropriate synthetic leader sequence peptide. Transfection of HLA-A2, -A3, and -Cw3 into 721.221 cells (which express HLA-E, but not HLA-A, -B, or -C proteins) has previously been shown to be protect these cells from NK-mediated lysis through an interaction with CD94/NKG2 receptors (6). However, no detectable binding of recombinant CD94/NKG2A/PE was observed to RMA-S cells expressing either hß2m alone or HLA-A2, -A3, -B27, and -Cw3 in the absence or the presence of specific HLA binding peptides. The failure to observe binding to peptide-loaded RMA-S transfectants expressing classical HLA class I molecules is unlikely to be due to the use of inappropriate peptides, as soluble CD94/NKG2A/PE does not bind to L cells transfected with HLA-A2, -A24, -A26, -B27, or -Cw7, each of which complexes with a myriad of endogenous peptides (data not shown). Thus, these data indicate that CD94/NKG2A is not broadly cross-reactive with HLA class I molecules, but that the interaction with HLA-E is specific.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Recombinant CD94/NKG2A binds specifically to HLA-E. RMA-S cells transfected with hß2m, HLA-A2 and hß2m, HLA-A3 and hß2m, HLA-B27 and hß2m, HLA-Cw3, or HLA-E and hß2m were incubated in the absence or the presence of synthetic peptide (ILDKKVEKV for HLA-A2, KLFEKVYNY for HLA-A3, RRISGVDRS for HLA-B27, YAYDGKDYIAL for HLA-Cw3, and VMAPRTVLL for HLA-E) at 26°C for 16 h. Cells were washed and incubated with either the anti-HLA class I-specific mAb B9.12.1 (open histograms) or the multimeric CD94/NKG2A/PE (shaded histograms) and were analyzed by flow cytometry.

 

View this table:
[in this window]
[in a new window]
 
Table I. Soluble CD94/NKG2A binds HLA-E but not classical HLA class I molecules1

 
HLA-E specifically confers CD94-mediated protection from NK lysis

221707 NK cells express the inhibitory CD94/NKG2A receptor and do not express inhibitory KIR (15). These cells were used in cytotoxicity assays with the RMA-S/HLA-class I transfectants to functionally verify the binding data obtained using recombinant CD94/NKG2A/PE. As expected incubation of RMA-S/HLA-E transfectants with an HLA leader sequence peptide resulted in reduced levels of NK-mediated lysis compared with those in cells expressing 2m alone (Fig. 4Go). In contrast, RMA-S transfectants expressing HLA-A2, -A3, -B27, and -Cw3 that were incubated with synthetic peptides specific for each HLA class I protein were lysed by 221707 NK cells at levels comparable to those in RMA-S cells transfected with hß2m alone. These data are consistent with the direct binding data reported above and strongly suggest that CD94/NKG2A interacts specifically with HLA-E and not with a broad range of HLA class I molecules.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 4. NK cells (221707) were assayed for cytotoxicity against RMA-S cells transfected with the indicated HLA class I genes incubated for 16 h at 26°C in the presence of 300 µM synthetic peptide at an E:T cell ratio of 60:1 (no peptide for ß2m, ILDKKVEKV for HLA-A2, KLFEKVYNY for HLA-A3, RRISGVDRS for HLA-B27, YAYDGKDYIAL for HLA-Cw3, and VMAPRTVLL for HLA-E).

 
CD94/NKG2A interacts with HLA-E complexed with HLA class I leader sequence peptides that contain Thr at P2

Recent studies have shown that protection from NK cell lysis can be mediated through an interaction between CD94/NKG2A and HLA-E complexed with peptides corresponding to HLA class I leader sequence peptides (residues 3–11) that have a Met, but not a Thr, at residue 4 (P2 of the HLA-E binding peptide) (15, 17). Binding data have indicated that leader sequence peptides with Thr at P2 do not bind to HLA-E as well as those with a Met at P2 (15, 16, 17, 23, 24). There are two possible explanations for the failure of leader sequences containing Thr at residue 4 (P2) to protect HLA-E-expressing target cells from lysis by CD94/NKG2A+ NK cells. Firstly, CD94/NKG2A may not recognize HLA-E complexed with leader sequence peptides that contain Thr at P2. Alternatively, these peptides may fail to confer protection from NK cell-mediated lysis because of their inability to maintain sufficient levels of stable HLA-E/peptide complexes for recognition by CD94/NKG2A over the course of a cytotoxicity assay. To discriminate between these possibilities, the ability of the soluble CD94/NKG2 receptor to bind to HLA-E complexed to peptides corresponding to HLA class I leader sequences that differ only at P2 was tested. After coculture for 16 h in the presence or the absence of the indicated peptides, RMA-S/HLA-E transfectants were incubated with anti-class I mAb or soluble CD94/NKG2A/PE and were analyzed by flow cytometry. Incubation with HLA leader sequence peptides containing either Met or Thr at P2 significantly increased the level of cell surface HLA-E expression with respect to that in cells incubated without peptide or with a control peptide, as detected by HLA class I-specific mAb (Fig. 5GoA). However, those with Met at P2 (VMAPRTVLL and VMAPRTLLL) consistently increased HLA-E expression to levels higher than those with Thr at P2. Despite the fact that higher levels of bound CD94/NKG2A/PE were consistently observed on RMA-S/HLA-E transfectants cultured with peptides having Met at P2, cells expressing HLA-E complexed to peptides with Thr at P2 clearly bound soluble CD94/NKG2A/PE. No binding of soluble CD94/NKG2A/PE was observed to RMA-S/HLA-E transfectants cultured in the absence of peptide or with a control peptide.

The observation that the soluble CD94/NKG2A/PE receptor bound to RMA-S/HLA-E transfectants cocultured with leader sequence peptides with Thr at P2 is superficially in conflict with the finding that peptides with Thr at P2 failed to confer protection from NK-mediated lysis (15, 17). This might suggest that the specificity of the recombinant receptor is subtly different from its natural counterpart. Alternatively, this discrepancy may reflect differences between the conditions of the binding and cytotoxicity assays. Notably, the binding assays using the soluble form of the receptor were performed immediately after removal of the peptide from the RMA-S/HLA-E transfectants, whereas the functional assays typically involve a 3-h incubation at 37°C in the absence of peptide after extensive washing to remove unincorporated chromium and excess peptide. If the HLA-E/peptide complexes formed with peptides with Thr at P2 are not as stable as those with Met at P2, it is possible that they dissociated over the course of the cytotoxicity assay, thus leaving little, if any, properly folded HLA-E on the target cells available to interact with CD94/NKG2A on the effector cells.

Therefore, the stability of HLA-E complexed to peptides containing either Thr or Met at P2 was tested using conditions similar to those employed in the cytotoxicity assays. Cell surface expression of HLA-E was maximized by overnight culture of RMA-S/HLA-E transfectants at 26°C with the indicated peptides. Cells were washed to remove excess peptide and were returned to 37°C. At the indicated times, aliquots of cells were sampled, and the amount of cell surface HLA-E was determined by flow cytometry. As expected, culture at 26°C without added peptide led to elevated levels of HLA-E expression (as a result of the increased thermostability), which rapidly returned to background levels when cultured at 37°C (Fig. 5GoB). A similar pattern of HLA-E expression was seen with the control peptide KLFEKVYNY (which binds HLA-A3). Overnight incubation at 26°C with HLA class I leader sequence peptides initially resulted in higher levels of HLA-E expression than that in cells incubated without peptide or with control peptides. On incubation at 37°C, cell surface expression of peptide-stabilized HLA-E was evident even after 2 h for cells incubated with the leader sequence peptide, VMAPRTVLL. In contrast, RMA-S/HLA-E transfectants incubated with the leader sequence peptide VTAPRTLLL rapidly lost conformational HLA class I determinants over the course of the 37°C incubation. Similar data were observed with another peptide that contains Thr at P2, VTAPRTVLL (data not shown). These data indicate that the leader sequence peptides with Thr at P2, such as VTAPRTLLL, form complexes with HLA-E that are significantly less stable than those formed with peptides containing Met at P2. Consequently, the failure of peptides with Thr at P2 to protect HLA-E-positive target cells apparently results from the rapid dissociation of these complexes over the course of a cytotoxicity assay. Therefore, it might be expected that the continued presence of peptide with Thr at P2 throughout the course of the cytotoxicity assays would allow for the continual formation of HLA-E/peptide complexes, which would maintain cell surface HLA-E that could be recognized by CD94/NKG2A, and thus reconcile the difference between the binding and cytotoxicity data.

To examine this possibility, cytotoxicity assays were performed using target cells that were cultured either with or without the continued presence of peptide throughout the assay after cell surface HLA-E was reconstituted by overnight culture at 26°C with the same peptides. As expected, RMA-S cells that lacked HLA-E (hß2m alone) were efficiently lysed regardless of whether peptide was maintained throughout the assay (Fig. 5GoC). Overnight culture with the leader sequence peptide with Met at P2, VMAPRTVLL, was sufficient to protect RMA-S/HLA-E transfectants from lysis. As previously shown (15), the peptide VTAPRTLLL was not able to confer protection from lysis after overnight culture alone. However, if this peptide was maintained throughout the assay, it was able to protect RMA-S/HLA-E transfectants from NK-mediated lysis. The peptide VTAPRTVLL, like VTAPRTLLL, is also capable of protecting target cells from lysis when maintained throughout the coculture of target cells with NK cells (data not shown). Furthermore, protection was specific to peptides that have some capacity to interact with HLA-E, as control peptides KLFEKVYNY (Fig. 5GoC) and RRISGVDRS (data not shown), which do not bind HLA-E, failed to induce protection under any conditions. These data indicate that the CD94/NKG2A receptor does not functionally discriminate between HLA-E complexed to leader sequence peptides containing either Met or Thr at P2, but that this residue exerts a significant effect on recognition by its contribution to the stability of the HLA-E/peptide complexes.

Recognition of HLA-E by CD94/NKG2 is dependent on the sequence of the peptide associated with HLA-E

To examine the importance of other peptide residues in the recognition of HLA-E by CD94/NKG2A, we tested a panel of peptides for their ability to induce conformational class I epitopes on RMA-S/HLA-E transfectants and for their ability to produce a ligand structure recognized by CD94/NKG2A. Most human HLA class I alleles encode Val at residue 3 of the leader sequence (P1 of the HLA-E binding peptide); however, HLA-Aw34 encodes Ile, and murine class I molecules encode Ala at this position. The substitution of Ile (HLA-Aw34) for Val at P1 had little effect on either the ability to induce conformational determinants on HLA-E as detected by the class I-specific mAb or on the ability of soluble CD94/NKG2A/PE to bind to HLA-E compared with that of the signal sequence peptide derived from HLA-A2 (Fig. 6Go). The peptide AMAPRTLLL derived from murine H-2Dd and Ld differs from that derived from HLA-A1 only at P1 (A vs V). This peptide was less effective in stabilizing HLA-E on the surface of RMA-S/HLA-E cells than the corresponding peptide derived from the leader sequence of HLA-A1. However, recombinant CD94/NKG2A/PE was able to bind to HLA-E complexed with AMAPRTLLL, and the levels of staining were reduced in concordance with the lower levels of cell surface HLA-E. These data indicate that Ile can be substituted for Val at P1 with little effect on cell surface expression of HLA-E or on CD94/NKG2A recognition and that while an alanine substitution at P1 reduces cell surface expression of HLA-E, there is no apparent effect on the interaction between HLA-E and CD94/NKG2A/PE.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. Recognition of HLA-E by CD94/NKG2A is dependent on the sequence of the peptide. RMA-S/HLA-E transfectants were cultured at 37°C with the indicated peptides. Cells were stained with the HLA-class I-specific mAb B9.12.1 (anti-HLA class I) or soluble CD94/NKG2A/PE (CD94/NKG2A). Results are shown as the mean channel fluorescence intensity.

 
Residue 9 of HLA class I leader sequences (P7 of the HLA-E binding peptides) is highly conserved and is generally Leu in most HLA leader sequences. HLA-B7, however, encodes a Val instead of a Leu at residue 9 (P7) compared with HLA-A1. This substitution has little effect on the ability to stabilize cell surface HLA-E expression and the binding of soluble CD94/NKG2A/PE to HLA-E (Fig. 5GoA). Leader sequence residue 10 (P8) also tends to be a hydrophobic residue, although there is more variation than at residue 9. Val (HLA-A2), Ile (HLA Cw3), Leu (HLA-A1), and Phe (HLA-G) are present in leader sequence peptides at this position. No significant differences in the induction of HLA-E expression could be attributed to the presence of Val, Ile, or Leu at P8, but lower levels of HLA-E expression were observed using the HLA-G-derived peptide that has Phe at P8 (Fig. 6Go). Nevertheless, all these residues at P8 allowed for an interaction between HLA-E and soluble CD94/NKG2A/PE. Thus, the presence of a hydrophobic residue appears sufficient to allow for an interaction with soluble CD94/NKG2A/PE.

Changes in P3 and P6 produced the most noticeable effects. The leader sequence peptide corresponding to H-2Dk has a Val, rather than Ala, at P3. This peptide had a reduced ability to stabilize cell surface HLA-E on RMA-S cells with respect to the analogous peptide from H-2Dd/Ld. Despite this, soluble CD94/NKG2A/PE still bound to HLA-E complexed to the H-2Dk leader sequence peptide, albeit at a reduced level. The leader sequence of HLA-Cw7 is distinctive because it contains an Ala at P6. The other leader sequence peptides, including the comparable peptide derived from HLA-A1, encode Thr at P6. Consistent with previously described peptide binding data (23), the Ala substitution leads to a slight decrease in stabilization of cell surface HLA-E, but one that is not as marked as that observed with peptides having Thr at P2 (see Fig. 5GoA). However binding of soluble CD94/NKG2A/PE to HLA-E/Cw7 peptide was markedly lower than that for other peptides that induced comparable levels of HLA-E expression, suggesting that the substitution of Ala for Thr at P6 has a significant effect on the interaction between CD94/NKG2A and HLA-E.

Finally, a peptide derived from the EBV protein BZLF-1 (residues 39–47) that has recently been shown to bind HLA-E (25) was also tested for its ability to both bind HLA-E and produce the ligand structure recognized by CD94/NKG2A. While the sequence of this peptide is quite different from that of the prototypical HLA class I leader sequence, it clearly stabilized cell surface HLA-E with respect to control peptides. In marked contrast to the HLA-class I leader sequence-derived peptides, no binding of soluble CD94/NKG2A/PE to HLA-E/BZLF peptide complexes was observed. This suggests that the nature of the peptide associated with HLA-E plays a role in its recognition by CD94/NKG2 receptors.

CD94/NKG2A can functionally discriminate between different HLA-E binding peptides

For functional confirmation of the soluble CD94/NKG2A/PE binding data described above, RMA-S/HLA-E transfectants were cultured overnight in the presence of the indicated peptides, and then used as targets with or without the continued presence of the peptide in cytotoxicity assays with 221707 NK cells. As expected, protection from lysis was dependent on coculture with an appropriate peptide, as cells incubated without synthetic peptide were efficiently lysed by 221707 cells (Fig. 7Go). Incubation of RMA-S/HLA-E transfectants with the peptide VMAPRTLIL was sufficient to protect these cells from NK lysis regardless of whether the presence of the peptide was maintained throughout the assay. The leader sequence peptides derived from HLA-Cw7 and H-Dk had characteristics similar to those of peptides with Thr at P2, such as VTAPRTVLL (see Fig. 5GoC). These peptides do not protect RMA-S/HLA-E cells under typical assay conditions, but do so if the presence of the peptide is maintained throughout the assay. On the other hand, the BZLF-1 peptide was unable to induce protection of RMA-S/HLA-E transfectants regardless of whether the presence of the peptide was maintained throughout the assay. These data are consistent with the binding data obtained using the soluble receptor and indicate that the CD94/NKG2A receptor can functionally discriminate between different HLA-E/peptide complexes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD94 forms a disulfide-bonded heterodimer with members of the NKG2 family of proteins and is expressed on the surface of NK cells. Transfection studies have demonstrated a role for CD94 complexed with either NKG2A or the alternatively spliced variant NKG2B in HLA class I-dependent protection of target cells from lysis. To characterize the ligands for the CD94/NKG2A heterodimer and to minimize the complications inherent from the interpretation of functional data derived from cells with the potential to express multiple receptors for HLA class I proteins (including heterodimers of CD94 and other NKG2 family members), a recombinant protein consisting of the ectodomains of the CD94/NKG2A receptor was produced. An N-terminal sequence was appended to CD94 to allow for enzymatic biotinylation, which, in turn, facilitates multimerization and labeling of the recombinant protein. This multimeric, fluorescently labeled recombinant protein was then used to characterize the ligand(s) reactive with CD94/NKG2A. The data presented here clearly demonstrate that CD94/NKG2A does not interact with a broad array of HLA class I molecules, but that it specifically recognizes HLA-E complexed to leader sequence peptides derived from other class I molecules. Further, it was demonstrated that cell surface expression of HLA-E in the absence of an appropriate peptide is insufficient to form the ligand. These data also illustrate the utility of enzymatic biotinylation and multimerization of recombinant proteins with fluorescently labeled streptavidin in characterizing cell surface ligands and represent an extension of the approach that has already been used with soluble forms of MHC class I molecules (16, 26).

Previous studies have shown that class I leader sequence-derived peptides containing Met, but not Thr, at P2 complexed with HLA-E can act as a ligand for CD94/NKG2. It has also been shown that coculture of HLA-E-expressing cells with leader sequence peptides containing Thr at P2 increased HLA-E cell surface expression, albeit at reduced levels compared with those of similar peptides with Met at P2 (15, 17). The direct binding and functional data presented here clearly indicate that the CD94/NKG2A receptor can interact with HLA-E complexed to peptides with Thr at P2 and that these peptides can protect target cells from lysis by NK cells. However, these complexes are considerably less stable with respect to HLA-E complexed to peptides with Met at P2. Thus, the predominant factor in controlling CD94/NKG2 recognition of HLA-E with respect to the effects of substitutions at P2 of the bound peptide appears to be the affinity of the peptide for HLA-E, which, in turn, affects stable expression of HLA-E at the cell surface.

Analysis of a variety of other peptides derived from both human and mouse class I leader sequences showed that the naturally occurring variations at P1, P3, P7, and P8 had little obvious direct effect on the interaction between HLA-E and CD94/NKG2A. In general, substitutions that had an obvious effect on the stability of cell surface HLA-E lead to equivalent changes in the binding level of soluble CD94/NKG2A/PE. However, analysis of two peptides, the BZLF-1 peptide (residues 39–47) and the HLA-Cw7 leader sequence peptide, suggests that not all peptides that bind to HLA-E can efficiently form the ligand for CD94/NKG2A. While the BZLF-1 peptide does not bind HLA-E as well as most HLA class I leader sequence peptides tested, it is capable of stabilizing cell surface HLA-E. Despite this, no detectable binding of soluble CD94/NKG2A/PE was observed, nor was the peptide capable of protecting RMA-S/HLA-E transfectants from NK-mediated lysis even when its presence was maintained throughout the cytotoxicity assays.

The peptide VMAPRALLL derived from the HLA-Cw7 leader sequence differs from that of HLA-A1 only at P6 (Ala for Thr). This substitution appears to have a more profound effect on the interaction with CD94/NKG2A than on its ability to bind HLA-E. This peptide increased cell surface expression of HLA-E to levels similar to those of other class I leader sequence peptides containing Met at P2, yet was unable to confer protection from NK lysis to HLA-E-expressing RMA-S cells unless the peptide was maintained in culture during the assay. Moreover, the low level of binding of the soluble CD94/NKG2A/PE to HLA-E complexed with this peptide, relative to that of the other peptides that stabilize comparable levels of HLA-E, suggests that this substitution is affecting the conformation of the determinant recognized by CD94/NKG2A. The crystal structure of HLA-E (27) shows that that P6, a Thr in most HLA class I leader sequence peptides, makes significant contact with the C pocket, while the Arg at P5 is solvent exposed. The substitution of Ala for Thr in the HLA-Cw7 peptide may exert its affect on CD94/NKG2A recognition by altering the conformation of HLA-E around the C pocket or by altering the conformation of the peptide, which, in turn, may change the position of the exposed Arg at P5.

These data indicate that CD94/NKG2A recognition of HLA-E is potentially controlled at two levels. Firstly, there is a requirement for peptides that can bind HLA-E and allow its egress from the endoplasmic reticulum leading to subsequent cell surface expression. Studies with murine cells (28) and HLA class I-deficient human cells (17, 23) indicate that few self peptides are appropriate for this function, as cell surface expression of HLA-E in the absence of other HLA class I molecules is generally very low. Transfection of classical class I genes into cell lines that lack expression of classical class I genes but express HLA-E elevates cell surface expression of HLA-E (16, 17, 23). Thus, the signal sequences of class I molecules appear to be the predominant source of such peptides. Secondly, the sequence of the peptide also affects recognition of HLA-E. While most HLA class I signal sequence peptides produce the ligand for CD94/NKG2A when associated with HLA-E, the Cw7 peptide was poorly recognized by soluble CD94/NKG2A. Furthermore, no recognition of HLA-E complexed with the BZLF peptide was observed. These data suggest that even if self or viral peptides bind HLA-E sufficiently well to allow stable cell surface expression, recognition of HLA-E by CD94/NKG2A is further constrained by the sequence of the peptide.

While the precise role that CD94/NKG2 recognition of HLA-E plays in NK cell biology is not understood, it is appears that this system may function to complement the interaction of KIR with HLA class I molecules. As KIR are both clonally distributed and restricted in their interaction to particular HLA class I epitopes, the presence of a more broadly reactive system may be important for NK cells that lack an appropriate inhibitory KIR for recognition of self-HLA class I molecules (29). In addition, up-regulation of cell surface HLA-E expression through IFN-{gamma} induction of either HLA class I proteins themselves or the Ag-processing/peptide-loading mechanisms (30) or through induction of CD94/NKG2A expression through the action of IL-15 (31) may serve to make the recognition of HLA-E by CD94/NKG2 receptors acutely responsive to the effects of cytokines produced in inflammatory situations.


    Acknowledgments
 
We thank Drs. Peter Cresswell, J. P. Houchins, and J. McCluskey for gifts of cells and Abs. We also thank Dr. Jon Shuman for comments on the manuscript, and Gladys Wood for help with preparation of the manuscript.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. John Coligan, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, 12441 Parklawn Dr., Rockville, MD 20852. Back

2 Abbreviations used in this paper: KIR, killer cell inhibitory receptors; hß2m, human ß-microglobulin; HRP, horseradish peroxidase; PE, phycoerythrin. Back

Received for publication June 23, 1998. Accepted for publication September 3, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Long, E. O., D. N. Burshtyn, W. P. Clark, M. Peruzzi, S. Rajagopalan, S. Rojo, N. Wagtmann, C. C. Winter. 1997. Killer cell inhibitory receptors: diversity, specificity, and function. Immunol. Rev. 155:135.[Medline]
  2. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, M. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity 7:273.[Medline]
  3. Colonna, M., F. Navarro, T. Bellon, M. Llano, P. Garcia, J. Samaridis, L. Angman, M. Cella, M. A. Lopez-Botet. 1997. Common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809.[Abstract/Free Full Text]
  4. Borges, L., M.-L. Hsu, N. Fanger, M. Kubin, D. Cosman. 1997. A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J. Immunol. 159:5192.[Abstract]
  5. Moretta, A., M. Vitale, S. Sivori, C. Bottino, L. Morelli, R. Augugliaro, M. Barbaresi, D. Pende, E. Ciccone, M. Lopez-Botet, et al 1994. Human natural killer cell receptors for HLA-class I molecules: evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles. J. Exp. Med. 180:545.[Abstract/Free Full Text]
  6. Phillips, J. H., C. Chang, J. Mattson, J. E. Gumperz, P. Parham, L. L. Lanier. 1996. CD94 and a novel associated protein (94AP) form a NK cell receptor involved in the recognition of HLA-A, HLA-B and HLA-C allotypes. Immunity 5:163.[Medline]
  7. Lazetic, S., C. Chang, J. P. Houchins, L. L. Lanier, J. H. Phillips. 1996. Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. J. Immunol. 157:4741.[Abstract]
  8. Houchins, J. P., T. Yabe, C. McSherry, F. H. Bach. 1991. DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J. Exp. Med. 173:1017.[Abstract/Free Full Text]
  9. Plougastel, B., J. Trowsdale. 1997. Cloning of NKG2-F, a new member of the NKG2 family of human natural killer cell receptor genes. Eur. J. Immunol. 27:2835.[Medline]
  10. Ryan, J. C., W. E. Seaman. 1997. Divergent functions of lectin-like receptors on NK cells. Immunol. Rev. 155:79.[Medline]
  11. Houchins, J. P., L. L. Lanier, E. C. Niemi, J. H. Phillips, J. C. Ryan. 1997. Natural killer cell cytolytic activity is inhibited by NKG2-A and activated by NKG2-C. J. Immunol. 158:3603.[Abstract]
  12. Lanier, L. L., B. C. Corliss, J. Wu, C. Leong, J. H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391:703.[Medline]
  13. Perez Villar, J. J., I. Melero, F. Navarro, M. Carretero, T. Bellon, M. Llano, M. Colonna, D. E. Geraghty, M. Lopez-Botet. 1997. The CD94-NKG2-A inhibitory receptor complex is involved in natural killer cell-mediated recognition of cells expressing HLA-G1. J. Immunol. 158:5736.[Abstract]
  14. Soderstrom, K., B. Corliss, L. L. Lanier, J. H. Phillips. 1997. CD94/NKG2 is the predominant inhibitory receptor involved in recognition of HLA-G by decidual and peripheral blood NK cells. J. Immunol. 159:1072.[Abstract]
  15. Borrego, F., M. Ulbrecht, E. H. Weiss, J. E. Coligan, A. G. Brooks. 1998. Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell-mediated lysis. J. Exp. Med. 187:813.[Abstract/Free Full Text]
  16. Braud, V. M., D. S. J. Allan, C. A. O’Callaghan, K. Söderström, A. D’Andrea, G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795.[Medline]
  17. Lee, N., M. Llano, M. Carretero, A. Ishitani, F. Navarro, M. Lopez-Botet, D. E. Geraghty. 1998. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. USA 95:5199.[Abstract/Free Full Text]
  18. Anderson, K. S., J. Alexander, M. Wei, P. Cresswell. 1993. Intracellular transport of class I MHC molecules in antigen processing mutant cell lines. J. Immunol. 151:3407.[Abstract]
  19. Zappacosta, F., F. Borrego, A. G. Brooks, K. C. Parker, J. E. Coligan. 1997. Peptides isolated from HLA-Cw*0304 confer different degrees of protection from natural killer cell-mediated lysis. Proc. Natl. Acad. Sci. USA 94:6313.[Abstract/Free Full Text]
  20. Parker, K. C., M. DiBrino, L. Hull, J. E. Coligan. 1992. The ß2-microglobulin dissociation rate is an accurate measure of the stability of MHC class I heterotrimers and depends on which peptide is bound. J. Immunol. 149:1896.[Abstract]
  21. Brooks, A. G., P. E. Posch, C. J. Scorzelli, F. Borrego, J. E. Coligan. 1997. NKG2A complexed with CD94 defines a novel inhibitory natural killer cell receptor. J. Exp. Med. 185:795.[Abstract/Free Full Text]
  22. DiBrino, M., K. C. Parker, J. Shiloach, M. Knierman, J. Lukszo, R. V. Turner, W. E. Biddison, J. E. Coligan. 1993. Endogenous peptides bound to HLA-A3 possess a specific combination of anchor residues that permit identification of potential antigenic peptides. Proc. Natl. Acad. Sci. USA 90:1508.[Abstract/Free Full Text]
  23. Braud, V., E. Y. Jones, A. McMichael. 1997. The human major histocompatibility complex class Ib molecule HLA-E binds signal sequence-derived peptides with primary anchor residues at positions 2 and 9. Eur. J. Immunol. 27:1164.[Medline]
  24. Braud, V. M., D. S. J. Allan, D. Wilson, A. J. McMichael. 1998. TAP- and tapasin-dependent HLA-E surface expression correlates with the binding of an MHC class I leader peptide. Curr. Biol. 8:1.[Medline]
  25. Ulbrecht, M., S. Modrow, R. Srivastava, P. A. Peterson, E. H. Weiss. 1998. Interaction of HLA-E with peptides and the peptide transporter in vitro: implications for its function in antigen presentation. J. Immunol. 160:4375.[Abstract/Free Full Text]
  26. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, M. M. Davis. 1996. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.[Abstract/Free Full Text]
  27. O’Callaghan, C. A., J. Tormo, B. E. Willcox, V. M. Braud, B. K. Jakobsen, D. I. Stuart, A. J. McMichael, J. I. Bell, E. Y. Jones. 1998. Structural features impose tight peptide binding specificity in the nonclassical MHC molecule HLA-E. Mol. Cell 1:531.[Medline]
  28. Ulbrecht, M., J. Kellermann, J. P. Johnson, E. H. Weis. 1992. Impaired intracellular transport and cell surface expression of nonpolymorphic HLA-E: evidence for inefficient peptide binding. J. Exp. Med. 176:1083.[Abstract/Free Full Text]
  29. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach, K. L. Arnett, A. D’Andrea, J. H. Phillips, L. L. Lanier, P. Parham. 1998. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7:739.
  30. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-gamma. Annu. Rev. Immunol. 15:749.[Medline]
  31. Mingari, M. C., M. Ponte, S. Bertone, F. Schiavetti, C. Vitale, R. Bellomo, A. Moretta, L. Moretta. 1998. HLA class I-specific inhibitory receptors in human T lymphocytes: interleukin 15-induced expression of CD94/NKG2A in superantigen- or alloantigen-activated CD8+ T cells. Proc. Natl. Acad. Sci. USA 95:1172.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Anticancer ResHome page
Y. KAWAGUCHI, K. KONO, Y. MIZUKAMI, K. MIMURA, and H. FUJII
Mechanisms of Escape from Trastuzumab-mediated ADCC in Esophageal Squamous Cell Carcinoma: Relation to Susceptibility to Perforin-granzyme
Anticancer Res, June 1, 2009; 29(6): 2137 - 2146.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lo Monaco, L. Sibilio, E. Melucci, E. Tremante, M. Suchanek, V. Horejsi, A. Martayan, and P. Giacomini
HLA-E: Strong Association with {beta}2-Microglobulin and Surface Expression in the Absence of HLA Class I Signal Sequence-Derived Peptides
J. Immunol., October 15, 2008; 181(8): 5442 - 5450.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. J. Petrie, C. S. Clements, J. Lin, L. C. Sullivan, D. Johnson, T. Huyton, A. Heroux, H. L. Hoare, T. Beddoe, H. H. Reid, et al.
CD94-NKG2A recognition of human leukocyte antigen (HLA)-E bound to an HLA class I leader sequence
J. Exp. Med., March 17, 2008; 205(3): 725 - 735.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Ward, M. Bonaparte, J. Sacks, J. Guterman, M. Fogli, D. Mavilio, and E. Barker
HIV modulates the expression of ligands important in triggering natural killer cell cytotoxic responses on infected primary T-cell blasts
Blood, August 15, 2007; 110(4): 1207 - 1214.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Masilamani, C. Nguyen, J. Kabat, F. Borrego, and J. E. Coligan
CD94/NKG2A Inhibits NK Cell Activation by Disrupting the Actin Network at the Immunological Synapse
J. Immunol., September 15, 2006; 177(6): 3590 - 3596.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Derre, M. Corvaisier, B. Charreau, A. Moreau, E. Godefroy, A. Moreau-Aubry, F. Jotereau, and N. Gervois
Expression and Release of HLA-E by Melanoma Cells and Melanocytes: Potential Impact on the Response of Cytotoxic Effector Cells.
J. Immunol., September 1, 2006; 177(5): 3100 - 3107.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. S. Clements, L. Kjer-Nielsen, L. Kostenko, H. L. Hoare, M. A. Dunstone, E. Moses, K. Freed, A. G. Brooks, J. Rossjohn, and J. McCluskey
Crystal structure of HLA-G: A nonclassical MHC class I molecule expressed at the fetal-maternal interface
PNAS, March 1, 2005; 102(9): 3360 - 3365.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. I. Bonaparte and E. Barker
Killing of human immunodeficiency virus-infected primary T-cell blasts by autologous natural killer cells is dependent on the ability of the virus to alter the expression of major histocompatibility complex class I molecules
Blood, October 1, 2004; 104(7): 2087 - 2094.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. S. Huang, P. Borszcz, S. Sidobre, M. Kronenberg, and K. P. Kane
CD1d1 Displayed on Cell Size Beads Identifies and Enriches an NK Cell Population Negatively Regulated by CD1d1
J. Immunol., May 1, 2004; 172(9): 5304 - 5312.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. A. Bland, M. K. Lemberg, A. J. McMichael, B. Martoglio, and V. M. Braud
Requirement of the Proteasome for the Trimming of Signal Peptide-derived Epitopes Presented by the Nonclassical Major Histocompatibility Complex Class I Molecule HLA-E
J. Biol. Chem., September 5, 2003; 278(36): 33747 - 33752.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. D. Miller, D. A. Weber, C. Ibegbu, J. Pohl, J. D. Altman, and P. E. Jensen
Analysis of HLA-E Peptide-Binding Specificity and Contact Residues in Bound Peptide Required for Recognition by CD94/NKG2
J. Immunol., August 1, 2003; 171(3): 1369 - 1375.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. G. Shilling, K. L. McQueen, N. W. Cheng, J. A. Shizuru, R. S. Negrin, and P. Parham
Reconstitution of NK cell receptor repertoire following HLA-matched hematopoietic cell transplantation
Blood, May 1, 2003; 101(9): 3730 - 3740.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Gunturi, R. E. Berg, and J. Forman
Preferential Survival of CD8 T and NK Cells Expressing High Levels of CD94
J. Immunol., February 15, 2003; 170(4): 1737 - 1745.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. O. Flores-Villanueva, H. Hendel, S. Caillat-Zucman, J. Rappaport, A. Burgos-Tiburcio, S. Bertin-Maghit, J. A. Ruiz-Morales, M. E. Teran, J. Rodriguez-Tafur, and J.-F. Zagury
Associations of MHC Ancestral Haplotypes with Resistance/Susceptibility to AIDS Disease Development
J. Immunol., February 15, 2003; 170(4): 1925 - 1929.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. O. Long and S. Rajagopalan
Stress Signals Activate Natural Killer Cells
J. Exp. Med., December 2, 2002; 196(11): 1399 - 1402.
[Full Text] [PDF]


Home page
JEMHome page
J. Michaelsson, C. Teixeira de Matos, A. Achour, L. L. Lanier, K. Karre, and K. Soderstrom
A Signal Peptide Derived from hsp60 Binds HLA-E and Interferes with CD94/NKG2A Recognition
J. Exp. Med., December 2, 2002; 196(11): 1403 - 1414.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Radaev, M. Kattah, Z. Zou, M. Colonna, and P. D. Sun
Making Sense of the Diverse Ligand Recognition by NKG2D
J. Immunol., December 1, 2002; 169(11): 6279 - 6285.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. C. Hsu, X.-R. Liu, A. Selvakumar, E. Mickelson, R. J. O'Reilly, and B. Dupont
Killer Ig-Like Receptor Haplotype Analysis by Gene Content: Evidence for Genomic Diversity with a Minimum of Six Basic Framework Haplotypes, Each with Multiple Subsets
J. Immunol., November 1, 2002; 169(9): 5118 - 5129.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. G. Shilling, N. Young, L. A. Guethlein, N. W. Cheng, C. M. Gardiner, D. Tyan, and P. Parham
Genetic Control of Human NK Cell Repertoire
J. Immunol., July 1, 2002; 169(1): 239 - 247.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Dulphy, C. Rabian, C. Douay, O. Flinois, S. Laoussadi, J. Kuipers, R. Tamouza, D. Charron, and A. Toubert
Functional modulation of expanded CD8+ synovial fluid T cells by NK cell receptor expression in HLA-B27-associated reactive arthritis
Int. Immunol., May 1, 2002; 14(5): 471 - 479.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Sharland, A. Patel, J. H. Lee, A. E. Cestra, S. Saidman, and G. L. Waneck
Genetically Modified HLA Class I Molecules Able to Inhibit Human NK Cells Without Provoking Alloreactive CD8+ CTLs
J. Immunol., April 1, 2002; 168(7): 3266 - 3274.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Barakonyi, K. T. Kovacs, E. Miko, L. Szereday, P. Varga, and J. Szekeres-Bartho
Recognition of Nonclassical HLA Class I Antigens by {gamma}{delta} T Cells During Pregnancy
J. Immunol., March 15, 2002; 168(6): 2683 - 2688.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. P. Shum, L. R. Flodin, D. G. Muir, R. Rajalingam, S. I. Khakoo, S. Cleland, L. A. Guethlein, M. Uhrberg, and P. Parham
Conservation and Variation in Human and Common Chimpanzee CD94 and NKG2 Genes
J. Immunol., January 1, 2002; 168(1): 240 - 252.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
N. Matsumoto, K. Tajima, M. Mitsuki, and K. Yamamoto
H-2 allele specificity of the NK cell C-type lectin-like MHC class I receptor Ly49A visualized by soluble Ly49A tetramer
Int. Immunol., May 1, 2001; 13(5): 615 - 623.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Gardiner, L. A. Guethlein, H. G. Shilling, M. Pando, W. H. Carr, R. Rajalingam, C. Vilches, and P. Parham
Different NK Cell Surface Phenotypes Defined by the DX9 Antibody Are Due to KIR3DL1 Gene Polymorphism
J. Immunol., March 1, 2001; 166(5): 2992 - 3001.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Gays, K. P. Fraser, J. A. Toomey, A. G. Diamond, M. M. Millrain, P. J. Dyson, and C. G. Brooks
Functional Analysis of the Molecular Factors Controlling Qa1-Mediated Protection of Target Cells from NK Lysis
J. Immunol., February 1, 2001; 166(3): 1601 - 1610.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. H. Chung, K. Natarajan, L. F. Boyd, J. Tormo, R. A. Mariuzza, W. M. Yokoyama, and D. H. Margulies
Mapping the Ligand of the NK Inhibitory Receptor Ly49A on Living Cells
J. Immunol., December 15, 2000; 165(12): 6922 - 6932.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Watzl, C. C. Stebbins, and E. O. Long
Cutting Edge: NK Cell Inhibitory Receptors Prevent Tyrosine Phosphorylation of the Activation Receptor 2B4 (CD244)
J. Immunol., October 1, 2000; 165(7): 3545 - 3548.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. R. Kraft, R. E. Vance, J. Pohl, A. M. Martin, D. H. Raulet, and P. E. Jensen
Analysis of Qa-1b Peptide Binding Specificity and the Capacity of CD94/NKG2A to Discriminate between Qa-1-Peptide Complexes
J. Exp. Med., August 28, 2000; 192(5): 613 - 624.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Ulbrecht, S. Martinozzi, M. Grzeschik, H. Hengel, J. W. Ellwart, M. Pla, and E. H. Weiss
Cutting Edge: The Human Cytomegalovirus UL40 Gene Product Contains a Ligand for HLA-E and Prevents NK Cell-Mediated Lysis
J. Immunol., May 15, 2000; 164(10): 5019 - 5022.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. H. Idris, H. R. C. Smith, L. H. Mason, J. R. Ortaldo, A. A. Scalzo, and W. M. Yokoyama
The natural killer gene complex genetic locus Chok encodes Ly-49D, a target recognition receptor that activates natural killing
PNAS, May 25, 1999; 96(11): 6330 - 6335.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. L. Lanier
Natural killer cells fertile with receptors for HLA-G?
PNAS, May 11, 1999; 96(10): 5343 - 5345.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Stevens, R. C. Jones, R. S. Bordoli, J. Trowsdale, S. J. Gaskell, G. W. Butcher, and E. Joly
Peptide Specificity of RT1-A1c, an Inhibitory Rat Major Histocompatibility Complex Class I Natural Killer Cell Ligand
J. Biol. Chem., September 15, 2000; 275(38): 29217 - 29224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. R. Snyder, J. Wang, J. F. Waring, and G. D. Ginder
Identification of CCAAT Displacement Protein (CDP/cut) as a Locus-specific Repressor of Major Histocompatibility Complex Gene Expression in Human Tumor Cells
J. Biol. Chem., February 9, 2001; 276(7): 5323 - 5330.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brooks, A. G.
Right arrow Articles by Coligan, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brooks, A. G.
Right arrow Articles by Coligan, J. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS