HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yi, A.-K. Articles by Krieg, A. M. Search for Related Content PubMed PubMed Citation Articles by Yi, A.-K. Articles by Krieg, A. M.

Cutting Edge: Rapid Induction of Mitogen-Activated Protein Kinases by Immune Stimulatory CpG DNA¹

Ae-Kyung Yi^* and Arthur M. Krieg^2,*,

^* Department of Internal Medicine and Interdisciplinary Immunology Program, University of Iowa College of Medicine, Iowa City, IA 52242; and Department of Veterans Affairs and CpG ImmunoPharmaceuticals Inc., Iowa City, IA 52246

	Abstract

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 
Unmethylated CpG motifs in bacterial DNA or synthetic oligodeoxynucleotides (CpG DNA) rapidly activate B cells and monocyte-derived cells; however, the intracellular signaling pathways involved in this process are unclear. Here, we demonstrate that CpG DNA induces the activation of c-Jun NH₂-terminal kinase and p38 but does not activate the extracellular receptor kinase in murine B and monocyte-like cell lines. CpG DNA also induces the phosphorylation of activating transcription factor-2, c-Jun, and mitogen-activated protein kinase (MAPK)-activated protein kinase 2 as well as the activation of activator protein-1 (AP-1) DNA binding. Inhibition of p38 led to the suppression of CpG DNA-induced AP-1 DNA-binding activity and cytokine production, indicating that the p38 pathway is required for mediating these immune stimulatory effects of CpG DNA. Chloroquine, an endosomal acidification inhibitor, selectively abolished CpG DNA-mediated MAPK activation. Our results indicate that CpG DNA activates the p38 and c-Jun NH₂-terminal kinase MAPK and leads to the activation of AP-1 via a pathway which is sensitive to chloroquine.

	Introduction

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 
The genomic DNAs of bacteria and vertebrates differ in the frequency and methylation of CpG dinucleotides, which are relatively common in bacterial DNA (1/16 bases) but are underrepresented ("CpG suppression"; 1/50–1/60 bases) and methylated in vertebrate DNA (1). Bacterial DNA or synthetic oligodeoxynucleotides (ODNs)³ containing unmethylated CpG dinucleotides in particular base contexts (CpG motifs) induce B cell proliferation, IL-6 and Ig secretion, and apoptosis resistance (2, 3, 4, 5, 6, 7). Monocyte-derived cells are directly activated by CpG motifs to secrete the Th1-like cytokine IL-12 and type I IFNs, and NK cells respond with increased lytic activity and IFN- secretion, enhancing protective immune responses (8, 9, 10, 11, 12, 13, 14, 15, 16). Methylated bacterial DNA or ODNs in which the cytosines of CpG have been converted to 5-methyl-cytosine (the form present in vertebrate DNA) fail to induce immune activation (3). Thus, this simple structural difference in the frequency of CpG motifs between vertebrate and prokaryotic genomic DNAs appears to function as a "danger signal" to trigger innate immune defenses against infection and initiate a specific immune response (reviewed in 17 . Indeed, ODNs containing CpG motifs (CpG DNA) can be mixed with Ags to promote strong Th1-like immune responses (18, 19, 20, 21, 22, 23, 24).

Some of the stimulatory effects of CpG motifs may be mediated by the activation of NF-B (7, 11, 25, 26). However, the molecular mechanisms by which CpG DNA mediates leukocyte activation are not clearly understood at the present time. Mitogen-activated protein kinases (MAPKs) are important mediators of many cellular responses to stress and mitogenic signals. Therefore, we investigated whether CpG DNA-induced B cell or monocyte activation is associated with the activation of one or more members of the MAPK superfamily.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 
Oligodeoxynucleotides

Nuclease-resistant phosphorothioate ODNs (S-ODNs) were purchased from Hybridon Specialty Products (Milford, MA) and had no detectable endotoxins by Limulus assay. The sequences of the S-ODNs used are 5'TCCATGACGTTCCTGACGTT3' (CpG DNA: 1826) and 5'TCCAGGACTTTCCTCAGGTT3' (non-CpG DNA: 1911). For the sake of consistency, only the results using these two ODNs are shown herein. However, essentially the same results have been obtained in experiments with other CpG and control non-CpG DNA.

Culture conditions and reagents

A murine B lymphoma, WEHI-231 (clone 28), and a monocyte-like line, J774 (American Type Culture Collection, Manassas, VA), were cultured at 37°C in a 5% CO₂-humidified incubator and maintained in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% (v/v) heat-inactivated FCS (Sigma, St. Louis, MO), 1.5 mM L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin. Anti-IgM, LPS, PMA, and chloroquine, an endosomal acidification inhibitor, were purchased from Sigma. SB202190, a p38 kinase inhibitor, and PD98059, a MEK inhibitor, were purchased from Calbiochem (La Jolla, CA). Anti-murine CD40 Ab was purchased from PharMingen (San Diego, CA) and used at 2 µg/ml.

Preparation of whole cell lysates and nuclear extracts, Western blot analysis, and electrophoretic mobility shift assay (EMSA)

WEHI-231 cells or J774 cells (2 x 10⁶ cells/ml) were treated with medium, CpG or non-CpG DNA (2 µM), anti-IgM (10 µg/ml), LPS (1 µg/ml), or PMA (100 ng/ml). In some experiments, cells were pretreated with various inhibitors 2 h before the stimulation with DNA. Cells were harvested at the indicated timepoints, and then whole cell lysates or nuclear extracts were prepared as described previously (7, 26). To detect phosphorylated extracellular receptor kinase (ERK), c-Jun NH₂-terminal kinase (JNK), p38, activating transcription factor-2 (ATF-2), or c-Jun, equal amounts of whole cell lysates (50 µg/lane) were subjected to electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS (SDS-PAGE); next, Western blots were performed as described previously (7) using a specific Ab against the phosphorylated form of each protein. Specific Abs against the phosphorylated form of ERK, JNK, p38, ATF-2, or c-Jun were purchased from New England BioLabs (Beverly, MA). To detect the DNA-binding activity of the transcription factor activator protein-1 (AP-1), nuclear extracts (3 µg/lane) were analyzed by EMSA as described previously (26) using ³²P-labeled dsODNs containing the AP-1 (GATCTAGTGATGAGTCAGCCGGATC) binding sequence as a probe.

In vitro kinase assays

JNK and p38 in vitro kinase assays were performed as described previously (27), and the MAPK-activated protein (MAPKAP) kinase 2 in vitro kinase assay was completed using the MAPKAP kinase 2 assay kit (Upstate Biotechnology, Lake Placid, NY) according to the manufacturer’s protocol. Polyhistidine-tagged ATF-2 and Ab against p38 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The c-Jun-glutathione S-transferase (GST) fusion protein (1–79 aa) was a generous gift of Dr. Gary Koretzky (University of Iowa).

Cytokine ELISA

WEHI-231 cells (10⁶ cells/ml for IL-6 and 10⁷ cells/ml for TNF-) were treated with medium, CpG or non-CpG DNA (1 µM), anti-IgM (10 µg/ml), or PMA (100 ng/ml) plus ionomycin (1 µM) for 4 h (for TNF-) or 12 h (for IL-6) in the presence or absence of SB202190 (5 or 10 µM). Culture supernatants were analyzed by ELISA for TNF- or IL-6 as described previously (6).

	Results

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 
CpG DNA induces phosphorylation of JNK and p38 but not ERK

CpG DNA, but not control non-CpG DNA, induced the phosphorylation of several isoforms of JNK in both the murine B cell line WEHI-231 and the monocyte-like line J774 (Fig. 1). The JNK isoforms that were phosphorylated after CpG DNA stimulation were similar to those activated by anti-CD40 or LPS stimulation but somewhat different from those induced by anti-IgM or PMA (Fig. 1). The kinetics of induction of JNK phosphorylation by CpG DNA (within 15 min) were slightly slower compared with stimulation by anti-CD40 or LPS (within 3 min). CpG DNA also induced the phosphorylation of p38 in both WEHI-231 cells and J774 cells. However, CpG DNA failed to induce a substantial phosphorylation of ERK within 1 h in these cell lines. ERK phosphorylation in these cells was inducible, because it was markedly increased by treatment with anti-IgM (WEHI-231) or PMA (J774; Fig. 1).

View larger version (40K): [in this window] [in a new window]   FIGURE 1. CpG DNA induces phosphorylation of JNK and p38 but not ERK in murine B and monocyte-like cell lines. WEHI-231 cells (2 x 106/ml) were stimulated with medium, anti-IgM (10 µg/ml), anti-CD40 (2 µg/ml), CpG DNA (2 µM), or non-CpG DNA (2 µM) for various time periods. J774 cells (2 x 106/ml) were stimulated with medium, CpG DNA (2 µM), or non-CpG DNA (2 µM) for 30 min or with LPS (1 µg/ml) or PMA (100 ng/ml) for 10 min. Whole cell lysates (50 µg/lane) were analyzed by Western blot using specific Abs against the phosphorylated forms of ERK (pERK), JNK (pJNK), or p38 (p p38). The experiment was repeated more than five times with similar results.

To determine whether the phosphorylation of JNK and p38 was associated with an increase in their enzyme activity, in vitro kinase assays for JNK or p38 kinase were performed using c-Jun-GST (1–79 aa) or polyhistidine-tagged recombinant ATF-2, respectively, as substrates. These substrates showed a selective induction of JNK and p38 activities in the CpG DNA-treated cells within 15 min (Fig. 2, A and B).

View larger version (44K): [in this window] [in a new window]   FIGURE 2. CpG DNA activates enzyme activities of JNK and p38. WEHI-231 cells (107/ml) were stimulated with medium, anti-IgM (10 µg/ml), CpG DNA (2 µM), or non-CpG DNA (2 µM) for various time periods. Whole cell lysates were immunoprecipitated with agarose bead-bound c-Jun-GST fusion proteins (10 µg/sample) (A) or anti-p38 Abs (B). In vitro kinase assays were performed at 30°C for 30 min. Polyhistidine-tagged ATF-2 (rATF-2-polyhis) was used as a substrate for the p38 in vitro kinase assay (B). SI = stimulation index (numbers indicate the relative intensity of the band compared with that of medium control as 1). The experiment was repeated five times with similar results.

	CpG DNA induces phosphorylation of c-Jun and ATF-2 and induces MAPKAP kinase 2 enzyme activity

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

View larger version (25K): [in this window] [in a new window]   FIGURE 3. CpG DNA induces phosphorylation of ATF-2 and c-Jun and activates MAPKAP kinase 2 enzyme activity. A, CpG DNA induces phosphorylation of ATF-2 and c-Jun. WEHI-231 cells or J774 cells (2 x 106/ml) were stimulated with medium, anti-IgM (10 µg/ml), CpG DNA (2 µM), or non-CpG DNA (2 µM) for 15 min (for WEHI-231) or 30 min (for WEHI-231 and J774). Whole cell lysates (50 µg/lane) were analyzed by Western blot using a specific Ab against the phosphorylated forms of ATF-2 (pATF-2) and c-Jun (p-c-Jun). B, CpG DNA induces MAPKAP kinase 2 enzyme activity. J774 cells (5 x 106/5 ml) were pretreated with medium or SB202190 (10 µM) for 1 h and then stimulated with medium, CpG DNA (1 µM), or non-CpG DNA (nCpG: 1 µM) for 30 min. Whole cell lysates were immunoprecipitated with anti-MAPKAP kinase 2 Ab and an in vitro kinase assay was performed. The experiment was repeated more than three times with J774 or WEHI-231 cells.

Since c-Jun is a component of the transcription factor AP-1, we investigated whether CpG DNA can induce the DNA-binding activity of this transcription factor by EMSA using a double-stranded probe containing an AP-1 binding site. As demonstrated in Figure 4, CpG DNA induced the DNA-binding activity of AP-1 within 30 min in WEHI-231 and J774 cells (Fig. 4A). The CpG DNA-induced DNA-binding activity of AP-1 was suppressed by the p38 inhibitor SB202190, suggesting that the activation of p38 by CpG DNA may contribute to the activation of transcription factor AP-1 by CpG DNA (Fig. 4C). CpG DNA-mediated activation of AP-1 was not affected by PD98059, a specific MEK inhibitor (Fig. 4C). Of note, SB202190 showed no effects on CpG DNA-mediated NF-B activation in either J774 or WEHI-231 cells (data not shown).

View larger version (31K): [in this window] [in a new window]   FIGURE 4. CpG DNA induces DNA-binding activity of transcription factor AP-1. A, CpG DNA activates AP-1 in WEHI-231 cells. B, CpG DNA induces the DNA-binding activity of AP-1 through a chloroquine-sensitive pathway. C, p38 inhibitor blocks CpG DNA-mediated AP-1 activation. WEHI-231 cells (A) (2 x 106/ml) were stimulated with medium, CpG DNA (2 µM), or non-CpG DNA (2 µM) for 30 min. J774 cells (B and C) (2 x 106/ml) were pretreated with medium, chloroquine (5 µg/ml) (B), PD98059 (100 µM) (C), or SB202190 (10 µM) (C) for 1 h. Cells were stimulated with medium, Escherichia coli DNA (bDNA: 5 µg/ml), LPS (100 ng/ml for B and 1 µg/ml for C), CpG DNA (1 µM for B and 2 µM for C), or non-CpG DNA (2 µM) for 1 h (C) or 2 h (B). Equal amounts (3 µg/lane) of nuclear extracts were analyzed by EMSA for the DNA-binding activities of transcription factor AP-1 using 32P-labeled oligonucleotides containing the AP-1 binding sequence as a probe. The band specificity was confirmed by cross-competition with unlabeled specific and nonspecific oligonucleotides (data not shown). The experiments were repeated three times with similar results using extracts from two B cell lines (WEHI-231 and CH12.LX) and two monocyte-like cell lines (J774 and Raw264.7).

To investigate whether CpG DNA-mediated p38 activation led to the production of cytokines, WEHI-231 cells were stimulated with CpG DNA or anti-IgM in the presence or absence of p38 inhibitor SB202190 (Table I). The addition of SB202190 markedly suppressed CpG DNA-mediated TNF- and IL-6 production in WEHI-231 cells. SB202190 had less of an effect on anti-IgM- or PMA and ionomycin-induced cytokine production (Table I). These results indicate that CpG DNA-mediated p38 activation contributes to the activation of AP-1 and leads to the production of cytokines such as IL-6 and TNF-.

	CpG DNA-mediated JNK and p38 activation is dependent upon a chloroquine-sensitive step

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

	Discussion

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 
The discovery that the immune system "recognizes" bacterial DNA by its content of unmethylated CpG motifs (3) led to the question of how the recognition of CpG DNA activates B cell and macrophage responses. CpG DNA does not appear to activate cells through a cell surface receptor, but does require cell uptake, through which DNA is internalized into an acidified intracellular compartment (3, 28). It has become evident that one mechanism that transduces the CpG DNA signal into the nucleus of cells exposed to bacterial DNA is the degradation of IB and the activation of NF-B, as discussed previously (7, 26). The activation of NF-B in CpG DNA-treated cells is preceded by and may be dependent upon the generation of reactive oxygen species (7) and also appears to be dependent upon the acidification of the DNA, since inhibitors of endosomal acidification specifically block the activation of NF-B by CpG DNA, but not by LPS, anti-CD40, or anti-IgM (7).

Some of the genes whose expression is induced by CpG DNA do not have known NF-B binding sites in their promoters, which suggested to us the possibility that additional intracellular signaling pathways may also be induced in CpG DNA-triggered cells. We now report that two of the MAPK pathways, p38 and JNK, are rapidly activated in both B cells and macrophage-like cells following treatment with CpG DNA. Our results suggest that the activation of these kinases may lead to the phosphorylation and activation of the transcription factor AP-1, which may participate in the induction of new gene transcription in CpG DNA-treated cells. We hypothesize that the signals from these different pathways are integrated in the nucleus, where the pathways converge. Inhibition of NF-B leads to the suppression of cytokine production as well as B cell growth and apoptosis protection mediated by CpG DNA (7, 26). Interestingly, the inhibition of p38 by its specific inhibitor SB202190 led to the inhibition of CpG DNA-mediated cytokine production (Table I). Thus, activation of both NF-B and AP-1 is required for CpG DNA-mediated cytokine production, but other immune effects of CpG DNA may require only one of these pathways. The present results demonstrate that CpG DNA-mediated MAPK activation is also dependent upon a chloroquine-sensitive step, which might be endosomal acidification. Since chloroquine specifically blocks all of the CpG DNA-induced signaling events identified to date (7, 29), we hypothesize that it blocks a very early step in the signaling pathway triggered by CpG DNA, after which the signal may diverge into the NF-B and MAPK pathways. Further studies are underway to evaluate these possibilities.

Note added in proof. Since the submission of this manuscript, we have learned that similar results have been obtained by another group (30).

View larger version (53K): [in this window] [in a new window]   FIGURE 5. Endosomal acidification is required for CpG DNA-mediated MAPK activation. WEHI-231 cells (2 x 106/ml) were pretreated with medium or chloroquine (2.5 µg/ml) for 2 h and then stimulated with medium, CpG DNA (1 µM), non-CpG DNA (1 µM), or anti-CD40 (2 µg/ml) for 30 min. Whole cell lysates (50 µg/lane) were analyzed by Western blot using a specific Ab against the phosphorylated forms of JNK (pJNK) or ATF-2 (pATF-2). Similar results were observed for CpG DNA-mediated p38 activation and c-Jun phosphorylation in both WEHI-231 and J774 cells (data not shown). The experiment was repeated more than three times with similar results.

	Acknowledgments

	Footnotes

 
¹ A.-K.Y. was supported by a fellowship from the Arthritis Foundation and by a grant from the Lupus Foundation of America. A.M.K. was supported by grants from the Department of Veterans Affairs and by National Institutes of Health Grant P01-CA66570. Services were provided by the University of Iowa Diabetes and Endocrine Research Center (National Institutes of Health Grant DK25295).

² Address correspondence and reprint requests to Dr. Arthur M. Krieg, Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA 52242. E-mail address:

³ Abbreviations used in this paper: ODN, oligodeoxynucleotide; MAPK, mitogen-activated protein kinase; EMSA, electrophoretic mobility shift assay; ERK, extracellular receptor kinase; MEK, MAPK/ERK kinase; JNK, c-Jun NH₂-terminal kinase; ATF, activating transcription factor; AP-1, activator protein-1; MAPKAP, MAPK-activated protein; GST, glutathione S-transferase.

Received for publication July 7, 1998. Accepted for publication August 28, 1998.

	References

Top Abstract Introduction Materials and Methods Results CpG DNA induces phosphorylation... CpG DNA-mediated JNK and... Discussion References

 

1. Bird, A. P.. 1987. CpG islands as gene markers in the vertebrate nucleus. Trends Genet. 3:342.
2. Messina, J. P., G. S. Gilkeson, D. S. Pisetsky. 1991. Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J. Immunol. 147:1759.[Abstract]
3. Krieg, A. K., A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. Koretzky, D. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
4. Klinman, D., A.-K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12, and IFN. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
5. Yi, A.-K., P. Hornbeck, D. E. Lafrenz, A. M. Krieg. 1996. CpG DNA rescue of murine B lymphoma cells from anti-IgM-induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-XL. J. Immunol. 157:4918.[Abstract]
6. Yi, A.-K., D. M. Klinman, T. L. Martin, S. Matson, A. M. Krieg. 1996. Rapid immune activation by CpG motifs in bacterial DNA: systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
7. Yi, A.-K., R. Tuetken, T. Redford, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activates B cells and monocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
8. Tokunaga, T., S. Yamamoto, K. Namba. 1988. A synthetic single-stranded DNA, poly(dG,dC) induces interferon-/ß and -, augments natural killer activity, and suppresses tumor growth. Jpn. J. Cancer Res. 79:682.[Medline]
9. Yamamoto, S., E. Kuramoto, S. Shimada, T. Tokunaga. 1988. In vitro augmentation of natural killer cell activity and production of interferon-/ß and - with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 79:866.[Medline]
10. Yi, A.-K., J. H. Chace, J. S. Cowdery, A. M. Krieg. 1996. IFN- promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
11. Stacey, K. J., M. J. Sweet, D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
12. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
13. Cowdery, J. S., J. H. Chace, A.-K. Yi, A. M. Krieg. 1996. Bacterial DNA induces NK cells to produce IFN- in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
14. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M.-D. Nguyen, G. J. Silverman, M. Lotz, D. A. Carson, E. Raz. 1996. Immuno-stimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
15. Halpern, M. D., D. S. Pisetsky. 1995. In vitro inhibition of murine IFN- production by phosphorothioate deoxyguanosine oligomers. Immunopharmacology 29:47.[Medline]
16. Chace, J. H., N. A. Hooker, K. L. Mildenstein, A. M. Krieg, J. S. Cowdery. 1997. Bacterial DNA-induced NK cell IFN- production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
17. Krieg, A. M., A.-K. Yi, J. Schorr, H. L. Davis. 1998. The role of CpG dinucleotides in DNA vaccines. Trends Microbiol. 6:23.[Medline]
18. Roman, M., E. Martin-Orozco, J. S. Goodman, M.-D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849.[Medline]
19. Davis, H. L., R. Weeranta, T. J. Waldschmidt, L. Tygrett, J. Schorr, A. M. Krieg. 1998. CpG DNA is a potent adjuvant in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870.[Abstract/Free Full Text]
20. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on Th1 immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
21. Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, K. Heeg. 1997. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol. 27:2340.[Medline]
22. Weiner, G. J., H.-M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
23. Moldoveanu, Z., L. Love-Homan, W. Q. Huang, A. M. Krieg. 1998. CpG DNA, a novel adjuvant for systemic and mucosal immunization with influenza virus. Vaccine 16:1216.[Medline]
24. Sun, S., H. Kishimoto, J. Sprent. 1998. DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen. J. Exp. Med. 187:1145.[Abstract/Free Full Text]
25. Sparwasser, T., T. Miethe, G. Lipford, A. Erdmann, H. Hacker, K. Heeg, H. Wagner. 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor--mediated shock. Eur. J. Immunol. 27:1671.[Medline]
26. Yi, A.-K., A. M. Krieg. 1998. CpG DNA rescue from anti-IgM induced WEHI-231 B lymphoma apoptosis via modulation of IB and IBß and sustained activation of nuclear factor-B/c-Rel. J. Immunol. 160:1240.[Abstract/Free Full Text]
27. Sutherland, C. L., A. W. Heath, S. L. Pelech, P. R. Young, M. R. Gold. 1996. Differential activation of the ERK, JNK, and p38 mitogen-activated protein kinases by CD40 and the B cell antigen receptor. J. Immunol. 157:3381.[Abstract]
28. Tonkinson, J. L., C. A. Stein. 1994. Patterns of intracellular compartmentalization, trafficking, and acidification of 5'-fluorescein-labeled phosphodiester and phosphorothioate oligodeoxynucleotides in HL60 cells. Nucleic Acids Res. 22:4268.[Abstract/Free Full Text]
29. Macfarlane, D. E., L. Manzel. 1998. Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds. J. Immunol. 160:1122.[Abstract/Free Full Text]
30. Häcker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T., Sparwasser, K. Heeg, G. B. Lipford, and H. Wagner. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. 1998. EMBO J. In press.

This article has been cited by other articles:

				D. Yu, M. R. Putta, L. Bhagat, M. Dai, D. Wang, A. F. Trombino, T. Sullivan, E. R. Kandimalla, and S. Agrawal Impact of Secondary Structure of Toll-Like Receptor 9 Agonists on Interferon Alpha Induction Antimicrob. Agents Chemother., December 1, 2008; 52(12): 4320 - 4325. [Abstract] [Full Text] [PDF]

				Y.-I. Kim, J.-E. Park, A. Martinez-Hernandez, and A.-K. Yi CpG DNA Prevents Liver Injury and Shock-mediated Death by Modulating Expression of Interleukin-1 Receptor-associated Kinases J. Biol. Chem., May 30, 2008; 283(22): 15258 - 15270. [Abstract] [Full Text] [PDF]

				A. Iparraguirre, J. W. Tobias, S. E. Hensley, K. S. Masek, L. L. Cavanagh, M. Rendl, C. A. Hunter, H. C. Ertl, Ulrich. H. von Andrian, and W. Weninger Two distinct activation states of plasmacytoid dendritic cells induced by influenza virus and CpG 1826 oligonucleotide J. Leukoc. Biol., March 1, 2008; 83(3): 610 - 620. [Abstract] [Full Text] [PDF]

				R. B. Anderson, G. J. Cianciolo, M. N. Kennedy, and S. V. Pizzo {alpha}2-Macroglobulin binds CpG oligodeoxynucleotides and enhances their immunostimulatory properties by a receptor-dependent mechanism J. Leukoc. Biol., February 1, 2008; 83(2): 381 - 392. [Abstract] [Full Text] [PDF]

				J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes J. Immunol., July 1, 2007; 179(1): 45 - 52. [Abstract] [Full Text] [PDF]

				D. Zipris, E. Lien, A. Nair, J. X. Xie, D. L. Greiner, J. P. Mordes, and A. A. Rossini TLR9-Signaling Pathways Are Involved in Kilham Rat Virus-Induced Autoimmune Diabetes in the Biobreeding Diabetes-Resistant Rat J. Immunol., January 15, 2007; 178(2): 693 - 701. [Abstract] [Full Text] [PDF]

				R. Lang, M. Hammer, and J. Mages DUSP Meet Immunology: Dual Specificity MAPK Phosphatases in Control of the Inflammatory Response J. Immunol., December 1, 2006; 177(11): 7497 - 7504. [Abstract] [Full Text] [PDF]

				T. H. Harris, N. M. Cooney, J. M. Mansfield, and D. M. Paulnock Signal transduction, gene transcription, and cytokine production triggered in macrophages by exposure to trypanosome DNA. Infect. Immun., August 1, 2006; 74(8): 4530 - 4537. [Abstract] [Full Text] [PDF]

				M. K. Mohammad, M. Morran, B. Slotterbeck, D. W. Leaman, Y. Sun, H. v. Grafenstein, S.-C. Hong, and M. F. McInerney Dysregulated Toll-like receptor expression and signaling in bone marrow-derived macrophages at the onset of diabetes in the non-obese diabetic mouse Int. Immunol., July 1, 2006; 18(7): 1101 - 1113. [Abstract] [Full Text] [PDF]

				A.-K. Yi, H. Yoon, J.-E. Park, B.-S. Kim, H. J. Kim, and A. Martinez-Hernandez CpG DNA-mediated Induction of Acute Liver Injury in D-Galactosamine-sensitized Mice: THE MITOCHONDRIAL APOPTOTIC PATHWAY-DEPENDENT DEATH OF HEPATOCYTES J. Biol. Chem., May 26, 2006; 281(21): 15001 - 15012. [Abstract] [Full Text] [PDF]

				M. A. Delgado, J. F. Poschet, and V. Deretic Nonclassical Pathway of Pseudomonas aeruginosa DNA-Induced Interleukin-8 Secretion in Cystic Fibrosis Airway Epithelial Cells. Infect. Immun., May 1, 2006; 74(5): 2975 - 2984. [Abstract] [Full Text] [PDF]

				D. Wang, S. A. John, J. L. Clements, D. H. Percy, K. P. Barton, and L. A. Garrett-Sinha Ets-1 deficiency leads to altered B cell differentiation, hyperresponsiveness to TLR9 and autoimmune disease Int. Immunol., September 1, 2005; 17(9): 1179 - 1191. [Abstract] [Full Text] [PDF]

				J. Wang, R. Alvarez, G. Roderiquez, E. Guan, Q. Caldwell, J. Wang, M. Phelan, and M. A. Norcross CpG-Independent Synergistic Induction of {beta}-Chemokines and a Dendritic Cell Phenotype by Orthophosphorothioate Oligodeoxynucleotides and Granulocyte-Macrophage Colony-Stimulating Factor in Elutriated Human Primary Monocytes J. Immunol., May 15, 2005; 174(10): 6113 - 6121. [Abstract] [Full Text] [PDF]

				E. R. Kandimalla, L. Bhagat, Y. Li, D. Yu, D. Wang, Y.-P. Cong, S. S. Song, J. X. Tang, T. Sullivan, and S. Agrawal Immunomodulatory oligonucleotides containing a cytosine-phosphate-2'-deoxy-7-deazaguanosine motif as potent Toll-like receptor 9 agonists PNAS, May 10, 2005; 102(19): 6925 - 6930. [Abstract] [Full Text] [PDF]

				S. L. McCoy, S. E. Kurtz, C. J. MacArthur, D. R. Trune, and S. H. Hefeneider Identification of a Peptide Derived from Vaccinia Virus A52R Protein That Inhibits Cytokine Secretion in Response to TLR-Dependent Signaling and Reduces In Vivo Bacterial-Induced Inflammation J. Immunol., March 1, 2005; 174(5): 3006 - 3014. [Abstract] [Full Text] [PDF]

				X. Zhong, C. Bai, W. Gao, T. B. Strom, and T. L. Rothstein Suppression of expression and function of negative immune regulator PD-1 by certain pattern recognition and cytokine receptor signals associated with immune system danger Int. Immunol., August 1, 2004; 16(8): 1181 - 1188. [Abstract] [Full Text] [PDF]

				S. L. McCoy, S. E. Kurtz, F. A. Hausman, D. R. Trune, R. M. Bennett, and S. H. Hefeneider Activation of RAW264.7 Macrophages by Bacterial DNA and Lipopolysaccharide Increases Cell Surface DNA Binding and Internalization J. Biol. Chem., April 23, 2004; 279(17): 17217 - 17223. [Abstract] [Full Text] [PDF]

				A. A. Cecil and M. J. Klemsz p38 activation through Toll-like receptors modulates IFN-{gamma}-induced expression of the Tap-1 gene only in macrophages J. Leukoc. Biol., March 1, 2004; 75(3): 560 - 568. [Abstract] [Full Text] [PDF]

				E. R. Kandimalla, L. Bhagat, F.-G. Zhu, D. Yu, Y.-P. Cong, D. Wang, J. X. Tang, J.-Y. Tang, C. F. Knetter, E. Lien, et al. A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif PNAS, November 25, 2003; 100(24): 14303 - 14308. [Abstract] [Full Text] [PDF]

				S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF]

				H. Xu, H. An, Y. Yu, M. Zhang, R. Qi, and X. Cao Ras Participates in CpG Oligodeoxynucleotide Signaling through Association with Toll-like Receptor 9 and Promotion of Interleukin-1 Receptor-associated Kinase/Tumor Necrosis Factor Receptor-associated Factor 6 Complex Formation in Macrophages J. Biol. Chem., September 19, 2003; 278(38): 36334 - 36340. [Abstract] [Full Text] [PDF]

				N. B. Ray and A. M. Krieg Oral Pretreatment of Mice with CpG DNA Reduces Susceptibility to Oral or Intraperitoneal Challenge with Virulent Listeria monocytogenes Infect. Immun., August 1, 2003; 71(8): 4398 - 4404. [Abstract] [Full Text] [PDF]

				S.-J. Yeo, D. Gravis, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: ROLE OF NF-{kappa}B AND p38 J. Biol. Chem., June 13, 2003; 278(25): 22563 - 22573. [Abstract] [Full Text] [PDF]

				W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF]

				E. R. Kandimalla, L. Bhagat, D. Wang, D. Yu, F.-G. Zhu, J. Tang, H. Wang, P. Huang, R. Zhang, and S. Agrawal Divergent synthetic nucleotide motif recognition pattern: design and development of potent immunomodulatory oligodeoxyribonucleotide agents with distinct cytokine induction profiles Nucleic Acids Res., May 1, 2003; 31(9): 2393 - 2400. [Abstract] [Full Text] [PDF]

				A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF]

				S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression J. Immunol., January 15, 2003; 170(2): 1052 - 1061. [Abstract] [Full Text] [PDF]

				J. J. Gao, V. Diesl, T. Wittmann, D. C. Morrison, J. L. Ryan, S. N. Vogel, and M. T. Follettie Regulation of gene expression in mouse macrophages stimulated with bacterial CpG-DNA and lipopolysaccharide J. Leukoc. Biol., December 1, 2002; 72(6): 1234 - 1245. [Abstract] [Full Text] [PDF]

				B. K. Choudhury, J. S. Wild, R. Alam, D. M. Klinman, I. Boldogh, N. Dharajiya, W. J. Mileski, and S. Sur In Vivo Role of p38 Mitogen-Activated Protein Kinase in Mediating the Anti-inflammatory Effects of CpG Oligodeoxynucleotide in Murine Asthma J. Immunol., November 15, 2002; 169(10): 5955 - 5961. [Abstract] [Full Text] [PDF]

				P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF]

				M. Gursel, D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide J. Leukoc. Biol., May 1, 2002; 71(5): 813 - 820. [Abstract] [Full Text] [PDF]

				V. Hornung, S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann Quantitative Expression of Toll-Like Receptor 1-10 mRNA in Cellular Subsets of Human Peripheral Blood Mononuclear Cells and Sensitivity to CpG Oligodeoxynucleotides J. Immunol., May 1, 2002; 168(9): 4531 - 4537. [Abstract] [Full Text] [PDF]

				A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF]

				F.-G. Zhu, C. F. Reich, and D. S. Pisetsky Inhibition of murine macrophage nitric oxide production by synthetic oligonucleotides J. Leukoc. Biol., April 1, 2002; 71(4): 686 - 694. [Abstract] [Full Text] [PDF]

				Y. Park, S. W. Lee, and Y. C. Sung Cutting Edge: CpG DNA Inhibits Dendritic Cell Apoptosis by Up-Regulating Cellular Inhibitor of Apoptosis Proteins Through the Phosphatidylinositide-3'-OH Kinase Pathway J. Immunol., January 1, 2002; 168(1): 5 - 8. [Abstract] [Full Text] [PDF]

				M. J. Sweet, C. C. Campbell, D. P. Sester, D. Xu, R. C. McDonald, K. J. Stacey, D. A. Hume, and F. Y. Liew Colony-Stimulating Factor-1 Suppresses Responses to CpG DNA and Expression of Toll-Like Receptor 9 but Enhances Responses to Lipopolysaccharide in Murine Macrophages J. Immunol., January 1, 2002; 168(1): 392 - 399. [Abstract] [Full Text] [PDF]

				A.-K. Yi, J.-G. Yoon, S.-C. Hong, T. W. Redford, and A. M. Krieg Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-{alpha} production through activation of NF-{kappa}B Int. Immunol., November 1, 2001; 13(11): 1391 - 1404. [Abstract] [Full Text] [PDF]

				K. H. Baek, S. J. Ha, and Y. C. Sung A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages J. Immunol., September 1, 2001; 167(5): 2847 - 2854. [Abstract] [Full Text] [PDF]

				Y. Chen, J. Zhang, S. A. Moore, Z. K. Ballas, J. P. Portanova, A. M. Krieg, and D. J. Berg CpG DNA induces cyclooxygenase-2 expression and prostaglandin production Int. Immunol., August 1, 2001; 13(8): 1013 - 1020. [Abstract] [Full Text] [PDF]

				A. H. Dalpke, S. Opper, S. Zimmermann, and K. Heeg Suppressors of Cytokine Signaling (SOCS)-1 and SOCS-3 Are Induced by CpG-DNA and Modulate Cytokine Responses in APCs J. Immunol., June 15, 2001; 166(12): 7082 - 7089. [Abstract] [Full Text] [PDF]

				M.-J. Shi, S.-R. Park, P.-H. Kim, and J. Stavnezer Roles of Ets proteins, NF-{{kappa}}B and nocodazole in regulating induction of transcription of mouse germline Ig {{alpha}} RNA by transforming growth factor-{beta}1 Int. Immunol., June 1, 2001; 13(6): 733 - 746. [Abstract] [Full Text] [PDF]

				J. J. Gao, Q. Xue, C. J. Papasian, and D. C. Morrison Bacterial DNA and Lipopolysaccharide Induce Synergistic Production of TNF-{{alpha}} Through a Post-Transcriptional Mechanism J. Immunol., June 1, 2001; 166(11): 6855 - 6860. [Abstract] [Full Text] [PDF]

				F. Meyer, K. T. Wilson, and S. P. James Modulation of Innate Cytokine Responses by Products of Helicobacter pylori Infect. Immun., November 1, 2000; 68(11): 6265 - 6272. [Abstract] [Full Text] [PDF]

				D. Miyazaki, G. Liu, L. Clark, and S. J. Ono Prevention of Acute Allergic Conjunctivitis and Late-Phase Inflammation with Immunostimulatory DNA Sequences Invest. Ophthalmol. Vis. Sci., November 1, 2000; 41(12): 3850 - 3855. [Abstract] [Full Text]

				L. Jin, D. P. Raymond, T. D. Crabtree, S. J. Pelletier, C. W. Houlgrave, T. L. Pruett, and R. G. Sawyer Enhanced Murine Macrophage TNF Receptor Shedding by Cytosine-Guanine Sequences in Oligodeoxynucleotides J. Immunol., November 1, 2000; 165(9): 5153 - 5160. [Abstract] [Full Text] [PDF]

				G. J. Weiner The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides J. Leukoc. Biol., October 1, 2000; 68(4): 455 - 463. [Abstract] [Full Text]

				S. FUJIEDA, S. IHO, Y. KIMURA, H. YAMAMOTO, H. IGAWA, and H. SAITO Synthetic Oligodeoxynucleotides Inhibit IgE Induction in Human Lymphocytes Am. J. Respir. Crit. Care Med., July 1, 2000; 162(1): 232 - 239. [Abstract] [Full Text]

				R. M. Vabulas, H. Pircher, G. B. Lipford, H. Hacker, and H. Wagner CpG-DNA Activates In Vivo T Cell Epitope Presenting Dendritic Cells to Trigger Protective Antiviral Cytotoxic T Cell Responses J. Immunol., March 1, 2000; 164(5): 2372 - 2378. [Abstract] [Full Text] [PDF]

				G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al. Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo J. Immunol., February 1, 2000; 164(3): 1617 - 1624. [Abstract] [Full Text] [PDF]

				T. Decker, F. Schneller, T. Sparwasser, T. Tretter, G. B. Lipford, H. Wagner, and C. Peschel Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells Blood, February 1, 2000; 95(3): 999 - 1006. [Abstract] [Full Text] [PDF]

				G. Hartmann and A. M. Krieg Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells J. Immunol., January 15, 2000; 164(2): 944 - 953. [Abstract] [Full Text] [PDF]

				D. P. Sester, S. J. Beasley, M. J. Sweet, L. F. Fowles, S. L. Cronau, K. J. Stacey, and D. A. Hume Bacterial/CpG DNA Down-Modulates Colony Stimulating Factor-1 Receptor Surface Expression on Murine Bone Marrow-Derived Macrophages with Concomitant Growth Arrest and Factor-Independent Survival J. Immunol., December 15, 1999; 163(12): 6541 - 6550. [Abstract] [Full Text] [PDF]

				L. Manzel, L. Strekowski, F. M. D. Ismail, J. C. Smith, and D. E. Macfarlane Antagonism of Immunostimulatory CpG-Oligodeoxynucleotides by 4-Aminoquinolines and Other Weak Bases: Mechanistic Studies J. Pharmacol. Exp. Ther., December 1, 1999; 291(3): 1337 - 1347. [Abstract] [Full Text]

				A.-K. Yi, D. W. Peckham, R. F. Ashman, and A. M. Krieg CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway Int. Immunol., December 1, 1999; 11(12): 2015 - 2024. [Abstract] [Full Text] [PDF]

				J. J. Gao, E. G. Zuvanich, Q. Xue, D. L. Horn, R. Silverstein, and D. C. Morrison Cutting Edge: Bacterial DNA and LPS Act in Synergy in Inducing Nitric Oxide Production in RAW 264.7 Macrophages J. Immunol., October 15, 1999; 163(8): 4095 - 4099. [Abstract] [Full Text] [PDF]

				G. Hartmann, G. J. Weiner, and A. M. Krieg CpG DNA: A potent signal for growth, activation, and maturation of human dendritic cells PNAS, August 3, 1999; 96(16): 9305 - 9310. [Abstract] [Full Text] [PDF]

				J. Kovarik, P. Bozzotti, L. Love-Homan, M. Pihlgren, H. L. Davis, P.-H. Lambert, A. M. Krieg, and C.-A. Siegrist CpG Oligodeoxynucleotides Can Circumvent the Th2 Polarization of Neonatal Responses to Vaccines But May Fail to Fully Redirect Th2 Responses Established by Neonatal Priming J. Immunol., February 1, 1999; 162(3): 1611 - 1617. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yi, A.-K. Articles by Krieg, A. M. Search for Related Content PubMed PubMed Citation Articles by Yi, A.-K. Articles by Krieg, A. M.