| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Internal Medicine, Saga Medical School, Saga, 849, Japan; and
Amgen Institute, Ontario Cancer Institute and Departments of Medical Biophysics and Immunology, University of Toronto, Toronto, Ontario, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by lymph node cells in response to CII was also reduced.
CD28-deficient mice were either immunized four times with CII in CFA to
augment Ag loading or given low doses of IL-12 to enhance Th1 type
responses. Both treatments resulted in a very low incidence of CIA
development and minimal disease. CD28-deficient mice developed
arthritis from injection of lymph node cells from CII-immunized
wild-type mice, followed by immunization with CII in CFA. Taken
together, these results indicate that costimulation of CD28 cannot be
replaced by repeated activation through TCR or other costimulatory
molecules. Thus, CD28 plays a critical role in both cellular and
humoral immunity against CII and is indispensable for the development
of CIA. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Studies of CD28-/- gene-targeted mice have revealed that in the absence of CD28, T cell responses to mitogens in vitro are impaired, IgG Ab production in response to peptides or virus is reduced, and serum IgG1 levels are decreased (17). However, analyses of various autoimmune disease models using CD28-deficient mice have shown different and contradictory results. NOD mice lacking CD28 unexpectedly exhibited accelerated development of diabetes (18). Autoimmune myocarditis was induced with similar incidence in CD28-deficient and wild-type mice, although the severity was decreased in the mutants (19). These studies indicate that autoantigen-specific and pathologic T cells can be induced, at least in certain cases, in the absence of CD28. It was proposed that the absence of CD28 signaling might be overcome by other costimulatory molecules or that CD28 costimulatory signals might not be absolutely required in some circumstances, such as where there are high levels of cytokines, or in particular T cell subsets.
In this report, we have investigated the role of CD28 in the CIA model using CD28-deficient mice. The results show that CD28-deficient mice are highly resistant to the induction of CIA, even when reinforced immunization protocols are applied. The minimal response of T cells to type II collagen (CII) and the low IgM and IgG anti-CII Ab levels indicate that both cellular and humoral immunity against CII in CIA are highly dependent on costimulatory signaling through CD28.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD28-deficient mice (19) were backcrossed into the DBA/1 background (H-2q) for four generations and typed by PCR using ear biopsy-derived DNA (19). In all experiments, only CD28-/-, CD28+/-, and CD28+/+ littermates were used. All mice were 10 to 16 wk of age at the time of immunization. Animals were maintained in the Ontario Cancer Institute animal facility or the Saga Medical School animal facility. Care of animals was in accordance with the guidelines of the Canadian Medical Research Council and the Saga Medical School guidelines for animal experimentation.
Induction of CIA
Mice were immunized intradermally at the base of the tail with 150 µg of bovine CII (Elastin Products, Owensville, MO) emulsified with an equal volume of CFA, containing 200 µg of H37RA Mycobacterium tuberculosis (Difco, Detroit, MI). Mice were boosted by intradermal injection with 150 µg of bovine CII in CFA (IFA, Difco) on day 21. In one experiment, mice were immunized four times with CII in CFA to augment Ag priming. To address the role of IL-12 on the development of arthritis in CD28-deficient mice, mice were injected i.p. with 10 or 100 ng IL-12 on days 1–5 and 21–25 after the initial challenge (20). Arthritis development was checked by inspection three times a week, and the inflammation of four paws was graded from 0 to 3 as described previously (21, 22). Each paw was graded and the four scores were added such that the maximal score per mouse was 12. The arthritis index was calculated by dividing the total score of the experimental mice by the number of arthritic mice or the total number of mice.
Measurement of serum anti-CII Ab levels
The level of serum Abs to CII was measured by ELISA as described (22). Briefly, microtiter plates (Maxisorp, Nunc, Denmark) were coated with native bovine CII at 10 µg/ml overnight at 4°C. After washing, serum samples were added in serial dilution and incubated for 1 h at 37°C. After four washes, peroxidase-conjugated goat anti-mouse IgG (Biosource International, Camarillo, CA), IgG1, or IgG2a (Southern Biotechnology Associates, Birmingham, AL) was added and incubated for 1 h at 37°C. Ab binding was visualized using o-phenylenediamine (Sigma, St. Louis, MO). A standard serum composed of a mixture of sera from arthritic mice was added to each plate in serial dilutions and a standard curve was constructed. The standard serum was defined as 100 U and Ab titers of serum samples were calculated from the standard curve.
Histologic examination
Joint tissues from CD28+/- and CD28-/- DBA/1 mice were excised 9 to 10 wk after immunization and fixed in 10% buffered formalin, decalcified in 10% EDTA, embedded in paraffin, sectioned, and stained with hematoxylin and eosin.
Cytokine production of lymph node cells
IFN-, IL-4, and IL-10 production by LN cells was measured as
previously described (22). Fourteen days after immunization, LN
(inguinal, paraaortic, axillary, and popliteal) were removed, and the
cells were resuspended in DMEM supplemented with 5 x
10-5 M 2-ME, 20 mM HEPES, and 4% autologous mouse serum.
Cells were seeded at 4 x 106/well in 96-well
flat-bottom microtiter plates (Nunc) and stimulated with denatured
bovine CII (dCII) at 200 µg/ml for 48 or 72 h. Cytokines
produced in the culture supernatant was measured using an ELISA kit
(IFN-; Genzyme, Cambridge, MA; IL-4 and IL-10: Biosource
International) according to the manufacturer’s instructions.
RT-PCR
CD28+/- DBA/1 and CD28-/- DBA/1 mice
were immunized with CII and CFA and draining LN were removed after 14
or 21 days. Total RNA was extracted with TRI-ZOL reagent (Life
Technologies, Gaithersburg, MD). cDNA was obtained by reverse
transcription of 4 µg of total RNA using oligo(dT) and a RT-PCR kit
(Pharmacia Biotech, Uppsala, Sweden). PCR was done by four different
conditions to compare detectable level of each samples, namely using 12
or 36% of the reaction sample as the template and with 30 or 35
cycles. Primers used were as follows: ß-actin, GTGGGCCGCTCTAGGCACCAA
and CTCTTTGATGTCACGCACGATTTC; IFN-,
TGCATCTTGGCTTTGCAGCTCTTCCTCATGGC and TGGACCTGTGGGTTGTTGACCTCAAACTTGGC;
IL-4, ATGGGTCTCAACCCCCAGCTAGT and GCTCTTTAGGCTTTCCAGGAAGTC.
Reaction conditions were the following: 94°C for 40 s; 55°C
for 60 s; 72°C for 90 s. PCR products were separated on 2%
agarose gels and visualized with ethidium bromide.
Adoptive transfer of arthritis
DBA/1 mice were immunized with CII and CFA. After 14 days, LN
were removed and cell suspensions were prepared in HBSS. In some
experiments, B cells were further depleted by magnetic cell sorting
with anti-mouse CD45R Ab (RA3-6B2, Cedarlane, Hornby, Canada)
coupled to magnetic beads (Biomag, Perseptive Biosystems, Framingham,
MA). LN cells were resuspended in DMEM-5% FCS at 2 x
106 cells/ml and mixed with beads previously coupled with
anti-CD45R Abs at a cell-beads ratio of 1:50. The cell suspensions
were incubated for 30 min on ice, and B cells bound to beads were
magnetically separated. The resultant cell population contained >93%
TCR-
ß+ cells and <3% surface IgM+ cells as
determined by flow cytometric analysis. Whole LN cells or purified T
cells were resuspended in HBSS and injected i.p. into
CD28-/- DBA/1 mice. Recipient mice were then immunized
with CII and CFA on the next day, and arthritis development was
observed.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD28-/-, CD28+/-, and
CD28+/+ littermate mice were immunized with CII and
observed for signs of arthritis. As shown in Table I
, CD28-/- DBA/1 mice never
developed arthritis in 3 experiments using a total of 19 mutant mice.
CD28+/- mice and CD28+/+ mice developed
arthritis with similar incidence and severity (Table I and Fig. 1). Histologic examination revealed that
in contrast to the typical arthritis characterized by the dense
cellular infiltration and bone erosion observed in the joints of
CD28+/+ and CD28+/- mice, all joints examined
in five CD28-/- mice showed no signs of inflammation.
|
|
, A and
C, anti-CII Ab levels of IgG and IgM isotypes were
markedly decreased in CD28-/- mice as compared with
CD28+/+ and CD28+/- mice throughout the course
of CIA. IgG anti-CII Ab levels were similar between
CD28+/+ and CD28+/- mice (Fig. 2A).
It has been shown that CD28-/- mice have reduced serum
IgG1 levels (17) and reduced production of IgG1 Ab in response to Ag
priming (19). We therefore evaluated the levels of IgG1 and IgG2a
subclass Abs against CII in CD28+/- and
CD28-/- mice (Fig. 2B). CD28-/-
mice showed markedly decreased levels of both subclasses. However, in
CD28-/- mice, IgG2a anti-CII levels were
significantly higher than IgG1 anti-CII levels, whereas both
subclasses showed similar levels in CD28+/+ and
CD28+/- mice. These results imply that the CD28
costimulatory molecule is critical in IgG and IgM anti-CII Ab
production and in the development of CIA and that the production of
IgG1 anti-CII Ab was severely depressed in CD28-/-
mice.
|
To analyze Ag-specific T cell responses in CD28-/-
DBA/1 mice, IFN- production by LN cells in response to dCII was
examined. Mice were killed on day 14 after immunization and numbers of
viable LN cells were counted. Cells were stimulated with dCII, and
IFN- in the supernatant was measured. Results from two
representative experiments are shown in Fig. 3. LN cells from CD28-/-
mice produced a markedly decreased amount of IFN- in response to
dCII compared with that produced by cells from CD28+/- or
CD28+/+ mice. Furthermore, the total number of LN cells
recovered from CD28-/- mice was 
50% that of control
mice (Fig. 3). We also measured IL-4 and IL-10 production by LN cells.
However, these Th2 cytokines were undetectable in culture supernatant
of LN cells stimulated with dCII from CD28-/- as well as
CD28+/- mice.
|
and IL-4 were examined in the LN of CD28-/-
and CD28+/- DBA/1 mice after immunization with CII. As
shown in Fig. 4, no differences were
observed in the expression of IFN- in CD28-/- and
CD28+/- mice, and although one CD28-/- mouse
showed decreased level, IL-4 expression could be detected in
CD28-/- as well as CD28+/- mice. These
results suggest that the expansion and IFN- production of LN cells
in response to CII is defective in CD28-/- mice.
|
Previous studies have shown that in some cases, the absence of
costimulation via CD28 can be overcome by prolonged stimulation through
the TCR (23) and that CD28-/- T cells can initiate but
not sustain a primary Ag-specific response (24). We examined whether
CD28-/- DBA/1 mice developed CIA following repeated
immunizations. Mice were immunized with CII in CFA four times (on days
0, 16, 32, and 48). However, only 1 of 13 CD28-/- mice
developed mild and transient arthritis (grade 1, from day 56 to day 65,
Table II). IgG anti-CII Ab levels of
CD28-/- mice were increased compared with those of mice
immunized with a regular protocol (Figs. 2
and 5). The one CD28-/- mouse
that developed arthritis showed the highest anti-CII level among
all CD28-/- mice (Fig. 5). IgG subclass anti-CII Ab
levels showed that IgG1 anti-CII Abs were lower than IgG2a Abs in
CD28-/- mice (day 42, IgG1 2.0 ± 0.8 U, IgG2a
20.6 ± 7.0 U, p < 0.001), whereas both Ab levels
were not different in CD28+/- mice (IgG1 92.4 ± 16.4
U, IgG2a 101.0 ± 29.3 U). These results indicate that
CD28-/- mice are still resistant to the development of
CIA even after repeated immunization with CII plus CFA.
|
|
). IgG
anti-CII Ab levels were not increased in IL-12-injected
CD28-/- mice as compared with levels in mice that
underwent the standard immunization protocol (data not shown). These
results indicate that IL-12 fails to enhance anti-CII Ab production
or induce arthritis in CD28-/- DBA/1 mice. Adoptive transfer of arthritis by DBA/1 lymph node cells to CD28-/- DBA/1 mice
To directly investigate whether the resistance of
CD28-/- mice to CIA depends on the function of lymphoid
cells, LN cells, or purified T cells from CII-immunized DBA/1 mice were
injected into naive CD28-/- mice, then recipient mice
were immunized with CII. CD28-/- mice transferred with
whole LN cells from wild-type mice developed moderate arthritis after 6
to 9 days and lasted for >10 days, on the other hand, mice transferred
purified T cells show low incidence and mild arthritis (Table III). These results indicate that
CD28-/- mice can develop arthritis in the presence of T
cells and B cells from CII-primed CD28+/+ mice and that T
cells only may transfer arthritis but with less efficacy.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
by LN cells in response to CII. We also observed
low IgM anti-CII Ab levels in CD28-deficient mice, in contrast to
previous reports where serum IgM levels and IgM Ab production against
vesicular stomatitis virus were normal (19). Furthermore,
CD28+/- mice showed mild decreased IgM anti-CII Ab
levels as compared with those of CD28+/+ mice (Fig. 2B). These data suggest that IgM Ab production, at least to
some Ags or in certain genetic background, may be regulated by CD28.
Our results indicate that both the cellular and humoral immune
responses to CII are regulated by CD28 costimulation. They agree with
previous studies of CIA in rats (15) and mice (16), in both of which
the administration of CTLA4-Ig blocked development of arthritis and
significantly reduced anti-CII Ab levels and T cell response to
CII. They also agree with studies of various autoimmune disease models
using CTLA4-Ig (11, 12, 13, 14, 25, 26) but differ from some studies in which
CD28-deficient mice were used (18, 19). There may be a fundamental
difference between the congenital loss of CD28 and treatment with
CTLA4-Ig, or the discrepancy may be due to variation among disease
models. Functional redundancy often exists in knockout mice, and the
role of a particular molecule can be compensated for or overcome by
other molecules. For example, we have previously shown that
CD4-deficient mice develop CIA with normal incidence and severity and
that TCR-ß+CD4-CD8- T cells
can replace the role of CD4+ T cells in these mice (21).
This result contrasts with the demonstration that anti-CD4
treatment abolishes development of CIA in normal mice (27, 28). The
present study of CD28-deficient mice suggests an indispensable role for
CD28 in triggering CIA in which CD28-mediated activation cannot be
substituted for by other costimulatory molecules. Yashiro et al. (29)
recently showed the differences between CD28 and other costimulatory
molecules in the capacity to activate naive T cells. Although CD28 and
other costimulatory molecules, including CD2, CD5, CD9, CD11a, or CD44,
induced T cell proliferation, only CD28 induced IL-2 production and
prevented apoptosis after activation. These results support the
nonredundant function of CD28 in the induction and survival of
Ag-specific T cells after active immunization. In contrast to our results, it has been shown that CD28-deficient NOD mice develop accelerated and severe diabetes (18). The difference may first exist in the induction of disease. CIA is induced by immunization with CII, whereas NOD mice spontaneously develop disease. In the latter case, autoantigens might be expressed for a long time, presumably from birth, which may lead to the extended exposure of autoantigens to T cells, resulting in the activation of Ag-specific T cells in the absence of CD28. Another possibility may be due to the different nature of Ag in its efficacy to induce T cell activation. The signal in the absence of CD28 may be below the level to activate and expand T cells specific to CII, whereas it may reach the threshold to activate Ag-specific T cells and proceed following disease process in NOD mice.
We further examined the susceptibility of CD28-deficient DBA/1 mice to
CIA by reinforced induction protocols. Four immunizations with CII in
CFA resulted in a minimal response. The arthritic mouse showed IgG
anti-CII Ab levels comparable to control CD28+/- mice;
nevertheless, the disease of the arthritic mouse subsided within 10
days. These results suggest that the function of CD28 in disease
development is not limited to the promotion of anti-CII Ab
production by B cells but includes the triggering of the inflammatory
action of various cellular components, presumably via cytokine
production. We also tested whether a low dose of IL-12 rendered
CD28-deficient mice susceptible to CIA. IL-12 promotes Th1 type T cell
responses and has been shown to potentiate various autoimmune diseases
(30). In the CIA model, it has been reported that the administration of
IL-12 together with CII plus IFA induces severe arthritis in DBA/1 mice
(20, 31). Conversely, IL-12-deficient mice are resistant to CIA (33).
Furthermore, it has been reported that Th1 responses are predominant at
the time of onset of arthritis and that the cytokine environment (high
levels of IFN-) influences the T cells responding to CII to become
type 1 T cells (33, 34). These studies indicate the importance of Th1
type responses in cellular immunity against CII. However,
CD28-deficient mice treated with IL-12 developed CIA of very low
incidence and minimal severity, and IgG anti-CII Ab levels were not
significantly increased. Szeliga et al. (31) showed that the enhancing
effect of IL-12 on anti-CII Ab production and incidence of CIA was
not observed in B10.Q mice, suggesting genetic factors other than MHC
is responsible for this phenomenon. Our data indicate that
CD28-deficient mice are resistant to IL-12-induced enhancement of
anti-CII responses and that IL-12 cannot overcome the absence of
CD28.
CD28-deficient mice and mice injected with CTLA4-Ig exhibit decreased
production of Th2-induced IgG1 Abs (6, 17). Th2 responses have
generally been reported to be severely impaired in CD28-deficient or
CTLA4-Ig-treated mice, consistent with the demonstration that CD28
promotes Th2 cytokine production (35). However, in contrast, a recent
study showed unimpaired Th2 responses in a different strain of
CD28-deficient mice, suggesting that the effect of blocking CD28 in the
Th1/Th2 balance varies depending on the genetic background of the mouse
and the type of immunogen (36). Our results show that the IgG1
anti-CII Ab level was lower than that of IgG2a in
CD28-/- DBA/1 mice, whereas both subclasses were at a
similar level in CD28+/- DBA/1 mice. We measured Th2
cytokine production of LN cells in response to CII but failed to detect
IL-4 or IL-10 in response to CII in CD28-/- as well as
CD28+/- mice. In addition, there is no differences in the
expression of IFN- mRNAs in the LNs from CD28+/- and
CD28-/- mice, and only slight reduction of IL-4
expression was observed in limited number of CD28-/-
mice. In a previous study, IL-4, IL-10, and IFN- expressions have
been observed by immunization with CFA alone (33), which suggests
macrophages activated by adjuvant may induce those cytokines.
Furthermore, these cytokine expressions do not necessarily indicate
profile of CII-reactive T cells, since CII-reactive T cells may
constitute only a small population in the LNs. Our results indicate
that although we could not reveal an altered Th1/Th2 cytokine profile
of T cells, CD28-deficient DBA/1 mice have mounted severely impaired
Th2 responses as suggested from the IgG1/IgG2a anti-CII Ab profile.
However, it is unclear whether Th1/Th2 imbalance plays any role in the
resistance of CD28-deficient mice to CIA since, as mentioned before,
Th1 responses are predominant and play a major role in the initiation
of CIA.
In conclusion, CD28 is an essential prerequisite for cellular and humoral immunity against CII, and CD28 costimulation is required for the development of CIA in DBA/1 mice. Activation of CII-specific T cells to initiate CIA requires costimulatory signals provided by CD28 which cannot be replaced by other costimulatory molecules or repeated administration of the Ag.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tak Wah Mak, Amgen Institute, 620 University Ave., Toronto, Ontario, Canada M5G 2 M9.
3 Abbreviations used in this paper: NOD, nonobese diabetes; CIA, collagen-induced arthritis; CII, collagen type II; dCII, denatured collagen type II; LN, lymph node.
Received for publication February 19, 1998. Accepted for publication September 16, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  L. Chen, W. Cheng, P. Shivshankar, L. Lei, X. Zhang, Y. Wu, I-T. Yeh, and G. Zhong Distinct Roles of CD28- and CD40 Ligand-Mediated Costimulation in the Development of Protective Immunity and Pathology during Chlamydia muridarum Urogenital Infection in Mice Infect. Immun., July 1, 2009; 77(7): 3080 - 3089. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. O'Neill, Y. Cao, K. M. Hamel, P. D. Doodes, G. Hutas, and A. Finnegan Expression of CD80/86 on B Cells Is Essential for Autoreactive T Cell Activation and the Development of Arthritis J. Immunol., October 15, 2007; 179(8): 5109 - 5116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Singh, P. R. Chandler, Y. Seki, B. Baban, M. Takezaki, D. J. Kahler, D. H. Munn, C. P. Larsen, A. L. Mellor, and M. Iwashima Role of CD28 in fatal autoimmune disorder in scurfy mice Blood, August 15, 2007; 110(4): 1199 - 1206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lyddane, B. U. Gajewska, E. Santos, P. D. King, G. C. Furtado, and M. Sadelain Cutting Edge: CD28 Controls Dominant Regulatory T Cell Activity during Active Immunization J. Immunol., March 15, 2006; 176(6): 3306 - 3310. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cuzzocrea, E. Ayroldi, R. Di Paola, M. Agostini, E. Mazzon, S. Bruscoli, T. Genovese, S. Ronchetti, A. P. Caputi, and C. Riccardi Role of glucocorticoid-induced TNF receptor family gene (GITR) in collagen-induced arthritis FASEB J, August 1, 2005; 19(10): 1253 - 1265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Taneja, N. Taneja, M. Behrens, M. M. Griffiths, H. S. Luthra, and C. S. David Requirement for CD28 May Not Be Absolute for Collagen-Induced Arthritis: Study with HLA-DQ8 Transgenic Mice J. Immunol., January 15, 2005; 174(2): 1118 - 1125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. P. de Jong, S. T. Rietdijk, W. A. Faubion, A. C. Abadia-Molina, K. Clarke, E. Mizoguchi, J. Tian, T. Delaney, S. Manning, J.-C. Gutierrez-Ramos, et al. Blocking inducible co-stimulator in the absence of CD28 impairs Th1 and CD25+ regulatory T cells in murine colitis Int. Immunol., February 1, 2004; 16(2): 205 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Poussin, E. Tuzun, E. Goluszko, B. G. Scott, H. Yang, J. U. Franco, and P. Christadoss B7-1 Costimulatory Molecule Is Critical for the Development of Experimental Autoimmune Myasthenia Gravis J. Immunol., April 15, 2003; 170(8): 4389 - 4396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Peng, C. Liu, D. Liu, C. Ren, W. Li, Z. Wang, N. Xing, C. Xu, X. Chen, C. Ji, et al. Effects of B7-blocking agent and/or CsA on induction of platelet-specific T-cell anergy in chronic autoimmune thrombocytopenic purpura Blood, April 1, 2003; 101(7): 2721 - 2726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Iwai, Y. Kozono, S. Hirose, H. Akiba, H. Yagita, K. Okumura, H. Kohsaka, N. Miyasaka, and M. Azuma Amelioration of Collagen-Induced Arthritis by Blockade of Inducible Costimulator-B7 Homologous Protein Costimulation J. Immunol., October 15, 2002; 169(8): 4332 - 4339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Yamada, A. D. Salama, and M. H. Sayegh The Role of Novel T Cell Costimulatory Pathways in Autoimmunity and Transplantation J. Am. Soc. Nephrol., February 1, 2002; 13(2): 559 - 575. [Full Text] [PDF]
|
|
|
|
 |
|
 B. Salomon, L. Rhee, H. Bour-Jordan, H. Hsin, A. Montag, B. Soliven, J. Arcella, A. M. Girvin, S. D. Miller, and J. A. Bluestone Development of Spontaneous Autoimmune Peripheral Polyneuropathy in B7-2-deficient NOD Mice J. Exp. Med., September 4, 2001; 194(5): 677 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Liu, K. Geboes, P. Hellings, P. Maerten, H. Heremans, P. Vandenberghe, L. Boon, P. van Kooten, P. Rutgeerts, and J. L. Ceuppens B7 Interactions with CD28 and CTLA-4 Control Tolerance or Induction of Mucosal Inflammation in Chronic Experimental Colitis J. Immunol., August 1, 2001; 167(3): 1830 - 1838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Pechhold, N. B. Patterson, C. Blum, C. L. Fleischacker, B. O. Boehm, and D. M. Harlan Low Dose Streptozotocin-Induced Diabetes in Rat Insulin Promoter-mCD80-Transgenic Mice Is T Cell Autoantigen-Specific and CD28 Dependent J. Immunol., February 15, 2001; 166(4): 2531 - 2539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Saegusa, N. Ishimaru, K. Yanagi, N. Haneji, M. Nishino, M. Azuma, I. Saito, and Y. Hayashi Autoantigen-Specific CD4+CD28low T Cell Subset Prevents Autoimmune Exocrinopathy in Murine Sjogren's Syndrome J. Immunol., August 15, 2000; 165(4): 2251 - 2257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Thornton, G. P. Boivin, K. N. Kim, F. D. Finkelman, and R. Hirsch Heterogeneous Effects of IL-2 on Collagen-Induced Arthritis J. Immunol., August 1, 2000; 165(3): 1557 - 1563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. T. Chang, B. M. Segal, and E. M. Shevach Role of Costimulation in the Induction of the IL-12/IL-12 Receptor Pathway and the Development of Autoimmunity J. Immunol., January 1, 2000; 164(1): 100 - 106. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
