| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Division of Rheumatology, Immunology and Allergy, Brigham and Women’s Hospital, and Harvard Medical School, Boston, MA 02115; and
Gwen Knapp Center for Lupus and Immunology Research, University of Chicago, Chicago, IL 60637
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
play a role in immunoregulation and tumor
rejection. In the mouse, most CD1d1-reactive T cells described express
an invariant V
14-J281 TCR associated with TCR ß-chains of
limited diversity. Similarly, human CD1d-reactive T cells express a
highly restricted TCR repertoire. Here we report the unexpected result
that in mice immunized with CD1d1-bearing transfectant cells, a diverse
repertoire of TCRs was expressed by CD1d1-reactive T cell clones
isolated by limiting dilution without preselection for NK1 expression.
Only 3 of 10 CD1d1-reactive T cell clones expressed the invariant
V14-J281 TCR rearrangement. T cells expressing V10, -11,
-15, and -17, and having non-germline-encoded nucleotides resulting in
diverse V-J junctions were identified. Like CD1d1-reactive T cells
expressing the invariant V14-J281 TCR -chain, CD1d1-reactive
clones with diverse TCRs produced both Type 1 (IFN-) and Type 2
(IL-4, IL-10) cytokines. This establishes the existence of significant
diversity in the TCRs directly reactive to the CD1d1 protein. Our
findings reveal that CD1d interacts with a broad array of TCRs,
suggesting substantial redundancy and flexibility of the immune system
in providing T cells serving the role(s) mediated by CD1d
reactivity. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß TCR+ T cells (1, 2). For example, human CD1b and CD1c can present foreign mycobacterial
lipid molecules, such as mycolic acids and lipoarabinomannan, to human
CD4-CD8- ß TCR+ T cells
(4, 5, 6, 7, 8, 9). The processing and presentation of these Ags are independent of
the transporter associated with Ag processing (TAP) and
proceeds through an endosomal pathway that includes the MHC class II
compartments in professional APCs (5, 9, 10). In addition to the
presentation of exogenous lipid Ags to T cells, CD1 is also recognized
by both human ß and 
T cells in the absence of exogenous Ag
(11) (M.B.B., unpublished data). This direct recognition of CD1 by T
cells has been referred to as "autoreactivity," although a role for
endogenous cellular lipid molecules or exogenous lipids present in cell
culture media has not been excluded.
The mouse genome encodes two CD1 genes (CD1D1 and
CD1D2) likely to be the result of a gene duplication that
are homologues of human CD1d (12, 13, 14). While the crystal structure of
murine CD1d1 confirmed its overall similarity to MHC class I, the
striking feature was a substantially larger Ag-binding groove that was
lined almost exclusively with hydrophobic and nonpolar amino acids (3).
These structural data, together with the identification of
-glycosylacylphytosphingosines as murine CD1
(mCD1)3-restricted Ags for NK
T cells (15), supports the idea that mouse CD1, as first proposed for
human CD1, may have evolved to present lipid Ags to T cells (4, 6, 8).
T cell hybridomas generated from NK1.1+ thymocytes
recognized CD1 expressed on thymocytes, as well as CD1-transfected cell
lines, in the absence of any exogenous Ag (16). NK1.1+ T
cells use an invariant TCR -chain that results from the
recombination of V14.1 (TCRAV14S1) with J281 (TCRAJ15) and pairs
with one of three Vß-chain families: Vß2, -7, or -8 (17, 18).
NK1.1+ T cells release large amounts of IL-4 within hours
of activation, and it has been proposed that this population of T cells
may be the earliest source of IL-4 that could shift an immune responses
toward a Th2 phenotype. However, it is now appreciated that
NK1.1+ T cells have the capacity to produce IFN-,
indicating that their function is not exclusively in Th2 T cell
responses and that their potential for various cytokine-mediated roles
needs further study (19, 20, 21).
Given the broad diversity of T cells directed against CD1a, -b,
and -c in humans, we sought to examine further the diversity and
function of T cells reactive to mCD1. Thus, rather than select for
study only those T cells that expressed V14 TCRs or the NK1.1
marker, we stimulated murine splenic cells with CD1-expressing
transfectants and established a panel of T cell clones that recognized
CD1 directly. Although several V14+ clones were
obtained, a majority of the T cell clones derived used a diverse V
and Vß repertoire. These T cells were potent cytolytic T cells that
also secreted large amounts of IL-10 and IFN- upon specific
activation, suggesting their potential for diverse roles in
immunoregulation and host defense.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The Abs M1/42.3.9.8.HLK (anti-MHC I), M5/114.15.2
(anti-MHC II), GK1.5 (anti-CD4), and 53-6.72 (anti-CD8)
were obtained from the American Type Culture Collection (Rockville,
MD). Abs 53-5.8 (anti-CD8ß), H57-597 (anti-ßTCR), GL3
(anti- TCR), PK136 (anti-NK1.1), 5E6 (anti-Ly49C),
1B1 (anti-mCD1 (22)) were obtained from PharMingen (San Diego, CA).
The hamster Abs 38-4.5 (IgG control), 3H3.23.2 and 5C6.4 (both
anti-mCD1) were used as spent culture supernatants (46). The Abs
1H1 and 3C11 (rat anti-mCD1) were generously provided by Steve Balk
(Beth Israel Hospital, Boston, MA), and 10A7 (anti-NKR-P1A/B) was a
kind gift of James Ryan (University of California at San Francisco, San
Francisco, CA). The mCD1-restricted peptide, p99a (EHDFHHIREWGNHK)
(23), was synthesized by the Brigham and Women’s Hospital Biopolymer
Laboratory.
Cell culture
RMA-S was grown in complete media consisting of RPMI 1640 media supplemented with 10 mM HEPES, 2 mM L-glutamine, 10 mM nonessential amino acids, 10 mM essential amino acids, 0.055 mM 2-ME (all from Life Technologies, Gaithersburg, MD), and 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT). All T cells were grown in complete media supplemented with 1.5 nM recombinant human IL-2 (gift of Ajinomoto, Kawasaki, Japan). T cell cloning was done by plating T cells at limiting dilution in round bottom plates in the presence of 2 x 105 mitomycin C-inactivated RMA-S.CD1d1 cells.
Transfections
The RMA-S cell line was derived by mutagenesis from a C57BL/6 T
cell lymphoma cell line (RBL-5) and contains a mutant TAP2
gene, making these cells defective in the MHC class I Ag-processing
pathway (24). Because these cells also lack MHC class II, they were
selected as an APC to study CD1-restricted T cells. RMA-S cells were
transfected with the expression vector pSR-NEO (25) containing the
mCD1D1 cDNA (kindly provided by Dr. Steve Balk, Beth Israel Hospital,
Boston, MA) by electroporation. Stably transfected cells were first
selected for G418 resistance and then for high surface expression of
mCD1 by sorting cells that stained brightly with the 3C11 and 1H1 Abs
using the FACSort (Becton Dickinson, Raritan, NJ). CD1+
RMA-S (RMA-S.CD1d1) clones were subsequently established by limiting
dilution. The CD1+ L cell transfectant was provided by Dr.
Steve Balk (Beth Israel Hospital, Boston, MA).
Derivation of T cell lines and clones
RMA-S.CD1d1 cells were loaded with the p99a peptide at 37°C for 4 h, washed, inactivated with mitomycin C, and injected i.m. in C57BL/6 mice (line 14). At the same time, p99a peptide in CFA (initial immunization) or IFA (subsequent immunizations) was injected s.c. in the contralateral thigh. This was repeated 10 days later. Alternately, mice were immunized by s.c. injection with p99a in CFA, in the absence of RMA-S.CD1d1 cells (line 24). After euthanasia by CO2 asphyxiation, spleen and lymph nodes were removed, and MHC class II+ cells were removed from a single-cell suspension by immunomagnetic bead depletion using the Ab M5/114.15.2. T cell cloning was done at limiting dilution in round-bottom 96-well plates in the presence of IL-2 and 2 x 105 mitomycin C-treated RMA-S.CD1d1 cells.
FACS
Cells (2 x 105) were stained with 50 µl of ascites (diluted 1:400) or purified Ab (5 µg/ml) in FACS buffer (5% bovine calf serum/0.01% azide) for 1 h at 4°C. The cells were washed, and 20 µl of FITC labeled F(ab')2 rabbit anti-hamster Ig or PE-labeled donkey anti-rat Ig (both from Jackson ImmunoResearch Laboratories, West Grove, PA) were added for 1 h at 4°C. After washing extensively with FACS buffer, the cells were counterstained with propidium iodide and analyzed using a FACSort (Becton Dickinson).
Proliferation assay
T cells were cultured in triplicate at a concentration of 5 x 104 cells/well in the presence of 105 mitomycin C (Sigma, St. Louis, MO)-treated CD1+ RMA-S cells in a flat-bottom 96-well plate in a total volume of 200 µl/well. Abs were used where indicated at a final concentration of 25 µg/ml or a final dilution of 1:4 for spent culture supernatants. The cultures were incubated for a total of 48–72 h at 37°C in 5% CO2 and pulsed with 1 µCi of [3H]thymidine (6.7 Ci/mmol, New England Nuclear, Boston, MA) per well for the last 6 h of culture, and [3H] incorporation was measured by liquid scintillation counting to assess T cell proliferation. Cultures were harvested onto fiberglass filter mats (Wallac, Gaithersburg, MD) using an automated harvester (Tomtec, Orange, CT) and counted using a 1205 Betaplate liquid scintillation counter (Wallac). In general, the SD of the triplicates was 5–10% of the mean.
Cytotoxicity assay
The RMA-S cell lines, stably transfected with mCD1D1 genes, or untransfected, were used as targets in a standard 51Cr release assay. Targets were labeled with 200 µCi of 51Cr for 2 h. Two thousand target cells were incubated with effector T cells for 4 h in triplicate, and the E:T ratio varied as indicated in the figures. Ab blocking studies were done by adding purified Ab at a final concentration of 25 µg/ml or supernatants at a final dilution of 1:3. Chromium release was assessed by spotting 25 µl of the supernatant onto fiberglass filter mats that were counted in a 1205 Betaplate liquid scintillation counter (Wallac). Specific lysis was calculated as [(sample cpm - spontaneous cpm)/(maximum cpm - spontaneous cpm)] x 100. In general, the SD of the triplicates was 1–5% of the mean.
Cytokine assays
A sandwich ELISA was used to determine the amount of IL-2, -4,
-10, and IFN- produced by the T cell clones 24 and 48 h after
specific Ag stimulation with RMA-S.CD1d1 cells compared with
untransfected RMA-S cells. Abs specific for the cytokines tested were
obtained from PharMingen and used according to the manufacturer’s
directions. The limits of detection were 78 pg/ml (IL-2, -4, and -10
and IFN-).
PCR and Nucleotide Sequencing
Expression of the canonical V14-J281 variable region by
the T cell clones was determined using nested PCR. RNA was extracted
from the T cell clones or thymus using RNAzol (Tel Test, Friendswood,
TX), and first strand cDNA synthesis was conducted using random
hexamers. The first round of amplification used gene-specific
oligonucleotide primers to the V14 and C gene segments (17, 26)
and Taq polymerase. The PCR reactions were diluted 1/100,
and a second round of amplification was conducted using internal
primers specific for V14 and J281, and the products were
visualized using ethidium bromide on a 2% agarose gel.
Cloning of the TCR cDNA from the V14-J281-negative T cell
clones was conducted using inverse PCR (27). First and second strand
cDNA synthesis was done using oligo(dT) and Superscript (both from Life
Technologies). Circularization of the cDNA was performed using DNA
ligase. First round PCR was done using C primers (28) oriented in
opposite directions and KlenTaq (CloneTech). The PCR product was
diluted 1/100 and reamplified using an internal nested primer set (28)
that contained 5' EcoRI sites to facilitate cloning. The
nested PCR products were cloned into the pBluescript II sequencing
vector (Stratagene) and sequenced at the Brigham and Women’s Hospital
automated DNA sequencing facility using a 3'C-specific primer
(5'-CGAGGATCTTTTAACTGGTAC-3') and V-specific primers (V10:
GGAAGTCTCGTCAGCCTGTT; V11: CCTCCCATTCTCCTTTGT; V15:
GAGAAGGTCGAGCAACATGAG; (17, 26).
Determination of the Vß gene segment usage was done by RT-PCR using primers previously described (29), except for the Vß5 and Cß primers. The following additional primers were used: Vß5: AACAAGTTCAGCAGATTCTGG; Vß5: GGGTTGTCCAAGTCTCCAAGA; Vß8: GAAACAAGGTGGCAGTAACAGGAGG; Vß14: CTGTTGGCCAGGTAGAGTCGG; Cß: CCCAGGCCTCTGCACTGATGT (for PCR); Cß: GATGGCTCAAACAAGGAGACC (for sequencing).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells purified from the spleen and lymph nodes of C57BL/6 mice
that had been immunized with RMA-S cells transfected with murine CD1D1
(RMA-S.CD1d1) cells and the p99a (23) peptide or immunized with the
p99a peptide alone, were used to generate mCD1-restricted T cell lines.
Although this foreign peptide was included in the immunization because
of an earlier report showing its ability to prime CD1d1-restricted T
cells in vivo (23), none of the T cell lines we derived was specific
for the p99a peptide. However, a number of the T cell lines recognized
CD1d1 directly without the addition of p99a. Direct recognition of
CD1d1 by the T cell lines was specific since they proliferated in
response to RMA-S.CD1d1 cells but not to untransfected RMA-S cells
(data not shown), and the proliferation was blocked by Abs 3H3 and 5C6
to mCD1 but not Abs specific for MHC class I or II (Fig. 1
). The T cell lines were heterogeneous
and contained predominantly CD8+ and
CD4-CD8- T cells, and some CD4+ T
cells, and the generation of sublines that were enriched for
CD8+ or CD4-CD8- T cells
indicated that both populations could recognize CD1d1.
|
To better understand the diversity of T cells that recognize
CD1d1, and to examine their potential effector functions, we
established T cell clones by limiting dilution from the CD1d1 specific
T cell lines. Seven clones were obtained that expressed neither CD4 nor
CD8 (CD4-CD8-, or DN) (data not shown). Three
T cell clones had heterogeneous expression of the CD8 chain and did
not express the CD8ß chain. This pattern of expression is typical of
cells that express the CD8 homodimer, such as T cells,
human NK cells, and activated CD4-CD8-
ßTCR+ T cells grown in vitro. All of the T cell clones
expressed the TCR-ß and the CD28-costimulatory molecule (data not
shown).
Despite the fact that these T cell clones were derived from C57BL/6 mice, an NK1.1+ strain, neither the original T cell lines nor the T clones expressed the NK1.1 Ag that was recognized by PK136 mAb. The T cell clones did not express other NK markers such as the NKR-1PA or NKR-1PB Ags (recognized by the 10A7 mAb), nor the Ly-49C Ag, that are expressed by some NK T cells. These data suggested that these T cells were distinct from the NK T cell subset.
To establish that the T cell clones recognized CD1, a cytolytic assay
was conducted using RMA-S.CD1d1 transfectants and RMA-S untransfected
control cells as targets. Both the CD8+ and DN T cell
clones specifically lysed the CD1-transfected target across a range of
E:T ratios (Fig. 2A). For
example, at E:T 100:1, T cell clone 14S.3 lysed nearly 100% of the
CD1+ target, but only 25% of the untransfected targets
(Fig. 2A). To rule out that the T cell clones were
recognizing a clonal variation unrelated to CD1 expression between the
RMA-S.CD1d1 and RMA-S NT, recognition of mouse L cell fibroblasts
either untransfected or transfected with CD1d1 (14) was also examined.
The 14S T cell clones specifically lysed the L.CD1 but not
untransfected L cells confirming the specificity for CD1-transfected
targets (Fig. 2B).
|
+) T cell clones (Fig. 3).
|
Stimulation of the T cell lines with RMA-S.CD1d1 cells led to the
production of >10,000 pg/106 T cells of IL-4, IL-10, and
IFN-; however, because these T cells were serially propagated in
culture, they lost their ability to produce large amounts of IL-4
despite preservation of the ability to secrete >40,000 pg of
IFN-/106 T cells (data not shown). The T cell clones
most consistently made large amounts of IFN- and IL-10 (Table I). For example, in one representative
assay, the T cell clones 14S.3, 14S.4, 14S.7, 14S.10, and 24.7 all made
>80,000 pg IFN-/106 T cells. In the same assay, these T
cell clones produced between 8,000 and 22,000 pg of
IL-10/106 T cells (Table I). There was more variation among
the T cell clones with respect to the production of IL-2 and IL-4. T
cell clones 14S.3, 14S.4, and 14S.7, did not produce any detectable
IL-2 while clones 14S.10, 24.7, and 24.8 all produced 3,800 to 17,000
pg/106 T cells (Table I). For comparison, the
CD4+ T cell clone AE7 (30), which is specific for pigeon
cytochrome c and is restricted by I-Ek, produced
only IL-2 and IFN-, a pattern typical of Th1 cells (Table I). The
production of both IL-10 and IFN- by the CD1-restricted T cell
clones is distinctly unusual and may reflect a unique in vivo function
for this subset of T cells.
|
usage of the CD1-restricted T cell clones
The canonical V14-J281 TCR V transcript could not be
detected by nested RT PCR in 7 of the 10 T cell clones studied,
although such sequences could be amplified from thymus RNA (data not
shown). This finding was in contrast to the CD1-reactive T-T hybridomas
reported by Bendelac et al. (16) that all used the invariant
V14-J281 TCR.
To determine the V gene usage of the T cell clones, we used inverse
PCR, followed by direct sequencing of the PCR products using a C
antisense primer (Table II, Fig. 4). The three
CD4-CD8- T cell clones, 14S.3, 14S.4, and
14S.7, all had identical V sequences that were encoded by V15
(AV15S1) rearranged to JNew.02 (TRAJ50). A fourth
CD4-CD8- T cell clone (14S15) used V10
(AV10S2 or AV10S9) rearranged to JTA65 (TRAJ49). The variable
regions of the two CD8+ T cell clones 14S.10 and 14S.11
were encoded by two different members of the V11 family, AV11S3 and
AV11S1, respectively. The 14S.11 T cell clone used the J19 (TRAJ40)
joining region, whereas the 14S.10 T cell clone used the JNEW.15
(TRAJ4) joining region. The V sequence of 14S.6 could not be
determined by directly sequencing the PCR product because of the
presence of two V TCR transcripts. After subcloning the PCR product
and sequencing multiple clones, we determined that the productive
rearrangement used V17 (AV17S1) recombined with JTT11 (TRAJ32),
while the nonproductively rearranged transcript was encoded by V3
(AV3S7) and JC5A (TRAJ52). In contrast, the 24.7, 24.8, and 24.9 T
cell clones used the V14-J281 (TRAJ15) rearrangement, as has been
found in NK1.1+ T cells. They all contained a single N
region nucleotide addition at the V-J junction, that preserved the
glycine and aspartate at residues 93 and 94, respectively, and are
characteristic of the invariant VTCR.
|
|
The T cell lines were polyclonal with respect to Vß usage as
determined by flow cytometry with Vß-specific mAbs. In most of the T
cell lines studied, Vß8.1/2 was dominant, and varying proportions of
Vß2-, Vß5.1/2-, Vß7-, and Vß8.3-expressing T cells were
detected (data not shown). The Vß usage of the T cell clones was
determined by RT-PCR analysis followed by sequencing (Table II
, Fig. 4). T cell clones 14S.3, 14S.4, and 14S.7 all expressed identical Vß
TCR rearrangements of Vß8.2 (BV8S2A1) and Jß2.5. The T cell clones
14S.10, 14S.11, 24.8, and 24.9 each expressed unique Vß TCR
rearrangements, but all used a member of the Vß8 family (BV8S1,
BV8S2A3, BV8S2A2, and BV8S3, respectively). Three other T cell clones
used genes from the Vß5, Vß6, and Vß14 families (Table II, Fig. 4).
Thus, despite the diverse array of V gene segments used by the
CD1-reactive T cell clones, five of the eight unique V chains were
paired with a member of the Vß8 family. Moreover, five of the clones
shared a three-amino acid motif in the complementarity-determining
region 3 (CDR3) that consisted of a negatively charged residue followed
by a bulky hydrophobic residue. Clones 24.8, 24.9, 14S11, 14S15, and
14S6 contained the amino acids DWG, while clone 14S3
has the amino acids E-I in the Vß CDR3 region
(Fig. 4). This D/E-hydrophobic amino acid motif
was independent of which Vß or Jß gene segments were used and was
entirely encoded by the TCRDB2 (Dß2) gene segment (Fig. 5). Although the TCRDB2 gene
segment can be translated in all three reading frames, the third
reading frame was selected to be used in all five TCR rearrangements.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ßTCR+ T cells (32, 33, 34). Characteristically, these
unique T cells express a limited TCR repertoire, exemplified by the
canonical rearrangement of V14-J281 which pairs with Vß chains
encoded by the Vß2, Vß7, or Vß8 families (17, 18). However, as
strongly indicated by the data presented in the current study, it is
likely that recognition of mCD1 involves many other T cells beyond the
V14-J281 NK T cell subset.
Cardell et al. provided the first evidence that mCD1 recognition was
not limited to NK1.1+ T cells (35). Hybridomas made from
splenic CD4+ T cells isolated from class II-deficient mice
recognized mCD1, yet did not express the V14-J281 canonical TCR
(35, 36). However, since MHC class II-deficient mice have markedly
abnormal T cell development, it was unclear to what extent these
findings reflected the situation in the normal immune system. Here,
using an approach that allowed detection of unselected T cells that
were CD1d1 reactive, we demonstrated that a wide diversity of TCRs used
by splenic T cells from normal wild-type C57BL/6 mice are capable of
recognizing CD1d1. These in vitro grown T cell clones do not express
the NK1.1 Ag. However, a recent study has questioned the validity of
using the NK1.1 Ag as a lineage marker because under certain
conditions, activation of T cells in vitro leads to down-regulation and
loss of expression of the NK1.1 Ag (37). Since the majority of our T
cell clones express V chains other than V14, it is likely that
these cells did not originate from the NK1.1+ T cell subset
and thus none of the available data support expression of NK1.1 by
non-V14 CD1-reactive T cells. Moreover, since V14-J281 T cells
represented a minority of the CD1d1-reactive T cell clones derived in a
culture system that included all potential CD1d1-reactive splenic T
cells, it appears likely that V14-J281 T cells may represent only
a small fraction of the mCD1-reactive T cells in normal C57BL/6 mice.
The relative paucity of V14+ T cells among our panel of
CD1d1-reactive T cell clones indicates that the V14 TCR is not
required for CD1d1 recognition.
Human studies analyzing TCR sequences for T cells directly reactive to
CD1 or specific to foreign glycolipids presented by CD1a, -b, and -c
also suggest a diverse repertoire of TCRs (E. Grant and M.B.B.,
unpublished observation). While the sequence data presented demonstrate
the diversity of TCRs that are capable of recognizing CD1d1, it is also
clear that preferential use of germline gene elements could be
appreciated (Table II). Vß8 was overrepresented among the T cell
clones, suggesting that the TCR Vß8 family members play a greater
role in mCD1 recognition than previously thought (Table II). Although
the V14-J281 is clearly important for selection of
NK1.1+ T cells, our data suggest that it is the TCRß
chain usage that actually correlates most strongly for T cell
reactivity to mCD1.
The primary sequence of five of eight CD1d1-reactive TCR Vß chains
contained the amino acids DWG in the CDR3 region, a sequence
encoded by the TCRBD2 gene segment when translated in its
third reading frame. In contrast, our review of two large series of
Vß chain sequences associated with the invariant V chain found
this DWG motif only rarely (16, 29). Because the T cell
clones characterized in this report were derived after stimulation in
vitro with RMA-S.CD1d1 cells, the TCR repertoire may have been selected
for reactivity with a serum Ag or an endogenous Ag present in RMA-S
cells. Because neither the nature nor the diversity of endogenous Ags
that CD1 presents is known, it is not possible from our analysis to
ascertain the significance of this motif occurring in >60% of our
Vß chain sequences. However, the location of these three amino acids
in the CDR3 loop suggests that they may play a role in the recognition
of the CD1d1 backbone or some structural feature shared by self ligands
for both V14+ and V14- TCRs.
The derivation of T cell clones provided opportunities to characterize
the function of CD1d1-reactive T cells in ways that are not possible
when T cell hybridomas are studied. CD1-restricted NK1.1+ T
cells produce both IL-4 and IFN- and have been implicated as
important regulatory T cells (37). Although variable levels of IL-4
were produced by the T cell clones described herein, the
non-V14+ T cells were most notable for their production
of substantial amounts of IL-10 and IFN- upon activation. Although
the functional impact of individual T cells producing both IL-10 and
IFN- is not yet appreciated, a similar subset of human T cells
specific for Borrelia burgdorferi have been recently
identified in patients with chronic Lyme disease and may be relevant to
the perpetuation of the disease (38). The capacity of CD1-reactive T
cells to produce Th2-type cytokines may have important implications.
Recent data from humans with type I diabetes mellitus correlated a
marked reduction in the number of the V24-JQ CD1d-reactive T
cells and a diminution of IL-4 production by them with progression to
disease (39). Paired siblings whose V24-JQ T cells continued to
produce IL-4 and who maintained high serum levels of IL-4 did not
develop chronic diabetes despite having multiple risk factors. Systemic
sclerosis and the lpr SLE mouse model have been shown to correlate with
a selective reduction in the V24-JQ T/V14 T cell subsets (40, 41). These results emphasize that CD1-reactive T cells are likely
important regulatory and effector cells that may play a critical role
in autoimmunity.
The CD1-specific T cell clones were efficient cytolytic T cells. Since
these cells were CD4-CD8- or expressed
variable cell surface levels of CD8 homodimers, their cytotoxic
function was independent of the expression of the CD8ß coreceptor.
Similar findings have been observed for several human
CD4-CD8- T cells line that are restricted by
CD1 (42). The capacity of the murine T cell clones to produce large
amounts of IFN- and specifically recognize and lyse CD1+
APC indicates a likely role in host defense or in
hypersensitivity-mediated inflammatory reactions. These results
demonstrate, that similar to the NK T cells, CD1-reactive T cells with
diverse TCRs have the potential to be important regulatory and effector
cells.
We suggest that the large repertoire of murine T cells capable of
recognizing CD1 indicates that distinct endogenous Ags may be loaded by
mCD1 which positively selects diverse T cells. In support of the latter
hypothesis, the crystal structure determination of mCD1 suggests that
the Ag-binding cavity of the molecule is not empty, but contains a
single acyl chain (3). Recognition of -glycosylacylphytosphingosines
by V14+ NK T cells is restricted by mCD1 (15) and
indicates that mCD1 has the ability to present foreign lipid Ags that
are similar structurally to the Ags that have been shown to be
presented by human CD1 (4, 6, 8, 9). The binding of
-galactosylacylphytosphingosine would occupy the dimensions of the
CD1 binding pocket (15). In this context, the various TCRs competent to
recognize mCD1 may reflect the potential for diverse lipid and
glycolipid Ags to be presented. The direct recognition of mCD1 (in the
absence of exogenous Ag) that has been reported, may in fact represent
weak reactivity to endogenous Ags that has been augmented by the use of
APCs that express greater than physiologic levels of mCD1 (e.g., mCD1
transfected cell lines) and T cells that have a low threshold of
activation (e.g., in vitro-cultured T cell clones and hybridomas). In
support of this, the T cell clones described herein had a much weaker
proliferative response to native APC such as splenocytes or thymocytes
than to the CD1-transfected cell lines (S.M.B, unpublished
observations).
The role of lipid Ags bound in the CD1d1 cavity in T cell recognition
will have to await further characterization of the lipids presented by
CD1d1. Our data show that the number and diversity of T cells reactive
to CD1d1 are larger than previously expected, and the ability of these
cells to function as potent cytotoxic T cells and to produce IFN-
and IL-10 in addition to IL-4 emphasizes their likely importance in
immune responses. The correlations of CD1-reactive T cell responses
with murine autoimmune models and human diabetes point further
toward their role in autoimmunity.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Samuel M. Behar, Division of Rheumatology, Immunology and Allergy, Brigham and Women’s Hospital, Smith Building, Room 516C, 1 Jimmy Fund Way, Boston, MA 02115.
3 Abbreviations used in this paper: mCD1, murine CD1; CDR3, complementarity-determining region 3.
Received for publication June 26, 1998. Accepted for publication September 10, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß+ T cells [see comments]. Nature 372:691.[Medline]
14 NKT cells by glycosylceramides. Science 278:1626. chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097./ß+ cells in mouse liver. J. Exp. Med. 183:1277. upon activation by anti-CD3 or CD1. J. Immunol. 159:2240. dependent immunity to Toxoplasma gondii in MHC class I-deficient mice. J. Exp. Med. 178:1465. promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8:466. 12.1+ T cell expansions in the peripheral blood of rheumatoid arthritis patients. J. Exp. Med. 177:1623.ß TCR expression of peripheral V14+ NK T cells. J. Immunol. 158:2076.[Abstract]
-helix-defined peptides in delineating the T cell determinant for pigeon cytochrome c. J. Immunol. 138:1838.[Abstract]
/ß+ cells in the liver of mice. J. Exp. Med. 180:699. and IL-10 secretion in patients with chronic Borrelia burgdorferi infection. J. Immunol. 160:1804.24JQ T cells in type 1 diabetes. Nature 391:177.[Medline]
14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
24JQ antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.This article has been cited by other articles:
|
|
 |
|
  L. Cosmi, R. De Palma, V. Santarlasci, L. Maggi, M. Capone, F. Frosali, G. Rodolico, V. Querci, G. Abbate, R. Angeli, et al. Human interleukin 17-producing cells originate from a CD161+CD4+ T cell precursor J. Exp. Med., August 4, 2008; 205(8): 1903 - 1916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Berzofsky and M. Terabe NKT Cells in Tumor Immunity: Opposing Subsets Define a New Immunoregulatory Axis J. Immunol., March 15, 2008; 180(6): 3627 - 3635. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, S. Teneberg, P. Thapa, A. Bendelac, S. B. Levery, and D. Zhou Sensitive detection of isoglobo and globo series tetraglycosylceramides in human thymus by ion trap mass spectrometry Glycobiology, February 1, 2008; 18(2): 158 - 165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Ambrosino, M. Terabe, R. C. Halder, J. Peng, S. Takaku, S. Miyake, T. Yamamura, V. Kumar, and J. A. Berzofsky Cross-Regulation between Type I and Type II NKT Cells in Regulating Tumor Immunity: A New Immunoregulatory Axis J. Immunol., October 15, 2007; 179(8): 5126 - 5136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. VanderLaan, C. A. Reardon, Y. Sagiv, L. Blachowicz, J. Lukens, M. Nissenbaum, C.-R. Wang, and G. S. Getz Characterization of the Natural Killer T-Cell Response in an Adoptive Transfer Model of Atherosclerosis Am. J. Pathol., March 1, 2007; 170(3): 1100 - 1107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Raghuraman, Y. Geng, and C.-R. Wang IFN-beta-Mediated Up-Regulation of CD1d in Bacteria-Infected APCs J. Immunol., December 1, 2006; 177(11): 7841 - 7848. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. O. Ilyinskii, R. Wang, S. P. Balk, and M. A. Exley CD1d Mediates T-Cell-Dependent Resistance to Secondary Infection with Encephalomyocarditis Virus (EMCV) In Vitro and Immune Response to EMCV Infection In Vivo J. Virol., July 15, 2006; 80(14): 7146 - 7158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Brigl, P. van den Elzen, X. Chen, J. H. Meyers, D. Wu, C.-H. Wong, F. Reddington, P. A. Illarianov, G. S. Besra, M. B. Brenner, et al. Conserved and Heterogeneous Lipid Antigen Specificities of CD1d-Restricted NKT Cell Receptors J. Immunol., March 15, 2006; 176(6): 3625 - 3634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Ragin, N. Sahu, and A. August Differential Regulation of Cytokine Production by CD1d-Restricted NKT Cells in Response to Superantigen Staphylococcal Enterotoxin B Exposure Infect. Immun., January 1, 2006; 74(1): 282 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Terabe, J. Swann, E. Ambrosino, P. Sinha, S. Takaku, Y. Hayakawa, D. I. Godfrey, S. Ostrand-Rosenberg, M. J. Smyth, and J. A. Berzofsky A nonclassical non-V{alpha}14J{alpha}18 CD1d-restricted (type II) NKT cell is sufficient for down-regulation of tumor immunosurveillance J. Exp. Med., December 19, 2005; 202(12): 1627 - 1633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Vincent, X. Xiong, E. P. Grant, W. Peng, and M. B. Brenner CD1a-, b-, and c-Restricted TCRs Recognize Both Self and Foreign Antigens J. Immunol., November 15, 2005; 175(10): 6344 - 6351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-T. Chen and J. T. Kung CD1d-Independent Developmental Acquisition of Prompt IL-4 Gene Inducibility in Thymus CD161(NK1)-CD44lowCD4+CD8- T Cells Is Associated with Complementarity Determining Region 3-Diverse and Biased V{beta}2/V{beta}7/V{beta}8/V{alpha}3.2 T Cell Receptor Usage J. Immunol., November 15, 2005; 175(10): 6537 - 6550. [Abstract] [Full Text] [PDF]
|
|
|
|
, RMA-S.CD1d1;
RMA-S; •, L.CD1; 
, L cells. Results are representative of two
to five experiments.
