The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Behar, S. M.
Right arrow Articles by Brenner, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Behar, S. M.
Right arrow Articles by Brenner, M. B.
The Journal of Immunology, 1999, 162: 161-167.
Copyright © 1999 by The American Association of Immunologists

Diverse TCRs Recognize Murine CD11

Samuel M. Behar2,*, T. A. Podrebarac*, C. J. Roy*, C. R. Wang{dagger} and M. B. Brenner*

* Division of Rheumatology, Immunology and Allergy, Brigham and Women’s Hospital, and Harvard Medical School, Boston, MA 02115; and {dagger} Gwen Knapp Center for Lupus and Immunology Research, University of Chicago, Chicago, IL 60637


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human and murine T cells that specifically recognize CD1d and produce IL-4 and IFN-{gamma} play a role in immunoregulation and tumor rejection. In the mouse, most CD1d1-reactive T cells described express an invariant V{alpha}14-J{alpha}281 TCR associated with TCR ß-chains of limited diversity. Similarly, human CD1d-reactive T cells express a highly restricted TCR repertoire. Here we report the unexpected result that in mice immunized with CD1d1-bearing transfectant cells, a diverse repertoire of TCRs was expressed by CD1d1-reactive T cell clones isolated by limiting dilution without preselection for NK1 expression. Only 3 of 10 CD1d1-reactive T cell clones expressed the invariant V{alpha}14-J{alpha}281 TCR{alpha} rearrangement. T cells expressing V{alpha}10, -11, -15, and -17, and having non-germline-encoded nucleotides resulting in diverse V-J junctions were identified. Like CD1d1-reactive T cells expressing the invariant V{alpha}14-J{alpha}281 TCR {alpha}-chain, CD1d1-reactive clones with diverse TCRs produced both Type 1 (IFN-{gamma}) and Type 2 (IL-4, IL-10) cytokines. This establishes the existence of significant diversity in the TCRs directly reactive to the CD1d1 protein. Our findings reveal that CD1d interacts with a broad array of TCRs, suggesting substantial redundancy and flexibility of the immune system in providing T cells serving the role(s) mediated by CD1d reactivity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CD1 genes, CD1A, -B, -C, -D, and -E in humans, and CD1D1 and CD1D2 in mice, define a lineage of Ag-presenting molecules distinct from those encoded in the MHC (1, 2). The CD1 proteins are markedly divergent in sequence from those encoded by MHC genes but share certain structural features with MHC class I as they fold in an overall topology similar to that of MHC class I proteins and are expressed as heterodimers associated with ß2-microglobulin (1, 3). While MHC I and MHC II molecules present peptide Ags to CD8+ and CD4+ T cells, respectively, CD1 presents nonpeptide Ags such as lipids and glycolipids to {alpha}ß TCR+ T cells (1, 2). For example, human CD1b and CD1c can present foreign mycobacterial lipid molecules, such as mycolic acids and lipoarabinomannan, to human CD4-CD8- {alpha}ß TCR+ T cells (4, 5, 6, 7, 8, 9). The processing and presentation of these Ags are independent of the transporter associated with Ag processing (TAP) and proceeds through an endosomal pathway that includes the MHC class II compartments in professional APCs (5, 9, 10). In addition to the presentation of exogenous lipid Ags to T cells, CD1 is also recognized by both human {alpha}ß and {gamma}{delta} T cells in the absence of exogenous Ag (11) (M.B.B., unpublished data). This direct recognition of CD1 by T cells has been referred to as "autoreactivity," although a role for endogenous cellular lipid molecules or exogenous lipids present in cell culture media has not been excluded.

The mouse genome encodes two CD1 genes (CD1D1 and CD1D2) likely to be the result of a gene duplication that are homologues of human CD1d (12, 13, 14). While the crystal structure of murine CD1d1 confirmed its overall similarity to MHC class I, the striking feature was a substantially larger Ag-binding groove that was lined almost exclusively with hydrophobic and nonpolar amino acids (3). These structural data, together with the identification of {alpha}-glycosylacylphytosphingosines as murine CD1 (mCD1)3-restricted Ags for NK T cells (15), supports the idea that mouse CD1, as first proposed for human CD1, may have evolved to present lipid Ags to T cells (4, 6, 8).

T cell hybridomas generated from NK1.1+ thymocytes recognized CD1 expressed on thymocytes, as well as CD1-transfected cell lines, in the absence of any exogenous Ag (16). NK1.1+ T cells use an invariant TCR {alpha}-chain that results from the recombination of V{alpha}14.1 (TCRAV14S1) with J{alpha}281 (TCRAJ15) and pairs with one of three Vß-chain families: Vß2, -7, or -8 (17, 18). NK1.1+ T cells release large amounts of IL-4 within hours of activation, and it has been proposed that this population of T cells may be the earliest source of IL-4 that could shift an immune responses toward a Th2 phenotype. However, it is now appreciated that NK1.1+ T cells have the capacity to produce IFN-{gamma}, indicating that their function is not exclusively in Th2 T cell responses and that their potential for various cytokine-mediated roles needs further study (19, 20, 21).

Given the broad diversity of T cells directed against CD1a, -b, and -c in humans, we sought to examine further the diversity and function of T cells reactive to mCD1. Thus, rather than select for study only those T cells that expressed V{alpha}14 TCRs or the NK1.1 marker, we stimulated murine splenic cells with CD1-expressing transfectants and established a panel of T cell clones that recognized CD1 directly. Although several V{alpha}14+ clones were obtained, a majority of the T cell clones derived used a diverse V{alpha} and Vß repertoire. These T cells were potent cytolytic T cells that also secreted large amounts of IL-10 and IFN-{gamma} upon specific activation, suggesting their potential for diverse roles in immunoregulation and host defense.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antibodies and antigens

The Abs M1/42.3.9.8.HLK (anti-MHC I), M5/114.15.2 (anti-MHC II), GK1.5 (anti-CD4), and 53-6.72 (anti-CD8{alpha}) were obtained from the American Type Culture Collection (Rockville, MD). Abs 53-5.8 (anti-CD8ß), H57-597 (anti-{alpha}ßTCR), GL3 (anti-{gamma}{delta} TCR), PK136 (anti-NK1.1), 5E6 (anti-Ly49C), 1B1 (anti-mCD1 (22)) were obtained from PharMingen (San Diego, CA). The hamster Abs 38-4.5 (IgG control), 3H3.23.2 and 5C6.4 (both anti-mCD1) were used as spent culture supernatants (46). The Abs 1H1 and 3C11 (rat anti-mCD1) were generously provided by Steve Balk (Beth Israel Hospital, Boston, MA), and 10A7 (anti-NKR-P1A/B) was a kind gift of James Ryan (University of California at San Francisco, San Francisco, CA). The mCD1-restricted peptide, p99a (EHDFHHIREWGNHK) (23), was synthesized by the Brigham and Women’s Hospital Biopolymer Laboratory.

Cell culture

RMA-S was grown in complete media consisting of RPMI 1640 media supplemented with 10 mM HEPES, 2 mM L-glutamine, 10 mM nonessential amino acids, 10 mM essential amino acids, 0.055 mM 2-ME (all from Life Technologies, Gaithersburg, MD), and 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT). All T cells were grown in complete media supplemented with 1.5 nM recombinant human IL-2 (gift of Ajinomoto, Kawasaki, Japan). T cell cloning was done by plating T cells at limiting dilution in round bottom plates in the presence of 2 x 105 mitomycin C-inactivated RMA-S.CD1d1 cells.

Transfections

The RMA-S cell line was derived by mutagenesis from a C57BL/6 T cell lymphoma cell line (RBL-5) and contains a mutant TAP2 gene, making these cells defective in the MHC class I Ag-processing pathway (24). Because these cells also lack MHC class II, they were selected as an APC to study CD1-restricted T cells. RMA-S cells were transfected with the expression vector pSR{alpha}-NEO (25) containing the mCD1D1 cDNA (kindly provided by Dr. Steve Balk, Beth Israel Hospital, Boston, MA) by electroporation. Stably transfected cells were first selected for G418 resistance and then for high surface expression of mCD1 by sorting cells that stained brightly with the 3C11 and 1H1 Abs using the FACSort (Becton Dickinson, Raritan, NJ). CD1+ RMA-S (RMA-S.CD1d1) clones were subsequently established by limiting dilution. The CD1+ L cell transfectant was provided by Dr. Steve Balk (Beth Israel Hospital, Boston, MA).

Derivation of T cell lines and clones

RMA-S.CD1d1 cells were loaded with the p99a peptide at 37°C for 4 h, washed, inactivated with mitomycin C, and injected i.m. in C57BL/6 mice (line 14). At the same time, p99a peptide in CFA (initial immunization) or IFA (subsequent immunizations) was injected s.c. in the contralateral thigh. This was repeated 10 days later. Alternately, mice were immunized by s.c. injection with p99a in CFA, in the absence of RMA-S.CD1d1 cells (line 24). After euthanasia by CO2 asphyxiation, spleen and lymph nodes were removed, and MHC class II+ cells were removed from a single-cell suspension by immunomagnetic bead depletion using the Ab M5/114.15.2. T cell cloning was done at limiting dilution in round-bottom 96-well plates in the presence of IL-2 and 2 x 105 mitomycin C-treated RMA-S.CD1d1 cells.

FACS

Cells (2 x 105) were stained with 50 µl of ascites (diluted 1:400) or purified Ab (5 µg/ml) in FACS buffer (5% bovine calf serum/0.01% azide) for 1 h at 4°C. The cells were washed, and 20 µl of FITC labeled F(ab')2 rabbit anti-hamster Ig or PE-labeled donkey anti-rat Ig (both from Jackson ImmunoResearch Laboratories, West Grove, PA) were added for 1 h at 4°C. After washing extensively with FACS buffer, the cells were counterstained with propidium iodide and analyzed using a FACSort (Becton Dickinson).

Proliferation assay

T cells were cultured in triplicate at a concentration of 5 x 104 cells/well in the presence of 105 mitomycin C (Sigma, St. Louis, MO)-treated CD1+ RMA-S cells in a flat-bottom 96-well plate in a total volume of 200 µl/well. Abs were used where indicated at a final concentration of 25 µg/ml or a final dilution of 1:4 for spent culture supernatants. The cultures were incubated for a total of 48–72 h at 37°C in 5% CO2 and pulsed with 1 µCi of [3H]thymidine (6.7 Ci/mmol, New England Nuclear, Boston, MA) per well for the last 6 h of culture, and [3H] incorporation was measured by liquid scintillation counting to assess T cell proliferation. Cultures were harvested onto fiberglass filter mats (Wallac, Gaithersburg, MD) using an automated harvester (Tomtec, Orange, CT) and counted using a 1205 Betaplate liquid scintillation counter (Wallac). In general, the SD of the triplicates was 5–10% of the mean.

Cytotoxicity assay

The RMA-S cell lines, stably transfected with mCD1D1 genes, or untransfected, were used as targets in a standard 51Cr release assay. Targets were labeled with 200 µCi of 51Cr for 2 h. Two thousand target cells were incubated with effector T cells for 4 h in triplicate, and the E:T ratio varied as indicated in the figures. Ab blocking studies were done by adding purified Ab at a final concentration of 25 µg/ml or supernatants at a final dilution of 1:3. Chromium release was assessed by spotting 25 µl of the supernatant onto fiberglass filter mats that were counted in a 1205 Betaplate liquid scintillation counter (Wallac). Specific lysis was calculated as [(sample cpm - spontaneous cpm)/(maximum cpm - spontaneous cpm)] x 100. In general, the SD of the triplicates was 1–5% of the mean.

Cytokine assays

A sandwich ELISA was used to determine the amount of IL-2, -4, -10, and IFN-{gamma} produced by the T cell clones 24 and 48 h after specific Ag stimulation with RMA-S.CD1d1 cells compared with untransfected RMA-S cells. Abs specific for the cytokines tested were obtained from PharMingen and used according to the manufacturer’s directions. The limits of detection were 78 pg/ml (IL-2, -4, and -10 and IFN-{gamma}).

PCR and Nucleotide Sequencing

Expression of the canonical V{alpha}14-J{alpha}281 variable region by the T cell clones was determined using nested PCR. RNA was extracted from the T cell clones or thymus using RNAzol (Tel Test, Friendswood, TX), and first strand cDNA synthesis was conducted using random hexamers. The first round of amplification used gene-specific oligonucleotide primers to the V{alpha}14 and C{alpha} gene segments (17, 26) and Taq polymerase. The PCR reactions were diluted 1/100, and a second round of amplification was conducted using internal primers specific for V{alpha}14 and J{alpha}281, and the products were visualized using ethidium bromide on a 2% agarose gel.

Cloning of the TCR{alpha} cDNA from the V{alpha}14-J{alpha}281-negative T cell clones was conducted using inverse PCR (27). First and second strand cDNA synthesis was done using oligo(dT) and Superscript (both from Life Technologies). Circularization of the cDNA was performed using DNA ligase. First round PCR was done using C{alpha} primers (28) oriented in opposite directions and KlenTaq (CloneTech). The PCR product was diluted 1/100 and reamplified using an internal nested primer set (28) that contained 5' EcoRI sites to facilitate cloning. The nested PCR products were cloned into the pBluescript II sequencing vector (Stratagene) and sequenced at the Brigham and Women’s Hospital automated DNA sequencing facility using a 3'C{alpha}-specific primer (5'-CGAGGATCTTTTAACTGGTAC-3') and V{alpha}-specific primers (V{alpha}10: GGAAGTCTCGTCAGCCTGTT; V{alpha}11: CCTCCCATTCTCCTTTGT; V{alpha}15: GAGAAGGTCGAGCAACATGAG; (17, 26).

Determination of the Vß gene segment usage was done by RT-PCR using primers previously described (29), except for the Vß5 and Cß primers. The following additional primers were used: Vß5: AACAAGTTCAGCAGATTCTGG; Vß5: GGGTTGTCCAAGTCTCCAAGA; Vß8: GAAACAAGGTGGCAGTAACAGGAGG; Vß14: CTGTTGGCCAGGTAGAGTCGG; Cß: CCCAGGCCTCTGCACTGATGT (for PCR); Cß: GATGGCTCAAACAAGGAGACC (for sequencing).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Derivation of T cell lines

T cells purified from the spleen and lymph nodes of C57BL/6 mice that had been immunized with RMA-S cells transfected with murine CD1D1 (RMA-S.CD1d1) cells and the p99a (23) peptide or immunized with the p99a peptide alone, were used to generate mCD1-restricted T cell lines. Although this foreign peptide was included in the immunization because of an earlier report showing its ability to prime CD1d1-restricted T cells in vivo (23), none of the T cell lines we derived was specific for the p99a peptide. However, a number of the T cell lines recognized CD1d1 directly without the addition of p99a. Direct recognition of CD1d1 by the T cell lines was specific since they proliferated in response to RMA-S.CD1d1 cells but not to untransfected RMA-S cells (data not shown), and the proliferation was blocked by Abs 3H3 and 5C6 to mCD1 but not Abs specific for MHC class I or II (Fig. 1Go). The T cell lines were heterogeneous and contained predominantly CD8+ and CD4-CD8- T cells, and some CD4+ T cells, and the generation of sublines that were enriched for CD8+ or CD4-CD8- T cells indicated that both populations could recognize CD1d1.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. CD1 recognition by the 14S T cell line. The proliferative response of the 14S T cell line was specifically blocked by Abs specific for mCD1. T cells were cultured with RMA-S.CD1d1 cells in the presence of the Abs indicated in the figure at a concentration of 20 µg/ml. The assay was harvested on day 3 after a 6-h pulse with 1 µCi/well of [3H]thymidine. Results are representative of three experiments.

 
Recognition of CD1 by murine T cell clones

To better understand the diversity of T cells that recognize CD1d1, and to examine their potential effector functions, we established T cell clones by limiting dilution from the CD1d1 specific T cell lines. Seven clones were obtained that expressed neither CD4 nor CD8 (CD4-CD8-, or DN) (data not shown). Three T cell clones had heterogeneous expression of the CD8{alpha} chain and did not express the CD8ß chain. This pattern of expression is typical of cells that express the CD8{alpha}{alpha} homodimer, such as {gamma}{delta} T cells, human NK cells, and activated CD4-CD8- {alpha}ßTCR+ T cells grown in vitro. All of the T cell clones expressed the TCR-{alpha}ß and the CD28-costimulatory molecule (data not shown).

Despite the fact that these T cell clones were derived from C57BL/6 mice, an NK1.1+ strain, neither the original T cell lines nor the T clones expressed the NK1.1 Ag that was recognized by PK136 mAb. The T cell clones did not express other NK markers such as the NKR-1PA or NKR-1PB Ags (recognized by the 10A7 mAb), nor the Ly-49C Ag, that are expressed by some NK T cells. These data suggested that these T cells were distinct from the NK T cell subset.

To establish that the T cell clones recognized CD1, a cytolytic assay was conducted using RMA-S.CD1d1 transfectants and RMA-S untransfected control cells as targets. Both the CD8+ and DN T cell clones specifically lysed the CD1-transfected target across a range of E:T ratios (Fig. 2GoA). For example, at E:T 100:1, T cell clone 14S.3 lysed nearly 100% of the CD1+ target, but only 25% of the untransfected targets (Fig. 2GoA). To rule out that the T cell clones were recognizing a clonal variation unrelated to CD1 expression between the RMA-S.CD1d1 and RMA-S NT, recognition of mouse L cell fibroblasts either untransfected or transfected with CD1d1 (14) was also examined. The 14S T cell clones specifically lysed the L.CD1 but not untransfected L cells confirming the specificity for CD1-transfected targets (Fig. 2GoB).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Recognition of mCD1 by T cell clones. RMA-S or L cells, stably transfected with the mCD1 cDNAs, or untransfected, were labeled with 51Cr for 2 h and used as targets in a standard 4-h cytotoxicity assay. Two thousand target cells were used and the number of T cells varied as indicated in the figure. {blacksquare}, RMA-S.CD1d1; {square}RMA-S; •, L.CD1; {circ}, L cells. Results are representative of two to five experiments.

 
To further confirm the restriction of these CD1-restricted T cell clones, Ab blocking experiments were performed. Abs to MHC I, MHC II, CD4, and CD8 did not block the specific recognition of RMA-S.CD1d1. In contrast, three anti-mCD1 Abs significantly inhibited the specific lysis of the RMA-S.CD1d1 by the CD1-restricted T cell clones. For example, mAb 1B1 (rat anti-CD1), and mAbs 3H3 and 5C6 (both hamster anti-CD1), blocked lysis of the RMA-S.CD1d1 transfectant by 14S3 (DN) and 14S.10 (CD8{alpha}{alpha}+) T cell clones (Fig. 3Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. The cytolytic activity of the T cell clones was CD1 restricted. The T cell clones 14S3 and 14S10 were incubated with 2000 51Cr-labeled RMA-S. CD1d1 target cells at E:T = 10:1, in the presence of the Abs indicated in the figure at a concentration of 20 µg/ml. Similar results were obtained with the other CD1-restricted T cell clones.

 
Cytokine production by CD1-restricted T cell clones

Stimulation of the T cell lines with RMA-S.CD1d1 cells led to the production of >10,000 pg/106 T cells of IL-4, IL-10, and IFN-{gamma}; however, because these T cells were serially propagated in culture, they lost their ability to produce large amounts of IL-4 despite preservation of the ability to secrete >40,000 pg of IFN-{gamma}/106 T cells (data not shown). The T cell clones most consistently made large amounts of IFN-{gamma} and IL-10 (Table IGo). For example, in one representative assay, the T cell clones 14S.3, 14S.4, 14S.7, 14S.10, and 24.7 all made >80,000 pg IFN-{gamma}/106 T cells. In the same assay, these T cell clones produced between 8,000 and 22,000 pg of IL-10/106 T cells (Table IGo). There was more variation among the T cell clones with respect to the production of IL-2 and IL-4. T cell clones 14S.3, 14S.4, and 14S.7, did not produce any detectable IL-2 while clones 14S.10, 24.7, and 24.8 all produced 3,800 to 17,000 pg/106 T cells (Table IGo). For comparison, the CD4+ T cell clone AE7 (30), which is specific for pigeon cytochrome c and is restricted by I-Ek, produced only IL-2 and IFN-{gamma}, a pattern typical of Th1 cells (Table IGo). The production of both IL-10 and IFN-{gamma} by the CD1-restricted T cell clones is distinctly unusual and may reflect a unique in vivo function for this subset of T cells.


View this table:
[in this window]
[in a new window]
 
Table I. Cytokine production by T cell clones1

 
V{alpha} usage of the CD1-restricted T cell clones

The canonical V{alpha}14-J{alpha}281 TCR V{alpha} transcript could not be detected by nested RT PCR in 7 of the 10 T cell clones studied, although such sequences could be amplified from thymus RNA (data not shown). This finding was in contrast to the CD1-reactive T-T hybridomas reported by Bendelac et al. (16) that all used the invariant V{alpha}14-J{alpha}281 TCR.

To determine the V{alpha} gene usage of the T cell clones, we used inverse PCR, followed by direct sequencing of the PCR products using a C{alpha} antisense primer (Table IIGo, Fig. 4Go). The three CD4-CD8- T cell clones, 14S.3, 14S.4, and 14S.7, all had identical V{alpha} sequences that were encoded by V{alpha}15 (AV15S1) rearranged to J{alpha}New.02 (TRAJ50). A fourth CD4-CD8- T cell clone (14S15) used V{alpha}10 (AV10S2 or AV10S9) rearranged to J{alpha}TA65 (TRAJ49). The variable regions of the two CD8{alpha}+ T cell clones 14S.10 and 14S.11 were encoded by two different members of the V{alpha}11 family, AV11S3 and AV11S1, respectively. The 14S.11 T cell clone used the J{alpha}19 (TRAJ40) joining region, whereas the 14S.10 T cell clone used the J{alpha}NEW.15 (TRAJ4) joining region. The V{alpha} sequence of 14S.6 could not be determined by directly sequencing the PCR product because of the presence of two V{alpha} TCR transcripts. After subcloning the PCR product and sequencing multiple clones, we determined that the productive rearrangement used V{alpha}17 (AV17S1) recombined with J{alpha}TT11 (TRAJ32), while the nonproductively rearranged transcript was encoded by V{alpha}3 (AV3S7) and J{alpha}C5A (TRAJ52). In contrast, the 24.7, 24.8, and 24.9 T cell clones used the V{alpha}14-J{alpha}281 (TRAJ15) rearrangement, as has been found in NK1.1+ T cells. They all contained a single N region nucleotide addition at the V-J junction, that preserved the glycine and aspartate at residues 93 and 94, respectively, and are characteristic of the invariant V{alpha}TCR.


View this table:
[in this window]
[in a new window]
 
Table II. Summary of the V, D, and J gene used by CD1-reactive T cell clones1

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. The deduced TCR V{alpha} and Vß CDR3 region amino acid sequence of the CD1-reactive T cell clones. The nucleic acid sequence of the CDR3 regions of the V{alpha} and Vß chains were determined as described in the methods. The Vß DWG shared motif is boxed and a similar sequence, EI, is underlined. The invariant V{alpha}14-J{alpha}281 TCR {alpha}-chain is shown for comparison (V14J281). *, The TCR V{alpha} and Vß sequences for the T cell clones 14S.3, 14S.4, and 14S.7 were identical with each other; only one sequence is shown for comparison. The nucleic acid sequence data are available from GenBank under accession number AF093858-76.

 
The CD1-restricted T cell clones predominantly use Vß8

The T cell lines were polyclonal with respect to Vß usage as determined by flow cytometry with Vß-specific mAbs. In most of the T cell lines studied, Vß8.1/2 was dominant, and varying proportions of Vß2-, Vß5.1/2-, Vß7-, and Vß8.3-expressing T cells were detected (data not shown). The Vß usage of the T cell clones was determined by RT-PCR analysis followed by sequencing (Table IIGo, Fig. 4Go). T cell clones 14S.3, 14S.4, and 14S.7 all expressed identical Vß TCR rearrangements of Vß8.2 (BV8S2A1) and Jß2.5. The T cell clones 14S.10, 14S.11, 24.8, and 24.9 each expressed unique Vß TCR rearrangements, but all used a member of the Vß8 family (BV8S1, BV8S2A3, BV8S2A2, and BV8S3, respectively). Three other T cell clones used genes from the Vß5, Vß6, and Vß14 families (Table IIGo, Fig. 4Go).

Thus, despite the diverse array of V{alpha} gene segments used by the CD1-reactive T cell clones, five of the eight unique V{alpha} chains were paired with a member of the Vß8 family. Moreover, five of the clones shared a three-amino acid motif in the complementarity-determining region 3 (CDR3) that consisted of a negatively charged residue followed by a bulky hydrophobic residue. Clones 24.8, 24.9, 14S11, 14S15, and 14S6 contained the amino acids DWG, while clone 14S3 has the amino acids E-I in the Vß CDR3 region (Fig. 4Go). This D/E-hydrophobic amino acid motif was independent of which Vß or Jß gene segments were used and was entirely encoded by the TCRDB2 (Dß2) gene segment (Fig. 5Go). Although the TCRDB2 gene segment can be translated in all three reading frames, the third reading frame was selected to be used in all five TCR rearrangements.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 5. Nucleic acid sequence of the TCR Vß CDR3 region of the CD1 reactive T cell clones. The underlined sequence is the junctional sequence between the end of the germline-encoded V segment and the beginning of the germline-encoded J segment and includes the D segment and the N nucleotide additions. The portion of the VDJ junctional sequence that is encoded by the germline-encoded TCRBD2 segment is shown in bold type. The nucleic acid sequence that encodes the shared motif is enclosed by a box. The germline sequence of the TCRBD2 segment is shown for comparison. *, The TCR V{alpha} and Vß sequences for the T cell clones 14S.3, 14S.4, and 14S.7 were identical with each other; only one sequence is shown for comparison.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The paradigm of CD1 recognition by murine T cells has been dominated by the discovery that a major fraction of NK1.1+ T cells expressing a highly restricted TCR repertoire directly recognize CD1d1 and rapidly produce large amounts of IL-4 upon activation. NK1.1+ T cells comprise 20% of HSAlow thymocytes in adult C57BL/6 mice, and significant numbers are also found in the bone marrow and the liver (31). The selection of NK1.1+ T cells during development requires mCD1, as mice with targeted mutations of ß2-microglobulin or CD1 are largely devoid of the NK1.1+ subset of {alpha}ßTCR+ T cells (32, 33, 34). Characteristically, these unique T cells express a limited TCR repertoire, exemplified by the canonical rearrangement of V{alpha}14-J{alpha}281 which pairs with Vß chains encoded by the Vß2, Vß7, or Vß8 families (17, 18). However, as strongly indicated by the data presented in the current study, it is likely that recognition of mCD1 involves many other T cells beyond the V{alpha}14-J{alpha}281 NK T cell subset.

Cardell et al. provided the first evidence that mCD1 recognition was not limited to NK1.1+ T cells (35). Hybridomas made from splenic CD4+ T cells isolated from class II-deficient mice recognized mCD1, yet did not express the V{alpha}14-J{alpha}281 canonical TCR (35, 36). However, since MHC class II-deficient mice have markedly abnormal T cell development, it was unclear to what extent these findings reflected the situation in the normal immune system. Here, using an approach that allowed detection of unselected T cells that were CD1d1 reactive, we demonstrated that a wide diversity of TCRs used by splenic T cells from normal wild-type C57BL/6 mice are capable of recognizing CD1d1. These in vitro grown T cell clones do not express the NK1.1 Ag. However, a recent study has questioned the validity of using the NK1.1 Ag as a lineage marker because under certain conditions, activation of T cells in vitro leads to down-regulation and loss of expression of the NK1.1 Ag (37). Since the majority of our T cell clones express V{alpha} chains other than V{alpha}14, it is likely that these cells did not originate from the NK1.1+ T cell subset and thus none of the available data support expression of NK1.1 by non-V{alpha}14 CD1-reactive T cells. Moreover, since V{alpha}14-J{alpha}281 T cells represented a minority of the CD1d1-reactive T cell clones derived in a culture system that included all potential CD1d1-reactive splenic T cells, it appears likely that V{alpha}14-J{alpha}281 T cells may represent only a small fraction of the mCD1-reactive T cells in normal C57BL/6 mice. The relative paucity of V{alpha}14+ T cells among our panel of CD1d1-reactive T cell clones indicates that the V{alpha}14 TCR is not required for CD1d1 recognition.

Human studies analyzing TCR sequences for T cells directly reactive to CD1 or specific to foreign glycolipids presented by CD1a, -b, and -c also suggest a diverse repertoire of TCRs (E. Grant and M.B.B., unpublished observation). While the sequence data presented demonstrate the diversity of TCRs that are capable of recognizing CD1d1, it is also clear that preferential use of germline gene elements could be appreciated (Table IIGo). Vß8 was overrepresented among the T cell clones, suggesting that the TCR Vß8 family members play a greater role in mCD1 recognition than previously thought (Table IIGo). Although the V{alpha}14-J{alpha}281 is clearly important for selection of NK1.1+ T cells, our data suggest that it is the TCRß chain usage that actually correlates most strongly for T cell reactivity to mCD1.

The primary sequence of five of eight CD1d1-reactive TCR Vß chains contained the amino acids DWG in the CDR3 region, a sequence encoded by the TCRBD2 gene segment when translated in its third reading frame. In contrast, our review of two large series of Vß chain sequences associated with the invariant V{alpha} chain found this DWG motif only rarely (16, 29). Because the T cell clones characterized in this report were derived after stimulation in vitro with RMA-S.CD1d1 cells, the TCR repertoire may have been selected for reactivity with a serum Ag or an endogenous Ag present in RMA-S cells. Because neither the nature nor the diversity of endogenous Ags that CD1 presents is known, it is not possible from our analysis to ascertain the significance of this motif occurring in >60% of our Vß chain sequences. However, the location of these three amino acids in the CDR3 loop suggests that they may play a role in the recognition of the CD1d1 backbone or some structural feature shared by self ligands for both V{alpha}14+ and V{alpha}14- TCRs.

The derivation of T cell clones provided opportunities to characterize the function of CD1d1-reactive T cells in ways that are not possible when T cell hybridomas are studied. CD1-restricted NK1.1+ T cells produce both IL-4 and IFN-{gamma} and have been implicated as important regulatory T cells (37). Although variable levels of IL-4 were produced by the T cell clones described herein, the non-V{alpha}14+ T cells were most notable for their production of substantial amounts of IL-10 and IFN-{gamma} upon activation. Although the functional impact of individual T cells producing both IL-10 and IFN-{gamma} is not yet appreciated, a similar subset of human T cells specific for Borrelia burgdorferi have been recently identified in patients with chronic Lyme disease and may be relevant to the perpetuation of the disease (38). The capacity of CD1-reactive T cells to produce Th2-type cytokines may have important implications. Recent data from humans with type I diabetes mellitus correlated a marked reduction in the number of the V{alpha}24-J{alpha}Q CD1d-reactive T cells and a diminution of IL-4 production by them with progression to disease (39). Paired siblings whose V{alpha}24-J{alpha}Q T cells continued to produce IL-4 and who maintained high serum levels of IL-4 did not develop chronic diabetes despite having multiple risk factors. Systemic sclerosis and the lpr SLE mouse model have been shown to correlate with a selective reduction in the V{alpha}24-J{alpha}Q T/V{alpha}14 T cell subsets (40, 41). These results emphasize that CD1-reactive T cells are likely important regulatory and effector cells that may play a critical role in autoimmunity.

The CD1-specific T cell clones were efficient cytolytic T cells. Since these cells were CD4-CD8- or expressed variable cell surface levels of CD8{alpha}{alpha} homodimers, their cytotoxic function was independent of the expression of the CD8{alpha}ß coreceptor. Similar findings have been observed for several human CD4-CD8- T cells line that are restricted by CD1 (42). The capacity of the murine T cell clones to produce large amounts of IFN-{gamma} and specifically recognize and lyse CD1+ APC indicates a likely role in host defense or in hypersensitivity-mediated inflammatory reactions. These results demonstrate, that similar to the NK T cells, CD1-reactive T cells with diverse TCRs have the potential to be important regulatory and effector cells.

We suggest that the large repertoire of murine T cells capable of recognizing CD1 indicates that distinct endogenous Ags may be loaded by mCD1 which positively selects diverse T cells. In support of the latter hypothesis, the crystal structure determination of mCD1 suggests that the Ag-binding cavity of the molecule is not empty, but contains a single acyl chain (3). Recognition of {alpha}-glycosylacylphytosphingosines by V{alpha}14+ NK T cells is restricted by mCD1 (15) and indicates that mCD1 has the ability to present foreign lipid Ags that are similar structurally to the Ags that have been shown to be presented by human CD1 (4, 6, 8, 9). The binding of {alpha}-galactosylacylphytosphingosine would occupy the dimensions of the CD1 binding pocket (15). In this context, the various TCRs competent to recognize mCD1 may reflect the potential for diverse lipid and glycolipid Ags to be presented. The direct recognition of mCD1 (in the absence of exogenous Ag) that has been reported, may in fact represent weak reactivity to endogenous Ags that has been augmented by the use of APCs that express greater than physiologic levels of mCD1 (e.g., mCD1 transfected cell lines) and T cells that have a low threshold of activation (e.g., in vitro-cultured T cell clones and hybridomas). In support of this, the T cell clones described herein had a much weaker proliferative response to native APC such as splenocytes or thymocytes than to the CD1-transfected cell lines (S.M.B, unpublished observations).

The role of lipid Ags bound in the CD1d1 cavity in T cell recognition will have to await further characterization of the lipids presented by CD1d1. Our data show that the number and diversity of T cells reactive to CD1d1 are larger than previously expected, and the ability of these cells to function as potent cytotoxic T cells and to produce IFN-{gamma} and IL-10 in addition to IL-4 emphasizes their likely importance in immune responses. The correlations of CD1-reactive T cell responses with murine autoimmune models and human diabetes point further toward their role in autoimmunity.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AR39582 to M.B.B. and AR01978 to S.M.B., a Medical Research Council of Canada clinician-scientist award to T.A.P., and Searle Scholars Award to C.-R.W. Back

2 Address correspondence and reprint requests to Dr. Samuel M. Behar, Division of Rheumatology, Immunology and Allergy, Brigham and Women’s Hospital, Smith Building, Room 516C, 1 Jimmy Fund Way, Boston, MA 02115. Back

3 Abbreviations used in this paper: mCD1, murine CD1; CDR3, complementarity-determining region 3. Back

Received for publication June 26, 1998. Accepted for publication September 10, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Porcelli, S. A.. 1995. The CD1 family: a third lineage of antigen presenting molecules. Adv. Immunol. 59:1.[Medline]
  2. Beckman, E. M., M. B. Brenner. 1995. MHC class I-like, class II-like and CD1 molecules: distinct roles in immunity. Immunol. Today 16:349.[Medline]
  3. Zeng, Z., A. R. Castaño, B. W. Segelke, E. A. Stura, P. A. Peterson, I. A. Wilson. 1997. Crystal structure of mouse CD1: an MHC-like fold with a large hydrophobic binding groove. Science 277:339.[Abstract/Free Full Text]
  4. Moody, D. B., B. B. Reinhold, M. R. Guy, E. M. Beckman, D. E. Frederique, S. T. Furlong, S. Ye, V. N. Reinhold, P. A. Sieling, R. L. Modlin, G. S. Besra, S. A. Porcelli. 1997. Structural requirements for glycolipid antigen recognition by CD1b-restricted T cells. Science 278:283.[Abstract/Free Full Text]
  5. Porcelli, S., C. T. Morita, M. B. Brenner. 1992. CD1b restricts the response of human CD4(-)8(-) T lymphocytes to a microbial antigen. Nature 360:593.[Medline]
  6. Beckman, E. M., S. A. Porcelli, C. T. Morita, S. M. Behar, S. T. Furlong, M. B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted {alpha}ß+ T cells [see comments]. Nature 372:691.[Medline]
  7. Beckman, E. M., A. Melian, S. M. Behar, P. A. Sieling, D. Chatterjee, S. T. Furlong, R. Matsumoto, J. P. Rosat, R. L. Modlin, S. A. Porcelli. 1996. CD1c restricts responses of mycobacteria-specific T cells: evidence for antigen presentation by a second member of the human CD1 family. J. Immunol. 157:2795.[Abstract]
  8. Sieling, P. A., D. Chatterjee, S. A. Porcelli, T. I. Prigozy, R. J. Mazzaccaro, T. Soriano, B. R. Bloom, M. B. Brenner, M. Kronenberg, P. J. Brennan. 1995. CD1-restricted T cell recognition of microbial lipoglycan antigens. Science 269:227.[Abstract/Free Full Text]
  9. Prigozy, T. I., P. A. Sieling, D. Clemens, P. L. Stewart, S. M. Behar, S. A. Porcelli, M. B. Brenner, R. L. Modlin, M. Kronenberg. 1997. The mannose receptor delivers lipoglycan antigens to endosomes for presentation to T cells by CD1b molecules. Immunity 6:187.[Medline]
  10. Sugita, M., R. M. Jackman, E. van Donselaar, S. M. Behar, R. A. Rogers, P. J. Peters, M. B. Brenner, S. A. Porcelli. 1996. Cytoplasmic tail-dependent localization of CD1b antigen-presenting molecules to MIICs. Science 273:349.[Abstract]
  11. Porcelli, S., M. B. Brenner, J. L. Greenstein, S. P. Balk, C. Terhorst, P. A. Bleicher. 1989. Recognition of cluster of differentiation 1 antigens by human CD4-CD8- cytolytic T lymphocytes. Nature 341:447.[Medline]
  12. Bradbury, A., K. T. Belt, T. M. Neri, C. Milstein, F. Calabi. 1988. Mouse CD1 is distinct from and co-exists with TL in the same thymus. EMBO J. 7:3081.[Medline]
  13. Bradbury, A., F. Calabi, C. Milstein. 1990. Expression of CD1 in the mouse thymus. Eur. J. Immunol. 20:1831.[Medline]
  14. Balk, S. P., P. A. Bleicher, C. Terhorst. 1991. Isolation and expression of cDNA encoding the murine homologues of CD1. J. Immunol. 146:768.[Abstract]
  15. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, H. Koseki, M. Taniguchi. 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NKT cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  16. Bendelac, A., O. Lantz, M. E. Quimby, J. W. Yewdell, J. R. Bennink, R. R. Brutkiewicz. 1995. CD1 recognition by mouse NK1+ T lymphocytes. Science 268:863.[Abstract/Free Full Text]
  17. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  18. Ohteki, T., H. R. MacDonald. 1996. Stringent Vß requirement for the development of NK1.1+ T cell receptor-{alpha}+ cells in mouse liver. J. Exp. Med. 183:1277.[Abstract/Free Full Text]
  19. Chen, H., W. E. Paul. 1997. Cultured NK1.1+ CD4+ T cells produce large amounts of IL-4 and IFN-{gamma} upon activation by anti-CD3 or CD1. J. Immunol. 159:2240.[Abstract/Free Full Text]
  20. Denkers, E. Y., R. T. Gazzinelli, D. Martin, A. Sher. 1993. Emergence of NK1.1+ cells as effectors of IFN-{gamma} dependent immunity to Toxoplasma gondii in MHC class I-deficient mice. J. Exp. Med. 178:1465.[Abstract/Free Full Text]
  21. Denkers, E. Y., T. Scharton-Kersten, S. Barbieri, P. Caspar, A. Sher. 1996. A role for CD4+ NK1.1+ T lymphocytes as major histocompatibility complex class II independent helper cells in the generation of CD8+ effector function against intracellular infection. J. Exp. Med. 184:131.[Abstract/Free Full Text]
  22. Brossay, L., D. Jullien, S. Cardell, B. C. Sydora, N. Burdin, R. L. Modlin, M. Kronenberg. 1997. Mouse CD1 is mainly expressed on hemopoietic-derived cells. J. Immunol. 159:1216.[Abstract]
  23. Castano, A. R., S. Tangri, J. E. Miller, H. R. Holcombe, M. R. Jackson, W. D. Huse, M. Kronenberg, P. A. Peterson. 1995. Peptide binding and presentation by mouse CD1. Science 269:223.[Abstract/Free Full Text]
  24. Ljunggren, H. G., C. Ohlen, P. Hoglund, L. Franksson, K. Karre. 1991. The RMA-S lymphoma mutant; consequences of a peptide loading defect on immunological recognition and graft rejection. Int. J. Cancer Suppl. 6:38.[Medline]
  25. Takebe, Y., M. Seiki, J. Fujisawa, P. Hoy, K. Yokota, K. Arai, M. Yoshida, N. Arai. 1988. SR {alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8:466.[Abstract/Free Full Text]
  26. Shimamura, M., T. Ohteki, P. Launois, A. M. Garcia, H. R. MacDonald. 1997. Thymus-independent generation of NK1+ T cells in vitro from fetal liver precursors. J. Immunol. 158:3682.[Abstract]
  27. DerSimonian, H., M. Sugita, D. N. Glass, A. L. Maier, M. E. Weinblatt, T. Reme, M. B. Brenner. 1993. Clonal V{alpha} 12.1+ T cell expansions in the peripheral blood of rheumatoid arthritis patients. J. Exp. Med. 177:1623.[Abstract/Free Full Text]
  28. Wang, R., M. Taniguchi. 1995. Limited T cell antigen receptor repertoire in tumor-infiltrating lymphocyte and inhibition of experimental lung metastasis of murine melanoma by anti-TCR antibody. J. Immunol. 154:1797.[Abstract]
  29. Masuda, K., Y. Makino, J. Cui, T. Ito, T. Tokuhisa, Y. Takahama, H. Koseki, K. Tsuchida, T. Koike, H. Moriya, M. Amano, M. Taniguchi. 1997. Phenotypes and invariant {alpha}ß TCR expression of peripheral V{alpha}14+ NK T cells. J. Immunol. 158:2076.[Abstract]
  30. Carbone, F. R., B. S. Fox, R. H. Schwartz, Y. Paterson. 1987. The use of hydrophobic, {alpha}-helix-defined peptides in delineating the T cell determinant for pigeon cytochrome c. J. Immunol. 138:1838.[Abstract]
  31. Ohteki, T., H. R. MacDonald. 1994. Major histocompatibility complex class I related molecules control the development of CD4+8- and CD4-8- subsets of natural killer 1.1+ T cell receptor-{alpha}+ cells in the liver of mice. J. Exp. Med. 180:699.[Abstract/Free Full Text]
  32. Chen, Y. H., N. M. Chiu, M. Mandal, N. Wang, C. R. Wang. 1997. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity 6:459.[Medline]
  33. Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. Van Kaer. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Medline]
  34. Smiley, S. T., M. H. Kaplan, M. J. Grusby. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.[Abstract/Free Full Text]
  35. Cardell, S., S. Tangri, S. Chan, M. Kronenberg, C. Benoist, D. Mathis. 1995. CD1-restricted CD4+ T cells in major histocompatibility complex class II-deficient mice. J. Exp. Med. 182:993.[Abstract/Free Full Text]
  36. Park, S. H., J. H. Roark, A. Bendelac. 1998. Tissue-specific recognition of mouse CD1 molecules [in process citation]. J. Immunol. 160:3128.[Abstract/Free Full Text]
  37. Chen, H., H. Huang, W. E. Paul. 1997. NK1.1+CD4+ T cells lose NK1.1 expression upon in vitro activation. J. Immunol. 158:5112.[Abstract]
  38. Pohl-Koppe, A., K. E. Balashov, A. C. Steere, E. L. Logigian, D. A. Hafler. 1998. Identification of a T cell subset capable of both IFN-{gamma} and IL-10 secretion in patients with chronic Borrelia burgdorferi infection. J. Immunol. 160:1804.[Abstract/Free Full Text]
  39. Wilson, S. B., S. C. Kent, K. T. Patton, T. Orban, R. A. Jackson, M. Exley, S. Porcelli, D. A. Schatz, M. A. Atkinson, S. P. Balk, J. L. Strominger, D. A. Hafler. 1998. Extreme Th1 bias of invariant V{alpha}24J{alpha}Q T cells in type 1 diabetes. Nature 391:177.[Medline]
  40. Mieza, M. A., T. Itoh, J. Q. Cui, Y. Makino, T. Kawano, K. Tsuchida, T. Koike, T. Shirai, H. Yagita, A. Matsuzawa, H. Koseki, M. Taniguchi. 1996. Selective reduction of V{alpha}14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
  41. Sumida, T., A. Sakamoto, H. Murata, Y. Makino, H. Takahashi, S. Yoshida, K. Nishioka, I. Iwamoto, M. Taniguchi. 1995. Selective reduction of T cells bearing invariant V{alpha}24J{alpha}Q antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.[Abstract/Free Full Text]
  42. Behar, S. M., S. A. Porcelli, E. M. Beckman, M. B. Brenner. 1995. A pathway of costimulation that prevents anergy in CD28- T cells: B7-independent costimulation of CD1-restricted T cells. J. Exp. Med. 182:2007.[Abstract/Free Full Text]
  43. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
  44. Malissen, M., K. Minard, S. Mjolsness, M. Kronenberg, J. Goverman, T. Hunkapiller, M. B. Prystowsky, Y. Yoshikai, F. Fitch, T. W. Mak, et al 1984. Mouse T cell antigen receptor: structure and organization of constant and joining gene segments encoding the beta polypeptide. Cell 37:1101.[Medline]
  45. LeFranc, M. P., V. Giudicelli, C. Busin, J. Bodmer, W. Muller, R. Bontrop, M. Lemaitre, A. Malik, D. Chaume. 1998. IMGT, the International ImMunoGeneTics database. Nucleic Acids Res. 26:297.[Abstract/Free Full Text]
  46. Mandal, M., X.-R. Chen, M.-L. Alegre, N. M. Chiu, Y.-H. Chen, A. R. Castano, C.-R. Wang. 1988. Tissue distribution, regulation and intracellular localization of murine CD1 molecules. Mol. Immuno. 35:525.



This article has been cited by other articles:


Home page
JEMHome page
L. Cosmi, R. De Palma, V. Santarlasci, L. Maggi, M. Capone, F. Frosali, G. Rodolico, V. Querci, G. Abbate, R. Angeli, et al.
Human interleukin 17-producing cells originate from a CD161+CD4+ T cell precursor
J. Exp. Med., August 4, 2008; 205(8): 1903 - 1916.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. Berzofsky and M. Terabe
NKT Cells in Tumor Immunity: Opposing Subsets Define a New Immunoregulatory Axis
J. Immunol., March 15, 2008; 180(6): 3627 - 3635.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
Y. Li, S. Teneberg, P. Thapa, A. Bendelac, S. B. Levery, and D. Zhou
Sensitive detection of isoglobo and globo series tetraglycosylceramides in human thymus by ion trap mass spectrometry
Glycobiology, February 1, 2008; 18(2): 158 - 165.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Ambrosino, M. Terabe, R. C. Halder, J. Peng, S. Takaku, S. Miyake, T. Yamamura, V. Kumar, and J. A. Berzofsky
Cross-Regulation between Type I and Type II NKT Cells in Regulating Tumor Immunity: A New Immunoregulatory Axis
J. Immunol., October 15, 2007; 179(8): 5126 - 5136.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. A. VanderLaan, C. A. Reardon, Y. Sagiv, L. Blachowicz, J. Lukens, M. Nissenbaum, C.-R. Wang, and G. S. Getz
Characterization of the Natural Killer T-Cell Response in an Adoptive Transfer Model of Atherosclerosis
Am. J. Pathol., March 1, 2007; 170(3): 1100 - 1107.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Raghuraman, Y. Geng, and C.-R. Wang
IFN-beta-Mediated Up-Regulation of CD1d in Bacteria-Infected APCs
J. Immunol., December 1, 2006; 177(11): 7841 - 7848.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. O. Ilyinskii, R. Wang, S. P. Balk, and M. A. Exley
CD1d Mediates T-Cell-Dependent Resistance to Secondary Infection with Encephalomyocarditis Virus (EMCV) In Vitro and Immune Response to EMCV Infection In Vivo
J. Virol., July 15, 2006; 80(14): 7146 - 7158.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Brigl, P. van den Elzen, X. Chen, J. H. Meyers, D. Wu, C.-H. Wong, F. Reddington, P. A. Illarianov, G. S. Besra, M. B. Brenner, et al.
Conserved and Heterogeneous Lipid Antigen Specificities of CD1d-Restricted NKT Cell Receptors
J. Immunol., March 15, 2006; 176(6): 3625 - 3634.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. J. Ragin, N. Sahu, and A. August
Differential Regulation of Cytokine Production by CD1d-Restricted NKT Cells in Response to Superantigen Staphylococcal Enterotoxin B Exposure
Infect. Immun., January 1, 2006; 74(1): 282 - 288.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Terabe, J. Swann, E. Ambrosino, P. Sinha, S. Takaku, Y. Hayakawa, D. I. Godfrey, S. Ostrand-Rosenberg, M. J. Smyth, and J. A. Berzofsky
A nonclassical non-V{alpha}14J{alpha}18 CD1d-restricted (type II) NKT cell is sufficient for down-regulation of tumor immunosurveillance
J. Exp. Med., December 19, 2005; 202(12): 1627 - 1633.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. S. Vincent, X. Xiong, E. P. Grant, W. Peng, and M. B. Brenner
CD1a-, b-, and c-Restricted TCRs Recognize Both Self and Foreign Antigens
J. Immunol., November 15, 2005; 175(10): 6344 - 6351.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-T. Chen and J. T. Kung
CD1d-Independent Developmental Acquisition of Prompt IL-4 Gene Inducibility in Thymus CD161(NK1)-CD44lowCD4+CD8- T Cells Is Associated with Complementarity Determining Region 3-Diverse and Biased V{beta}2/V{beta}7/V{beta}8/V{alpha}3.2 T Cell Receptor Usage
J. Immunol., November 15, 2005; 175(10): 6537 - 6550.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Kent, Y. Chen, S. M. Clemmings, V. Viglietta, N. S. Kenyon, C. Ricordi, B. Hering, and D. A. Hafler
Loss of IL-4 Secretion from Human Type 1a Diabetic Pancreatic Draining Lymph Node NKT Cells
J. Immunol., October 1, 2005; 175(7): 4458 - 4464.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Skold, X. Xiong, P. A. Illarionov, G. S. Besra, and S. M. Behar
Interplay of Cytokines and Microbial Signals in Regulation of CD1d Expression and NKT Cell Activation
J. Immunol., September 15, 2005; 175(6): 3584 - 3593.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Geng, P. Laslo, K. Barton, and C.-R. Wang
Transcriptional Regulation of CD1D1 by Ets Family Transcription Factors
J. Immunol., July 15, 2005; 175(2): 1022 - 1029.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. T. Smiley, P. A. Lanthier, K. N. Couper, F. M. Szaba, J. E. Boyson, W. Chen, and L. L. Johnson
Exacerbated Susceptibility to Infection-Stimulated Immunopathology in CD1d-Deficient Mice
J. Immunol., June 15, 2005; 174(12): 7904 - 7911.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. O. A. Yu, J. S. Im, A. Molano, Y. Dutronc, P. A. Illarionov, C. Forestier, N. Fujiwara, I. Arias, S. Miyake, T. Yamamura, et al.
Modulation of CD1d-restricted NKT cell responses by using N-acyl variants of {alpha}-galactosylceramides
PNAS, March 1, 2005; 102(9): 3383 - 3388.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Van Rhijn, D. C. Young, J. S. Im, S. B. Levery, P. A. Illarionov, G. S. Besra, S. A. Porcelli, J. Gumperz, T.-Y. Cheng, and D. B. Moody
CD1d-restricted T cell activation by nonlipidic small molecules
PNAS, September 14, 2004; 101(37): 13578 - 13583.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Duarte, M. Stenstrom, S. Campino, M.-L. Bergman, M. Lundholm, D. Holmberg, and S. L. Cardell
Prevention of Diabetes in Nonobese Diabetic Mice Mediated by CD1d-Restricted Nonclassical NKT Cells
J. Immunol., September 1, 2004; 173(5): 3112 - 3118.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. E. Gumperz
CD1d-restricted "NKT" cells and myeloid IL-12 production: an immunological crossroads leading to promotion or suppression of effective anti-tumor immune responses?
J. Leukoc. Biol., August 1, 2004; 76(2): 307 - 313.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Durante-Mangoni, R. Wang, A. Shaulov, Q. He, I. Nasser, N. Afdhal, M. J. Koziel, and M. A. Exley
Hepatic CD1d Expression in Hepatitis C Virus Infection and Recognition by Resident Proinflammatory CD1d-Reactive T Cells
J. Immunol., August 1, 2004; 173(3): 2159 - 2166.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Teige, I. Teige, S. Lavasani, R. Bockermann, E. Mondoc, R. Holmdahl, and S. Issazadeh-Navikas
CD1-Dependent Regulation of Chronic Central Nervous System Inflammation in Experimental Autoimmune Encephalomyelitis
J. Immunol., January 1, 2004; 172(1): 186 - 194.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Rauch, J. Gumperz, C. Robinson, M. Skold, C. Roy, D. C. Young, M. Lafleur, D. B. Moody, M. B. Brenner, C. E. Costello, et al.
Structural Features of the Acyl Chain Determine Self-phospholipid Antigen Recognition by a CD1d-restricted Invariant NKT (iNKT) Cell
J. Biol. Chem., November 28, 2003; 278(48): 47508 - 47515.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Skold and S. M. Behar
Role of CD1d-Restricted NKT Cells in Microbial Immunity
Infect. Immun., October 1, 2003; 71(10): 5447 - 5455.
[Full Text] [PDF]


Home page
J. Immunol.Home page
B. Gansuvd, W. J. Hubbard, A. Hutchings, F. T. Thomas, J. Goodwin, S. B. Wilson, M. A. Exley, and J. M. Thomas
Phenotypic and Functional Characterization of Long-Term Cultured Rhesus Macaque Spleen-Derived NKT Cells
J. Immunol., September 15, 2003; 171(6): 2904 - 2911.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. B. Kamath, J. Alt, H. Debbabi, and S. M. Behar
Toll-Like Receptor 4-Defective C3H/HeJ Mice Are Not More Susceptible than Other C3H Substrains to Infection with Mycobacterium tuberculosis
Infect. Immun., July 1, 2003; 71(7): 4112 - 4118.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Huber, D. Sartini, and M. Exley
Role of CD1d in Coxsackievirus B3-Induced Myocarditis
J. Immunol., March 15, 2003; 170(6): 3147 - 3153.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Chackerian, J. Alt, V. Perera, and S. M. Behar
Activation of NKT Cells Protects Mice from Tuberculosis
Infect. Immun., November 1, 2002; 70(11): 6302 - 6309.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. A. Chackerian, J. M. Alt, T. V. Perera, C. C. Dascher, and S. M. Behar
Dissemination of Mycobacterium tuberculosis Is Influenced by Host Factors and Precedes the Initiation of T-Cell Immunity
Infect. Immun., August 1, 2002; 70(8): 4501 - 4509.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Sfondrini, D. Besusso, M. T. Zoia, M. Rodolfo, A. M. Invernizzi, M. Taniguchi, T. Nakayama, M. P. Colombo, S. Menard, and A. Balsari
Absence of the CD1 Molecule Up-Regulates Antitumor Activity Induced by CpG Oligodeoxynucleotides in Mice
J. Immunol., July 1, 2002; 169(1): 151 - 158.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. E. Gumperz, S. Miyake, T. Yamamura, and M. B. Brenner
Functionally Distinct Subsets of CD1d-restricted Natural Killer T Cells Revealed by CD1d Tetramer Staining
J. Exp. Med., March 4, 2002; 195(5): 625 - 636.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Exley, Q. He, O. Cheng, R.-J. Wang, C. P. Cheney, S. P. Balk, and M. J. Koziel
Cutting Edge: Compartmentalization of Th1-Like Noninvariant CD1d-Reactive T Cells in Hepatitis C Virus-Infected Liver
J. Immunol., February 15, 2002; 168(4): 1519 - 1523.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K.-H. Sonoda, M. Taniguchi, and J. Stein-Streilein
Long-Term Survival of Corneal Allografts Is Dependent on Intact CD1d-Reactive NKT Cells
J. Immunol., February 15, 2002; 168(4): 2028 - 2034.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Mempel, C. Ronet, F. Suarez, M. Gilleron, G. Puzo, L. Van Kaer, A. Lehuen, P. Kourilsky, and G. Gachelin
Natural Killer T Cells Restricted by the Monomorphic MHC Class 1b CD1d1 Molecules Behave Like Inflammatory Cells
J. Immunol., January 1, 2002; 168(1): 365 - 371.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Exley, S. M. A. Tahir, O. Cheng, A. Shaulov, R. Joyce, D. Avigan, R. Sackstein, and S. P. Balk
Cutting Edge: A Major Fraction of Human Bone Marrow Lymphocytes Are Th2-Like CD1d-Reactive T Cells That Can Suppress Mixed Lymphocyte Responses
J. Immunol., November 15, 2001; 167(10): 5531 - 5534.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg
Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size
PNAS, October 5, 2001; (2001) 221445298.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. J. L. Hammond, D. G. Pellicci, L. D. Poulton, O. V. Naidenko, A. A. Scalzo, A. G. Baxter, and D. I. Godfrey
CD1d-Restricted NKT Cells: An Interstrain Comparison
J. Immunol., August 1, 2001; 167(3): 1164 - 1173.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. A. Exley, N. J. Bigley, O. Cheng, S. M. A. Tahir, S. T. Smiley, Q. L. Carter, H. F. Stills, M. J. Grusby, Y. Koezuka, M. Taniguchi, et al.
CD1d-reactive T-cell activation leads to amelioration of disease caused by diabetogenic encephalomyocarditis virus
J. Leukoc. Biol., May 1, 2001; 69(5): 713 - 718.
[Abstract] [Full Text]


Home page
JEMHome page
S.-H. Park, A. Weiss, K. Benlagha, T. Kyin, L. Teyton, and A. Bendelac
The Mouse CD1d-restricted Repertoire Is Dominated by a Few Autoreactive T Cell Receptor Families
J. Exp. Med., April 9, 2001; 193(8): 893 - 904.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Wang, T. Chun, I. C. Rulifson, M. Exley, S. P. Balk, and C.-R. Wang
Human CD1d Functions as a Transplantation Antigen and a Restriction Element in Mice
J. Immunol., March 15, 2001; 166(6): 3829 - 3836.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Bonish, D. Jullien, Y. Dutronc, B. B. Huang, R. Modlin, F. M. Spada, S. A. Porcelli, and B. J. Nickoloff
Overexpression of CD1d by Keratinocytes in Psoriasis and CD1d-Dependent IFN-{gamma} Production by NK-T Cells
J. Immunol., October 1, 2000; 165(7): 4076 - 4085.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Skold, N. N. Faizunnessa, C.-R. Wang, and S. Cardell
CD1d-Specific NK1.1+ T Cells with a Transgenic Variant TCR
J. Immunol., July 1, 2000; 165(1): 168 - 174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. G. Rodionov, T. W. Nordeng, T. L. Kongsvik, and O. Bakke
The Cytoplasmic Tail of CD1d Contains Two Overlapping Basolateral Sorting Signals
J. Biol. Chem., March 17, 2000; 275(12): 8279 - 8282.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. D. Finkelman, S. C. Morris, T. Orekhova, M. Mori, D. Donaldson, S. L. Reiner, N. L. Reilly, L. Schopf, and J. F. Urban Jr.
Stat6 Regulation of In Vivo IL-4 Responses
J. Immunol., March 1, 2000; 164(5): 2303 - 2310.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. M. Behar, C. C. Dascher, M. J. Grusby, C.-R. Wang, and M. B. Brenner
Susceptibility of Mice Deficient in CD1D or TAP1 to Infection with Mycobacterium tuberculosis
J. Exp. Med., June 21, 1999; 189(12): 1973 - 1980.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-H. Chen, B. Wang, T. Chun, L. Zhao, S. Cardell, S. M. Behar, M. B. Brenner, and C.-R. Wang
Expression of CD1d2 on Thymocytes Is Not Sufficient for the Development of NK T Cells in CD1d1-Deficient Mice
J. Immunol., April 15, 1999; 162(8): 4560 - 4566.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg
Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size
PNAS, October 23, 2001; 98(22): 12636 - 12641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Behar, S. M.
Right arrow Articles by Brenner, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Behar, S. M.
Right arrow Articles by Brenner, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS