The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrer, T.
Right arrow Articles by Walker, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrer, T.
Right arrow Articles by Walker, B. D.
The Journal of Immunology, 1998, 161: 4875-4881.
Copyright © 1998 by The American Association of Immunologists

Recognition of Two Overlapping CTL Epitopes in HIV-1 p17 by CTL from a Long-Term Nonprogressing HIV-1-Infected Individual1

Thomas Harrer2,*,{dagger}, Ellen Harrer*,{dagger}, Peter Barbosa3,{ddagger}, Friedemann Kaufmann, Ralf Wagner, Susanne Brüggemann*, Joachim R. Kalden*, Mark Feinberg{ddagger},§, R. Paul Johnson{dagger}, Susan Buchbinder|| and Bruce D. Walker{dagger}

* Department of Medicine III with Institute of Clinical Immunology, University of Erlangen-Nuremberg, Erlangen, Germany; {dagger} Partners AIDS Research Center and Infectious Disease Unit, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02129; {ddagger} Gladstone Institute, San Francisco, CA 94141; § Center of AIDS Research, San Francisco, CA 94141; Institute of Medical Microbiology, University of Regensburg, Regensburg, Germany; and || AIDS Office, Department of Public Health, San Francisco, CA 94140


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HIV-1 infection has been shown to elicit strong CTL responses in some infected persons, but few data are available regarding the relationship between targeted epitopes and in vivo viral quasispecies. In this study, we examined the CTL response in a person infected for 15 yr with a CD4 count persistently >500 cells/µl. The dominant in vivo activated CTL response was directed against two overlapping Gag CTL epitopes in an area of p17 known to be essential for viral replication. The 9-mer SLYNTVATL (amino acids 77–85) was recognized in conjunction with HLA-A2, whereas the overlapping 8-mer TLYCVHQR (amino acids 83–91) was recognized by HLA-A11-restricted CTL. Analysis of in vivo virus sequences both in PBMC and plasma revealed the existence of sequence variation in this region, which did not affect viral replication in vitro, but decreased recognition by the A11-restricted CTL response, with maintenance of the A2-restricted response. These results indicate that an essential region of the p17 protein can be simultaneously targeted by CTL through two different HLA molecules, and that immune escape from CTL recognition can occur without impairing viral replication. In addition, they demonstrate that Ag processing can allow for presentation of overlapping epitopes in the same infected cell, which can be affected quite differently by sequence variation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CD8-positive CTL play an important role in the suppression of viral replication both in animal models and in human viral infections (1, 2). A vigorous HIV-1-specific CTL response has also been observed in HIV-1-infected individuals (3, 4, 5, 6, 7, 8), and recent data suggest that CTL are associated with control of HIV-1 replication both in primary HIV-1 infection (9, 10, 11, 12, 13) and also in at least a subset of persons with long-term nonprogressing HIV-1 infection (14, 15, 16, 17, 18, 19). However, despite evidence of vigorous CTL responses, viral replication continues and the majority of infected persons progress to AIDS. Factors that permit the virus to persist remain undefined, although sequence variation leading to escape from both cellular and humoral immune responses has been hypothesized to contribute.

CTL recognize processed viral proteins that are proteolytically cleaved in the cytosol of infected cells and transported to the endoplasmic reticulum by specific transporter molecules. The transported peptides then stabilize the folding of class I molecules, associate with ß2-microglobulin, and are ultimately expressed at the cell surface (20). Even single amino acid (aa)4 changes, which occur frequently in RNA viruses, are often sufficient to abrogate class I binding or recognition by the TCR (21). Under antiviral drug pressure, mutations can increase to fixation in plasma within weeks (22). Strong immunologic pressure would likewise be expected to result in the selective growth of viruses that are not recognized.

In HIV-1 infection, a number of studies have demonstrated the presence of CTL escape variants (10, 18, 23, 24, 25, 26, 27, 28), but few studies have simultaneously examined more than one epitope in a given individual (29), and few studies have concurrently examined both plasma RNA and cultured virus for escape mutations. Furthermore, few data are available regarding the epitopes targeted by persons with long-term nonprogressing infection. In the majority of patients, CTL do not prevent progression of disease and the development of progressive immunodeficiency. A better understanding of the epitopes targeted by the CTL response as well as the occurrence of mutations within these epitopes is a necessary step in beginning to understand the role of CTL in this chronic viral disease. In this study, we examined the breadth and specificity of the CTL response in a person with nonprogressing illness, and relate these findings to the in vivo viral quasispecies.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patient

Subject 14279 is an HIV-1-seropositive person with documented seroconversion by 1978, based on analysis of frozen serum samples. He was clinically asymptomatic and maintained normal CD4 cell counts between 1,049 and 821/µl during the study period (14–16 yr after infection), and a CD4 count of 1,061/µl 23 mo after the first evaluation. Viral load analyses, performed as described below, ranged from 38,000 to 302,000 HIV-1 RNA copies/ml for the duration of study, and viral load was 110,000 copies/ml 7 mo later after the studies were completed. The patient was not receiving antiviral therapy.

HIV-1 quantitation

HIV-1 plasma viremia was quantitated using either quantitative competitive PCR (Amplicor HIV monitor test; Roche, Basel, Switzerland) or the branched DNA signal amplification assay (Quantiplex HIV-RNA assay; Chiron, Emeryville, CA).

Cell lines

EBV-transformed B-LCL were established and maintained as described previously (30). Allogeneic B-LCL were also obtained from American Society for Histocompatibility and Immunogenetics B cell line repository. The A11-transfected cell line T2-A11, expressing only HLA-A2 and A11, was generously provided by Dr. Masucci (Karolinska Institute, Stockholm, Sweden) (31).

HLA typing

HLA typing was performed using standard serologic techniques in the laboratory of Dr. Dean Mann at National Cancer Institute (Frederick, MD). The complete HLA type of subject 14279 is A 2,11; B 13,35; Cw 4 DR 3,11; DRW 52; DQ 27.

Recombinant vaccinia viruses

The recombinant vaccinia viruses vAbt141 expressing the full-length p55 gag protein, v/228 expressing the p17 subunit, and v/286 expressing the p24 subunit were kindly provided by Drs. Gail Mazzara and Dennis Panicali (Therion Biologics, Cambridge, MA) (32). Recombinant vaccinia viruses expressing the HIV-1-RT (VCF21), envelope (PE16), and the control lacZ(v/lac) genes were provided by Dr. Bernard Moss (Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, MD).

Synthetic HIV-1 peptides

Peptide p17.5 corresponding to the HIV-1 PV22 sequence was synthesized by Multiple Peptide Systems (San Diego, CA) as a C-terminal amide, as described (33). Peptides p17.5 a, b, and c were synthesized by Cambridge Research Biochemicals (Cambridge, MA), and peptide p17.ck by Quality Controlled Biochemicals (Hopkington, MA), all as free acids. The sequences of the peptides are: p17.5, QTGSEELRSLYNTVATLYCVHQRIE (aa 69–93); p17.5a, ELRSLYNTV (aa 74–82); p17.5b, SLYNTVATL (aa 77–85); p17.5c, TLYCVHQRI (aa 84–92); and p17.5ck, TLYCVHQKI (aa 84–92). Control peptides consisted of the HIV-1 (PV22)-derived envelope peptide 116, IVTHSFNCGGEFFYCNSTQLFNSTW; the p24-specific peptide p24/124; the RT-derived peptide RT50 (NPDIVIYQYMDDLYVGSDLEIGQHR); or an HIV-1-RT peptide IV9, ILKEPVHGV (34). Additional peptides for fine mapping were synthesized as free acids with an automated peptide synthesizer (Applied Biosystems model 432A, Foster City, CA). Lyophilized peptides were reconstituted at 2 mg/ml in sterile distilled water with 10% dimethylsulfoxide with or without 1 mM DTT.

Generation of HIV-1-specific CTL lines by peptide stimulation

One million autologous B-LCL were incubated for 1 h with peptide at a concentration of 100 µg/ml in 200 µl R10 medium (RPMI medium supplemented with antibiotics, HEPES, and 10% FCS). After washing with R10 medium, cells were irradiated with 60 Gy {gamma}-irradiation and then cocultivated with 3.4 million PBMC in 1.2 ml R10 on a 24-well plate. Plates were incubated at 37°C and 5% CO2 and fed with partial medium exchanges one or two times per week. From day 3 on, IL-2 was added at a final concentration of 10 U/ml and was increased to 100 U/ml after 2 wk. After 4 wk, cells were restimulated with the CD3-specific mAb 12F6 (35) at a concentration of 0.1 µg/ml along with irradiated PBMCs from healthy blood donors in R10 with 30 U/ml IL-2. At later time points, cells were restimulated with either autologous or HLA-matched peptide-sensitized 60 Gy irradiated B-LCL every 2 wk.

Generation of HIV-1-specific CTL lines by stimulation with HIV-1-infected CD4 cells

Five million PBMCs were incubated with a CD3:CD8 bispecific mAb overnight at a concentration of 5 µg/ml in 1 ml R10 with 100 U IL-2/ml. The Ab binds with one arm CD3 and with the other arm CD8, and stimulates CD4 cells while depleting CD8 cells (35). The next day, supernatant was removed, and 2 ml of HIV-1-IIIB containing H9-cell supernatant (p24 concentration, 0.7 µg p24/ml) supplemented with 100 U/ml IL-2 was added. Two days later, cells were washed in R10, irradiated with 30 Gy, and cocultured in R10 without IL-2 with 10 million PBMC, which had been kept in R10 for 3 days without stimulation. On day 3, IL-2 was added to a final concentration of 20 U/ml, and increased to 100 U/ml after 1 wk.

Generation of HIV-1-specific CTL clones by cloning with CD3-specific Ab

CTL clones were isolated and maintained as already described (36), using the CD3-specific mAb 12F6 as stimulus for T cell proliferation (35). Developing clones were screened for CTL activity against autologous target cells expressing RT, Env, Gag, and Nef proteins, as well as the control ß-galactosidase protein. Clones with sp. act. were then restimulated every 10 to 14 days with anti-CD3 and irradiated allogeneic PBMC.

Flow-cytometric analysis

Phenotypic analysis was performed using fluorescent probe-conjugated anti-CD8 mAb and phycoerythrin probe-conjugated anti-CD4 mAb, or similarly labeled control mAb (Coulter Electronics, Hialeah, FL), as described (33).

Cytotoxicity assay

B-LCL were either infected by recombinant vaccinia viruses or sensitized with synthetic peptides (10–100 µg/ml), as described, and tested in a 4-h chromium release assay (29). Supernatant fluid was harvested and counted on an LKB CliniGamma gamma counter (Pharmacia, Turku, Finland). Spontaneous release was less than 30% of maximum release, unless otherwise noted. For peptide titrations, chromium-labeled target cells were incubated with peptides on a 96-well plate for 1 h before adding effector cells. In some experiments, cold-target inhibition (cold:hot ratio 10:1) was used to lower background levels of presumed EBV-specific CTL.

Virus isolation and RNA preparation

Viral particles were isolated from supernatant after in vitro coculture (37) of PBMCs by centrifugation of 200 µl of supernatant for 1 h at 4°C and 22,000 rpm. The pellet was resuspended by vortexing in 0.8 ml of TRIzol reagent and incubated 5 min at room temperature. Chloroform (0.2 ml) was added, followed by shaking and a second 5-min incubation at room temperature. Samples were spun for 15 min at 12,000 rpm at 4°C, and the aqueous phase was transferred to a polyallomer tube containing 10 µl of glycogen at a concentration of 2 µg/µl. After adding 0.5 ml of isopropanol, samples were incubated at room temperature for 10 min. RNA was precipitated by spinning for 10 min at 22,000 rpm at 4°C, followed by a 70% ethanol wash. Pellets were allowed to dry and then resuspended in 100 µl of H2O.

Reverse transcription and PCR amplification

A quantity amounting to 5 to 10 µl of RNA preparation was transcribed using random primers, as described (38), and Superscript reverse transcriptase (Life Technologies, St. Lawrence, MA). PCR was performed with Stratagene taq polymerase (Stratagene, La Jolla, CA) and with 40 cycles with amplification at 94°C for 30 s, annealing at 52.5°C for 30 s, and 72°C for 45 s. A 5' primer ATCGGGATCCTGGAAAGGATCACCATC (position 919–935) and a 3' primer GATCGGATCCTCTTAATTCCTCTATT (position 1081–1065) were used. Underlined sequences indicate BamHI tags added for cloning purposes.

Cloning and sequencing

PCR products were cloned using the TA Cloning System (Invitrogen, San Diego, CA). Clones containing the desired insert were sequenced using the M13 universal primer in the PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit from Applied Biosystems.

Construction of recombinant proviruses

A puC8 derivative, plin8pr55 (39), including the complete gag gene of HX10, was used as a template to generate the matrix mutations Q90E and R91Q (aa numbering according to HIV-1 LAI sequence). Site-directed mutagenesis was performed by applying the QuikChange Site-directed mutagenesis kit (Stratagene, La Jolla, CA) on the dsDNA template of plin8Pr55. The following oligonucleotides were used: Q90E (5'-C CTC TAT TGT GTG CAT GAA AGG ATA GAG ATA AAA GAC ACG AAG GAA GCT TTA GAC AAG ATA GAG G-3') and R91Q (5'-C CTC TAT TGT GTG CAT CAA CAA ATA GAG ATA AAA GAC ACC AAG GAG GCT TTA GAC AAG ATA GAG G-3'). Underlined letters indicate the codon coding for the mutant clones. The presence of the desired mutations was confirmed by sequencing the complete gag reading frame by Taq cycle sequencing (Applied Biosystems, Weiterstadt, Germany). A 667-bp Glal/SpeI fragment of each mutant was subsequently subcloned into the proviral HX10 DNA construct to generate pHX10Q90E and phX10R91Q.

Cells and transfection

COS 7 cells were maintained in DMEM supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine. Transfections were performed by the Ca(PO4)2 procedure, as described elsewhere (40). CEM 4 cells were obtained from American Tissue Type Culture Collection (Manassas, VA) and grown in RPMI 1640 medium supplemented as described above. Cells were transfected with the mutant provirus constructs by the DEAE transfection procedure, essentially as described (41). Briefly, cells (5 x 106) were washed in 5 ml STBS (25 mM Tris/HCl, pH 7.4, 137 mM NaCl, 5 mM KCl, 0.6 mM Na2HPO4, 0.7 mM CaCl2, and 0.5 mM MgCl2) and resuspended in a mixture of STBS transfection buffer containing 10 µl of sterile DEAE dextran (10 mg/ml) together with 5 µg of the proviral DNA. After 30 min of incubation at 37°C, cells were washed twice in STBS, resuspended in 6 ml of complete RPMI 1640, and seeded in a 25-cm3 flask.

Monitoring of virus release and replication

COS 7 cells and cell culture supernatants containing released virus particles were harvested at day 2 and day 4 after transfection. Transfected CEM 4 cells were split every 2 days at a ratio of 1:3 to maintain the cells in rapid growth. Aliquots of the supernatants were harvested each second day. Release and replication of the wild-type and mutant HIVs following transfection of the proviral DNAs into CEM cells were monitored using a commercial p24 capture assay (DuPont NEN, de Nemours, Belgium) and, for comparison, by a nonradioactive reverse-transcriptase assay (Boehringer Mannheim, Penzberg, Germany). For Western blot analysis, supernatants were precleared by low speed centrifugation; viruses were then pelleted at 100,000 g for 1 h at 20°C. Cell pellets and virus pellets were dissolved in boiling mix (125 mM Tris/HCl, pH 6.8, 2% (w/v) SDS, 10% (w/v) ß-mercaptoethanol, 10% (w/v) glycerine, 1 mM EDTA, and 0.005% (w/v) bromophenol blue) and analyzed by conventional Western blot analysis following separation of the proteins on a denaturing 12% SDS-PAGE. HIV-1 Gag proteins were specifically detected by a mAb specifically detecting aa 307–336 within Pr55gag (mAb 16/4/2) (42).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
CTL activity of freshly isolated PBMC

Initial studies were performed to determine whether in vivo activated circulating CTL could be detected in fresh PBMC from subject 14279. This subject had been infected for 14 yr, yet maintained a CD4 count >500/mm3, and was thus classified as a long-term nonprogressor (16, 43). Using autologous B-LCL infected with recombinant vaccinia viruses, vigorous lysis of Gag- and Env-expressing target cells was observed (Fig. 1Go). The dominant target of these in vivo activated CTL was in the Gag protein, and this response was cross-reactive with the laboratory strains HIV-1-IIIB and SF2.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 1. HIV-1-specific bulk CTL activity. Fresh unstimulated PBMC from subject 14279 were tested against autologous B-LCL infected with recombinant vaccinia viruses expressing HIV-1 proteins in a 6-h 51chromium release assay. The E:T ratios were 100:1, 50:1, and 25:1. The recombinant vaccinia viruses expressed RT of HIV-1-IIIB, Gag of HIV-1-IIIB, Env of HIV-1-IIIB (PE16), Gag of HIV-1-SF2, Nef of HIV-1-SF2, Env of HIV-1-MN, and the control lac.

 
Epitope specificity of the dominant CTL response

Having identified a dominant response in gag, we next determined the epitopes targeted by this response. Since an HLA-A*0201 epitope in the gag-p17 region had been reported (33), we first determined whether the Gag-specific CTL response in the HLA-A2-positive subject 14279 targeted this epitope. PBMCs were stimulated with peptide-sensitized autologous B cells using the 22-aa peptide p17.5 containing the epitope (33). As a control, PBMCs were cultured without stimulator cells in R10 for 3 days, after which rIL-2 at 10 U/ml was added. Expanded cells were tested for killing against the autologous peptide-sensitized B-LCL. Strong lysis of the p17.5-sensitized targets was observed along with evidence of background EBV-specific lysis in the cultures stimulated with peptide-sensitized B-LCL (Fig. 2GoA). In those cultures expanded without specific stimulation by peptide-sensitized B cells, CTL also could be detected that specifically recognized peptide p17.5 (Fig. 2Go), providing evidence of a high precursor frequency of these cells in the PBMCs (Fig. 2GoB).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2. Recognition of two overlapping CTL epitopes. A and B, PBMC were stimulated either with peptide p17.5-pulsed autologous B-LCL (A) or with IL-2 alone (B). At day 17, expanding cells were tested at an E:T ratio of 25:1 in a 5-h 51chromium release assay against autologous B-LCL sensitized for 1 h with peptide p17.5 (QTGSEELRSLYNTVATLYCVHQRIE), control peptide iv-9 (ILKEPVHGV), or with no peptide. C, Four days later, the p17.5-stimulated PBMC were tested in a 5-h 51chromium release assay at an E:T ratio of 20:1 against autologous target cells sensitized with the peptides p17.5a (ELRSLYNTV), p17.5b (SLYNTVATL), and p17.5c (TLYCVHQRI).

 
Having identified a CTL response to the peptide p17.5, which contains an A2-restricted CTL epitope, we next synthesized three 9-aa-long peptide truncations from peptide p17.5 fitting the proposed HLA-A2 binding motif for peptides (44) with a leucine at position 2 and a hydrophobic aa at position 9 (valine for p17.5a, leucine for p17.5b, and isoleucine for p17.5c). Using the same cell line as above, we observed specific killing of target cells sensitized with either p17.5b or p17.5c, but not of target cells sensitized with peptide p17.5a or control peptides (Fig. 2GoC). Immune fluorescence analysis demonstrated a pure CD8+ phenotype of this cell line (not shown). Subsequent analysis of the HLA restriction showed that peptide p17.5b SLYNTVATL was recognized in association with HLA-A2, and thus represents a previously described A2-restricted epitope (34, 45). In contrast, peptide p17.5c was recognized in association with HLA-A11 (Fig. 3Go). This indicated that the cell line contained CTL with two different specificities: either peptide p17.5b or p17.5c. This was proven by segregating the p17.5b and the p17.5c sp. act. by restimulation of the cell line with peptide-pulsed HLA-A11 or HLA-A2-matched B-LCL, resulting in cell lines specific for the respective stimulating peptide, and loss of CTL specificity for the peptide not used in the stimulations (data not shown). Further evidence for the presence of two populations of CTL was obtained by limiting dilution cloning. Cells were stimulated at limiting dilution with the CD3-specific mAb 12F6, in the presence of irradiated allogeneic feeder cells. Applying this method, we identified a Gag-specific CTL clone, which also revealed an HLA-A11-restricted specificity against the peptide p17.5c, but not against p17.5b. The CTL activity against these two epitopes could be induced in the subject also at later time points (11 and 15 mo after the first evaluation) by in vitro stimulation of PBMC with both HIV-1 IIIB-superinfected (46) and peptide p17.5-sensitized irradiated autologous CD4 cells (data not shown).



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 3. Analysis of HLA restriction. P17.5b (A)- or p17.5c (B)-specific CTL lines were tested for lysis of autologous and of HLA-matched or mismatched B-LCL sensitized with peptides in a 5-h 51chromium release assay. The HLA type of the autologous B-LCL is A2, A11, B35, B13, C4, C-. Specific lysis was calculated for each target tested by subtracting the specific lysis of targets sensitized with a control peptide from the specific lysis of targets sensitized either with peptide p17.5b (SLYNTVATL) or with peptide p17.5c (TLYCVHQRI). A, PBMC were stimulated with HIV-1-IIIB-superinfected autologous CD4 cells and tested for recognition of peptide p17.5b or a control peptide (ILKEPVHGV) at an E:T ratio of 30:1. B, The p17.5c-specific CTL line was tested for recognition of peptide p17.5c or of the control peptide RT50 (NPDIVIYQYMDDLYVGSDLEIGQHR) at an E:T ratio of 20:1.

 
The HLA-A11-restricted epitope in p17 was further defined by smaller peptides. For HLA-A11, a putative HLA binding motif has been described with either M, L, F, Y, I, or A at position 2, and K or R as C-terminal anchor residues with interposition of 4 or 5 aa (47). This motif is fit by the 8-mer TLYCVHQK with a leucine at position 2 and a lysine at position 8 (Fig. 4GoA). The 9-mer ATLYCVHGK demonstrated higher specific lysis than the 8-mer TLYCVHGK, but the SD50 concentrations of both peptides for half-maximal lysis were similar with approximately 10 ng/ml. Together these data indicate that overlapping peptides can be processed and provided for CTL recognition in the same subject.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 4. Recognition of sequence variation within the HLA-A11-restricted epitope. A, p17.5c-specific cell lines from subject 14279 were tested against autologous B-LCL or the HLA-A11-matched T2-A11 cell line, sensitized with truncated and variant peptides at an E:T ratio of 10:1. Data shown are combined from three different experiments. B, p175c-specific cell lines from subject 14279 were tested against the HLA-A11-matched B-LCL TH. Because of background killing against the B-LCL by the CTL line, probably due to the presence of a presumably EBV-specific CTL, cold-target inhibition was used. For this purpose, a 10x surplus of nonradioactive TH B-LCL without peptide labeling was added to all wells.

 
Analysis of autologous viral sequences

We next determined whether this targeted immune pressure was associated with any detectable sequence variation within the identified epitopes. Sequences corresponding to the CTL epitopes were amplified by PCR using plasma as well as virus culture supernatants, cloned, and sequenced. No mutations could be detected in the HLA-A2-restricted CTL epitope, either in plasma RNA or culture supernatants. Concerning the HLA-A11-restricted epitope, a mixture of viral variants was found in the plasma with either a GLN or a GLU at position 91 and in the virus culture supernatant with either a LYS or a GLN at position 90 (Table IGo).


View this table:
[in this window]
[in a new window]
  		Table I. Sequence analysis of autologous virus (aa 77–91) in subject 142791

 
Effect of sequence variation in p17 CTL epitopes on recognition by specific CTL

In peptide titration experiments, the A2-restricted peptide SLYNTVATL could sensitize at concentrations as low as 1 ng/ml (Fig. 5Go). As sequencing of autologous viruses did not reveal any mutations in the A2-restricted epitope, we tested with synthetic peptides the influence of four different aa substitutions corresponding to the majority of viral variants, as published in the 1992 Los Alamos Database (48). All variants were recognized at high peptide concentrations, but there was up to a 3-log difference in the SD50 (concentration of peptide required for half-maximal lysis) for the various peptides. These data indicate that this CTL response has limited ability to recognize allowable variants within this region, and yet these variants did not dominate in vivo in this person.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5. Recognition of sequence variation within the HLA-A2-restricted CTL epitope. p17.5b-specific cell lines from subject 14279 were tested against autologous target cells sensitized with the variant peptides at the indicated concentrations. E:T ratio was 20:1. Peptide p24/124 from HIV-1 p24 served as a control peptide.

 
Analysis of the viral sequences corresponding to the A11-restricted epitope demonstrated the presence of three viral variants showing either a lysine or a glutamine at position aa 91 or a glutamate at position aa 90 together with a lysine at position aa 91 (Table IGo). Analyzing the influence of the various aa substitutions on recognition by CTL, we observed similar recognition of the 91K and 91R variants down to 1 to 10 µg/ml (Fig. 4GoA). The in vivo variants aa 91-Q and aa 90-E were able to sensitize only at high concentrations of 100 µg/ml, with a loss of recognition already at 10 µg/ml (Fig. 4GoA). When these analyses were repeated with variant peptides with the P9 anchor residue 91-Q or 91-K at the C-terminal end, the aa 91-Q variant was still recognized, albeit less than the K variant, whereas the 90-E variant peptide was not able to sensitize for lysis by CTL (Fig. 4GoB).

To examine the effects of these mutations on viral fitness, mutant viruses were established by site-directed mutagenesis. When these mutant proviruses were transfected into CEM (Fig. 6Go) or COS cells (data not shown), there was no difference in the production of virus compared with the wild-type virus, as determined by p24 Ag detection in the cellular supernatant. Therefore, the mutations at positions 90 and 91, which resulted in decreased immune recognition, do not abrogate virus production, although other closely related mutations at positions 85 and 88 have been shown to significantly impair virus replication (49).



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 6. Analysis of replication of HIV-1 variants. CEM 4 cells transfected with either HIV-HX10, the HIV-HX10Q90E mutant, or the HIV-HX10R91Q mutant were analyzed for HIV-1 p24 Ag production over time.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this long-term nonprogressing HIV-1-infected individual, we identified two overlapping CTL epitopes restricted by two different HLA Ags: HLA-A2 and HLA-A11. The HLA-A2-restricted CTL epitope SLYNTVATL, which is the immunodominant A*0201-restricted epitope (50), fits the HLA-A2 binding motif with leucines at the P2 and P9 anchor positions (44). As reported for other A2-restricted epitopes, an aromatic aa, tyrosine, is found at the P3 position and a valine at the P6 position (51). The characteristic anchor residues of the HLA-A11 binding motif are a leucine at position 2 and a lysine or an arginine at the C-terminal end at position P8 to P11 (52). The 8-mers TLYCVHQK/R fit this binding motif. Although the 9-mer ATLYCVHQK showed higher specific lysis at high peptide concentrations than the 8-mer TLYCVHQK, both demonstrated similar peptide concentration of 10 ng/ml for half-maximum lysis. Therefore, we would regard the 8-mer TLYCVHQK as the optimal peptide.

Peptides presented by HLA molecules are derived from the cytoplasm, where they are generated by enzymatic processing of endogenously synthesized proteins by the proteasome complex (53, 54). The precise mechanism of this processing and the involved enzymes are not yet resolved, but mutations both within and adjacent to CTL epitopes can significantly alter peptide processing (55, 56). Specific proteases in this complex cleave proteins sequentially according to their protease specificity. The small 8- to 12-amino-acid-long peptides are then transported into the endoplasmic reticulum by the two TAP-transporter proteins, where they can associate with HLA molecules (57). The observation of two overlapping epitopes in the same subject provides interesting insights into the peptide-generating process. To cut overlapping peptides, the proteins have to associate with enzymes, which have the flexibility to cleave the proteins by different ways. Alternatively, longer peptides might reach the ER, bind to HLA molecules, and be enzymatically trimmed to the correct length.

The CTL epitopes targeted by this subject are located in a region of the HIV-1 sequence in which a number of viral variants have been reported (48). Analysis of autologous viral sequences containing the HLA-A11-restricted epitope revealed the presence of three viral strains. Both the substitution of the putative anchor lysine at position 91 by the uncharged aa glutamine, as found in the virus culture supernatant, and, even much more pronounced, the substitution of the glutamine at position 90 by the negatively charged glutamate, as found in plasma, caused a strong decrease of recognition.

Despite the presence of three viral variants in the HLA-A11 epitope, no variants were detected in the A2 epitope, although substitutions in this region have frequently been published (48, 58). This might be due to lack of selection by the immune system in this individual or to broad cross-recognition of possible variants.

Although HIV-1 is a virus with an enormous sequence variability, it is likely that there are constraints on the accumulation of mutations. By site-directed mutagenesis, it has been demonstrated that single aa mutations within these epitopes (aa 84–88) strongly inhibited or abrogated viral replication in vitro in CEM cells (49). In contrast, the CTL epitope mutations Q90E and R91Q, which we observed in subject 14279, had no negative effect on replication or cytopathic effects of HIV-1 on an HX10 background in CEM4 cells in our experiments. However, we have not studied potential influences of these mutations on replication and virulence of HIV-1 in other cell types. Interestingly, despite the high viral load, the patient preserved a normal CD4 count in the follow-up, suggesting an attenuated virulence of the patient’s autologous viral quasi species.

We could not detect aa substitutions in the HLA-A2-restricted CTL epitope, although mutations in this epitope frequently are found in the Los Alamos Database (48). In a recent study, CTL escape was found to be associated with an aa substitution at the P2 position of the A2 epitope (58). It only can be speculated whether the variation in the A11 epitope has put constraints on the variability in the A2 epitope. We hypothesize that targeting a localized area by two epitopes restricted by two different HLA molecules, as in this nonprogressing long-term seropositive person, may decrease the chances of the virus to evade the immunologic pressure by escape mutations in both epitopes without compromising its structure and function.

Based on mathematical models on antigenic oscillation and shifting immunodominance, it has been proposed that a CTL response against one or few epitopes should be more favorable than recognition of numerous epitopes (26). In this patient, we could define another unique CTL epitope in RT (59). Additional CTL clones against envelope and Nef were isolated, but not yet further analyzed. This indicates a polyclonal CTL response against at least five different epitopes in this patient. CTL clones against the two p17 epitopes could be recovered at several time points during the follow-up for more than 1 yr, despite the presence of putative escape variants in the A11-restricted p17 epitope. This indicates that it is possible to maintain a polyclonal CTL response for prolonged periods of time. Whether the high viral load is due to partial escape from CTL responses remains speculative.


   Footnotes
 
1 This work was supported by grants from Bundesministerium für Bildung und Forschung, Deutsche Forschungsgemeinschaft (SFB 466), and Bayerische Staatsministerium für Kultus, Erziehung und Wissenschaft (T.H.); and by the National Institutes of Health (AI28568 and AI30914). Back

2 Address correspondence and reprint requests to Dr. Thomas Harrer, Department of Medicine III with Institute of Clinical Immunology, University of Erlangen-Nürnberg, Krankenhausstrasse 12, 91054 Erlangen, Germany. E-mail address: Back

3 Current address: California College of Podiatric Medicine, San Francisco, CA 94141. Back

4 Abbreviations used in this paper: aa, amino acid; B-LCL, B lymphoblastoid cell line. Back

Received for publication March 16, 1998. Accepted for publication June 25, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Reddehase, M., F. Weiland, K. Muench, S. Jonjic, A. Lueske, U. Koszinowski. 1985. Interstitial murine cytomegalovirus pneumonia after irradiation: characterization of cells that limit viral replication during established infections of the lungs. J. Virol. 55:264.[Abstract/Free Full Text]
  2. Walter, W. A., P. D. Greenberg, M. J. Gilbert, R. J. Finch, K. S. Watanabe, E. D. Thomas, S. R. Riddell. 1995. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor. N. Engl. J. Med. 333:1038.[Abstract/Free Full Text]
  3. Walker, B. D., S. Chakrabarti, B. Moss, T. Paradis, T. Flynn, A. Durno, R. S. Blumberg, J. C. Kaplan, M. S. Hirsch, T. T. Schooley. 1987. HIV-specific cytotoxic T lymphocytes in seropositive individuals. Nature 328:345.[Medline]
  4. Nixon, D. F., A. R. Townsend, J. G. Elvin, C. R. Rizza, J. Gallwey, A. J. McMichael. 1988. HIV-1 gag-specific cytotoxic T lymphocytes defined with recombinant vaccinia virus and synthetic peptides. Nature 336:484.[Medline]
  5. Koenig, S., P. Earl, D. Powell, G. Pantaleo, S. Merli, B. Moss, A. S. Fauci. 1988. Group-specific, major histocompatibility complex class I-restricted cytotoxic responses to human immunodeficiency virus 1 (HIV-1) envelope proteins by cloned peripheral blood T cells from an HIV-1-infected individual. Proc. Natl. Acad. Sci. USA 85:8638.[Abstract/Free Full Text]
  6. Koup, R. A., J. L. Sullivan, P. H. Levine, D. Brettler, A. Mahr, G. Mazzara, S. McKenzie, D. Panicali. 1989. Detection of major histocompatibility complex class I-restricted, HIV-specific cytotoxic T lymphocytes in the blood of infected hemophiliacs. Blood 73:1909.[Abstract/Free Full Text]
  7. Plata, F., B. Autran, L. Martins. 1987. AIDS virus-specific cytotoxic T lymphocytes in seropositive individuals. Nature 328:348.[Medline]
  8. Riviere, Y., S. Tanneau, A. Regnault. 1989. Human immunodeficiency virus-specific cytotoxic responses of seropositive individuals: distinct types of effector cells mediate killing of targets expressing gag and env proteins. J. Virol. 63:2270.[Abstract/Free Full Text]
  9. Koup, R. A., J. T. Safrit, Y. Cao, A. Andrews, G. McCloud, W. Borkowsky, C. Farthing, D. D. Ho. 1994. Temporal association of cellular immune response with the initial control of viremia in primary HIV-1 syndrome. J. Virol. 68:4650.[Abstract/Free Full Text]
  10. Borrow, P., H. Lewicki, X. Wei, M. S. Horwitz, N. Peffer, H. Meyers, J. A. Nelson, J. E. Gairin, B. H. Hahn, M. B. A. Oldstone, G. M. Shaw. 1997. Antiviral pressure exerted by HIV-1-specific cytotoxic T-lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med. 3:205.[Medline]
  11. Borrow, P., H. Lewicki, B. H. Hahn, G. M. Shaw, M. B. Oldstone. 1994. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J. Virol. 68:6103.[Abstract/Free Full Text]
  12. Pantaleo, G., J. F. Demarest, T. Schacker, M. Vaccarezza, O. J. Cohen, M. Daucher, C. Graziosi, S. S. Schnittman, T. C. Quinn, G. M. Shaw, et al 1997. The qualitative nature of the primary immune response to HIV infection is a prognosticator of disease progression independent of the initial level of plasma viremia. Proc. Natl. Acad. Sci. USA 94:254.[Abstract/Free Full Text]
  13. Musey, L., J. Hughes, T. Schacker, T. Shea, C. Lawrence, M. J. McElrath. 1997. Cytotoxic-T-cell responses, viral load, and disease progression in early human immunodeficiency virus type 1 infection. N. Engl. J. Med. 337:1267.[Abstract/Free Full Text]
  14. Harrer, E., T. Harrer, S. Buchbinder, D. L. Mann, M. Feinberg, T. Yilma, R. P. Johnson, B. D. Walker. 1994. HIV-1-specific cytotoxic T lymphocyte response in healthy long-term nonprogressing seropositive persons. AIDS Res. Hum. Retroviruses 10:S77.
  15. Ferbas, J., A. H. Kaplan, M. A. Hausner, L. E. Hultin, J. L. Matud, Z. Liu, D. L. Panicali, H. Nerng-Ho, R. Detels, J. V. Giorgi. 1995. Virus burden in long-term survivors of human immunodeficiency virus (HIV) infection is a determinant of anti-HIV CD8+ lymphocyte activity. J. Infect. Dis. 172:329.[Medline]
  16. Harrer, T., E. Harrer, S. A. Kalams, T. Elbeik, M. Feinberg, Y. Cao, D. D. Ho, T. Yilma, A. M. Caliendo, R. P. Johnson, S. Buchbinder, B. D. Walker. 1996. Strong cytotoxic T cells and weak neutralizing antibody responses in a subset of persons with stable non-progressing HIV-1 infection. AIDS Res. Hum. Retroviruses 12:585.[Medline]
  17. Klein, M. R., C. A. van Baalen, A. M. Holwerda, S. R. Kerkhof Garde, R. J. Bende, I. P. M. Keet, J. K. M. Eeftinck-Schattenkerk, A. D. M. E. Osterhaus, H. Schuitemaker, F. Miedema. 1996. Kinetics of Gag-specific cytotoxic T-lymphocyte responses during the clinical course of HIV-1 infection: a longitudinal analysis of rapid progressors and long-term asymptomatics. J. Exp. Med. 181:1365.[Abstract/Free Full Text]
  18. Goulder, P. J. R., R. E. Phillips, R. A. Colbert, S. McAdam, G. Ogg, M. A. Nowak, P. Giangrande, G. Luzzi, B. Borgan, A. Edwards, A. J. McMichael, S. Rowland-Jones. 1997. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med. 3:212.[Medline]
  19. Rinaldo, C., X. L. Huang, Z. F. Fan, M. Ding, L. Beltz, A. Logar, D. Panicali, G. Mazzara, J. Liebmann, M. Cottril, et al 1995. High levels of anti-human immunodeficiency virus type 1 (HIV-1) memory cytotoxic T-lymphocyte activity and low viral load are associated with lack of disease in HIV-1-infected long-term nonprogressors. J. Virol. 69:5838.[Abstract]
  20. Rötschke, O., K. Falk, K. Deres, H. Schild, M. Norda, J. Metzger, G. Jung, H.-G. Rammensee. 1990. Isolation and analysis of naturally processed peptides as recognized by cytotoxic T cells. Nature 348:252.[Medline]
  21. Yang, O. O., B. D. Walker. 1997. CD8+ cells in human immunodeficiency virus type I pathogenesis: cytolytic and noncytolytic inhibition of viral replication. Adv. Immunol. 66:273.[Medline]
  22. Wei, X., S. K. Ghosh, M. E. Taylor, V. A. Johnson, E. A. Emini, P. Deutsch, J. D. Lifson, S. Bonhoeffer, M. A. Nowak, B. H. Hahn, M. S. Saag, G. M. Shaw. 1995. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373:117.[Medline]
  23. Dai, L., K. West, R. Littaaua, K. Takahashi, F. Ennis. 1992. Mutation of human immunodeficiency virus type 1 at amino acid 585 on gp41 results in loss of killing by CD8+ A24-restricted cytotoxic T lymphocytes. J. Virol. 66:3151.[Abstract/Free Full Text]
  24. Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards, A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. M. Bangham, C. R. Rizza, A. J. McMichael. 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354:453.[Medline]
  25. Koenig, S., A. J. Conley, Y. A. Brewah, G. M. Jones, S. Leath, L. J. Boots, V. Davey, G. Pantaleo, J. F. Demarest, C. Carter, C. Wannebo, J. R. Yannelli, S. A. Rosenberg, H. C. Lane. 1995. Transfer of HIV-1-specific cytotoxic T lymphocytes to an AIDS patient leads to selection for mutant HIV variants and subsequent disease progression. Nat. Med. 1:330.[Medline]
  26. Nowak, M., R. M. May, R. E. Phillips, S. Rowland-Jones, D. G. Lalloo, S. M. McAdam, P. Klenerman, B. Koeppe, K. Sigmund, C. R. M. Bangham, A. J. McMichael. 1995. Antigenic oscillations and shifting immunodominance in HIV-1 infections. Nature 375:606.[Medline]
  27. Kalams, S. A., R. A. Johnson, M. J. Dynan, K. E. Harmant, T. Harrer, E. Harrer, A. K. Troca, S. Buchbinder, B. D. Walker. 1996. T cell receptor (TCR) usage and fine specificity of HIV-1-specific cytotoxic T lymphocyte (CTL) clones: analysis of quasispecies recognition reveals a dominant response directed against a minor in vivo variant. J. Exp. Med. 183:1669.[Abstract/Free Full Text]
  28. Wilson, C. C., S. A. Kalams, B. M. Wilkes, D. J. Ruhl, F. Gao, B. H. Hahn, I. C. Hanson, K. Luzuriaga, S. Wolinsky, R. Koup, S. P. Buchbinder, R. P. Johnson, B. D. Walker. 1997. Overlapping epitopes in human immunodeficiency virus type 1 gp120 presented by HLA A, B, and C molecules: effects of viral variation on cytotoxic T-lymphocyte recognition. J. Virol. 71:1256.[Abstract]
  29. Harrer, T., E. Harrer, S. A. Kalams, P. Barbosa, A. Trocha, R. P. Johnson, T. Elbeik, M. Feinberg, S. Buchbinder, B. D. Walker. 1996. Cytotoxic T lymphocytes in asymptomatic long-term nonprogressing HIV-1 infection: breadth and specificity of the response and relation to in vivo viral quasispecies in a person with prolonged infection and low viral load. J. Immunol. 156:2616.[Abstract]
  30. Walker, B. D., C. Flexner, T. J. Paradis, T. C. Fuller, M. S. Hirsch, R. T. Schooley, B. Moss. 1988. HIV-1 reverse transcriptase is a target for cytotoxic T lymphocytes in infected individuals. Science 240:64.[Abstract/Free Full Text]
  31. De Campos-Lima, P. O., R. Gavioli, Q. J. Zhang, L. E. Wallace, R. Docetti, M. Rowe, A. B. Rickinson, M. G. Masucci. 1993. HLA-A11 epitope loss isolates of Epstein-Barr virus from a highly A11+ population. Science 260:99.
  32. Koup, R. A., J. L. Sullivan, P. H. Levine, F. Brewster, A. Mahr, G. Mazzara, S. McKenzie, D. Panicali. 1989. Antigenic specificity of antibody-dependent cell-mediated cytotoxicity directed against human immunodeficiency virus in antibody positive sera. J. Virol. 63:584.[Abstract/Free Full Text]
  33. Johnson, R. P., A. Trocha, L. Yang, G. P. Mazzara, D. L. Panicali, T. M. Buchanan, B. D. Walker. 1991. HIV-1 gag-specific cytotoxic T lymphocytes recognize multiple highly conserved epitopes: fine specificity of the gag-specific response defined by using unstimulated peripheral blood mononuclear cells and cloned effector cells. J. Immunol. 147:1512.[Abstract]
  34. Tsomides, T. J., B. D. Walker, H. N. Eisen. 1991. An optimal viral peptide recognized by CD8+ T cells binds very tightly to the restricting class I major histocompatibility complex protein on intact cells but not to the purified class I protein. Proc. Natl. Acad. Sci. USA 88:11276.[Abstract/Free Full Text]
  35. Wong, J., R. Colvin. 1987. Bi-specific monoclonal antibodies: selective binding and complement fixation to cells that express two different surface antigens. J. Immunol. 139:1369.[Abstract]
  36. Walker, B. D., C. Flexner, K. Birch-Limberger, L. Fisher, T. J. Paradis, A. Aldovini, R. Young, B. Moss, R. T. Schooley. 1989. Long-term culture and fine specificity of human cytotoxic T-lymphocyte clones reactive with human immunodeficiency virus type. Proc. Natl. Acad. Sci. USA 86:9514.[Abstract/Free Full Text]
  37. Hollinger, F. B., J. W. Bremer, L. E. Myers, J. W. Gold, L. McQuay. 1992. Standardization of sensitive human immunodeficiency virus coculture procedures and establishment of a multicenter quality assurance program for the AIDS Clinical Trials Group: The NIH/NIAID/DAIDS/ACTG Virology Laboratories. J. Clin. Microbiol. 30:1787.[Abstract/Free Full Text]
  38. Piatak, M. J., K. C. Luk, B. Williams, J. D. Lifson. 1993. Quantitative competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species. Biotechniques 14:70.[Medline]
  39. Wagner, R., T. Boltz, L. Deml, S. Modrow, H. Wolf. 1993. Induction of cytolytic T lymphocytes directed towards the V3 loop of the human immunodeficiency virus type 1 external glycoprotein gp120 by p55gag/V3chimeric vaccinia viruses. J. Gen. Virol. 74:1261.[Abstract/Free Full Text]
  40. Lubaki, N. M., S. C. Ray, B. Dhruva, T. C. Quinn, R. F. Siliciano, R. C. Bollinger. 1997. Characterization of a polyclonal cytolytic T lymphocyte response to human immunodeficiency virus in persons without clinical progression. J. Infect. Dis. 175:1360.[Medline]
  41. Wasik, T. J., P. P. Jagodzinski, E. M. Hyjek, J. Wustner, G. Trinchieri, H. W. Lischner, D. Kozbor. 1997. Diminished HIV-specific CTL activity is associated with lower type 1 and enhanced type 2 responses to HIV-specific peptides during perinatal HIV infection. J. Immunol. 158:6029.[Abstract]
  42. Wagner, R., H. Fliessbach, G. Wanner, M. Motz, M. Niedrig, G. Deby, A. Von Brundd, H. Wolf. 1992. Studies on processing, particle formation, and immunogenicity of the HIV-1 gag gene product: a possible component of a HIV vaccine. Arch. Virol. 127:117.[Medline]
  43. Buchbinder, S. P., M. H. Katz, N. A. Hessol, P. M. O’Malley, S. D. Holmberg. 1994. Long-term HIV-1 infection without immunologic progression. AIDS 8:1123.[Medline]
  44. Falk, K., O. Rotzschke, S. Stevanovic, G. Jung, H. Rammensee. 1991. Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature 351:290.[Medline]
  45. Tsomides, T. J., A. Aldovini, R. P. Johnson, B. D. Walker, R. A. Young, H. N. Eisen. 1994. Naturally processed viral peptides recognized by cytotoxic T lymphocytes on cells chronically infected by human immunodeficiency virus type 1. J. Exp. Med. 180:1283.[Abstract/Free Full Text]
  46. Ratner, L., W. Haseltine, R. Patarca, K. J. Livak, B. Starcich, S. F. Josephs, E. R. Doran, J. A. Rafalsky, E. A. Whitehorn, K. Baumeister, et al 1985. Complete nucleotide sequence of the AIDS virus HTLV-III. Nature 313:277.[Medline]
  47. Stevanovic, S., H.-G. Rammensee. 1994. Identification of T-cell epitopes using allele-specific ligand motifs. Behring Inst. Mitt. 95:7.
  48. Myers, G., J. A. Berzofsky, B. Kober, R. F. Smith, G. N. Paolakis. 1992. Human retroviruses and AIDS 1992: a compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Los Alamose National Laboratory, Los Alamos, NM.
  49. Freed, E. O., J. M. Orenstein, A. J. Buckler-White, M. A. Martin. 1994. Single amino acid changes in the human immunodeficiency virus type 1 matrix protein block virus particle production. J. Virol. 68:5311.[Abstract/Free Full Text]
  50. Goulder, P. J., A. K. Sewell, D. G. Lalloo, D. A. Price, J. A. Whelan, J. Evans, G. P. Taylor, G. Luzzi, P. Giangrande, R. E. Phillips, A. J. McMichael. 1997. Patterns of immunodominance in HIV-1-specific cytotoxic T lymphocyte responses in two human histocompatibility leukocyte antigens (HLA): identical siblings with HLA-A*0201 are influenced by epitope mutation. J. Exp. Med. 185:1423.[Abstract/Free Full Text]
  51. Madden, D. R., D. N. Garboczi, D. C. Wiley. 1993. The antigenic identity of peptide/MHC complexes: a comparison of the conformations of five viral peptides presented by HLA-A2. Cell 75:693.[Medline]
  52. Gavioli, R., M. G. Kurilla, P. O. Di Campos-Lima, L. E. Wallace, R. Dolcetti, R. Murray, A. B. Rickinson, M. G. Masucci. 1993. Multiple HLA A11-restricted cytotoxic T-lymphocyte epitopes of different immunogenicities in the Epstein-Barr virus-encoded nuclear antigen 4. J. Virol. 67:1572.[Abstract/Free Full Text]
  53. Matsumura, M., D. H. Fremont, P. A. Peterson, I. A. Wilson. 1992. Emerging principles for the recognition of peptide antigens by MHC class I molecules. Science 257:927.[Abstract/Free Full Text]
  54. Rotzschke, O., K. Falk, K. Deres. 1990. Isolation and analysis of naturally processed viral peptides as recognized by cytotoxic T cells. Nature 348:252.
  55. Ossendorp, F., M. Eggers, A. Neisig, T. Ruppert, M. Groettrup, A. Sijts, E. Mengede, P. M. Kloetzel, J. Neefjes, U. Koszinowski, C. Melief. 1996. A single residue exchange within a viral CTL epitope alters proteasome-mediated degradation resulting in lack of antigen presentation. Immunity 5:115.[Medline]
  56. Del Val, M., H. J. Schlicht, T. Ruppert, M. J. Reddehase, U. H. Koszinowski. 1991. Efficient processing of an antigenic sequence for presentation by MHC class I molecules depends on its neighboring residues in the protein. Cell 66:1145.[Medline]
  57. Zweerink, H. J., M. C. Gammon, U. Utz, S. Y. Sauma, T. Harrer, J. C. Hawkins, R. P. Johnson, A. Sirotina, J. D. Hermes, B. D. Walker, W. E. Biddison. 1993. Presentation of endogenous peptides to MHC class I-restricted cytotoxic T lymphocytes in transport deletion mutant T2 cells. J. Immunol. 150:1763.[Abstract]
  58. Bauer, M., M. Lucchiari-Hartz, R. Maier, G. Haas, B. Autran, K. Eichmann, R. Frank, B. Maier, A. Meyerhans. 1997. Structural constraints of HIV-1 Nef may curtail escape from HLA-B7-restricted CTL recognition. Immunol. Lett. 55:119.[Medline]
  59. Harrer, E., T. Harrer, P. Barbosa, M. Feinberg, D. Mann, T. Yilma, R. P. Johnson, B. D. Walker. 1996. Recognition of the highly conserved YMDD region in the HIV-1 reverse transcriptase by HLA A2 restricted CTL from an asymptomatic non-progressing individual. J. Infect. Dis. 173:476.[Medline]



This article has been cited by other articles:


Home page
 BloodHome page
V. Soumelis, I. Scott, F. Gheyas, D. Bouhour, G. Cozon, L. Cotte, L. Huang, J. A. Levy, and Y.-J. Liu
Depletion of circulating natural type 1 interferon-producing cells in HIV-infected AIDS patients
Blood, August 15, 2001; 98(4): 906 - 912.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
P. J.R. Goulder, M. A. Altfeld, E. S. Rosenberg, T. Nguyen, Y. Tang, R. L. Eldridge, M. M. Addo, S. He, J. S. Mukherjee, M. N. Phillips, et al.
Substantial Differences in Specificity of HIV-specific Cytotoxic T Cells in Acute and Chronic HIV Infection
J. Exp. Med., January 8, 2001; 193(2): 181 - 194.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harrer, T.
Right arrow Articles by Walker, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harrer, T.
Right arrow Articles by Walker, B. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS