|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








*
Department of Transfusion Medicine, Clinical Center,
Surgery Branch, and
Laboratory of Pathology, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although the clinical response remains the ultimate therapeutic goal, it is a parameter of little value for the identification of the reason for the most common therapeutic failures. Evaluation of systemic CTL reactivity is generally equated to the level of immune competence toward a certain epitope, and as a consequence is used for the assessment of the effects of a vaccination protocol (10). Assessment of competence toward an immunogen, while yielding an accurate view of the systemic immune response to a vaccine, may not provide sufficient information regarding target/host interactions at the site in which they are likely to occur. In fact, clinical response, including complete responses, has been reported in the context of MAGE-3 peptide vaccination without stimulation of detectable CTL activity at the systemic level (Thierry Boon, personal communication).
The development of peptide-based vaccination protocols for the immunotherapy of melanoma has given us the unique opportunity of comparing systemic T cell responses to a vaccine with localization and status of activation of the same T cells in the target organ.
We therefore wanted to establish a strategy suited for the analysis of CTL response to vaccination at the tumor site. Utilizing functional assays and TCR ß-chain analysis, we studied the immune response of a melanoma patient after four cycles of vaccination with g209-2M peptide, a single residue variant of gp100209217 identified as one of the immunodominant HLA-A*0201-restricted CTL epitopes of gp100 (3, 8, 11). An in-depth analysis of T cell reactivity was undertaken in the peripheral circulation and at the tumor site, which revealed a functional dissociation between local and systemic immune response during anti-melanoma vaccination.
| Materials and Methods |
|---|
|
|
|---|
The melanoma cell lines 624.38 (HLA-A*0201/0301, B*1402/-, Cw*0702/0802) and 624.28 (HLA-A*0301/-, B*1402/-, Cw*0702/0802) were generated by limiting dilution from a metastatic lesion (12). The cell lines 888-MEL (HLA-A*01/2402, B*52/55, Cw*0102/1201) and 1102-MEL (HLA-A*0201/24, B*55/62, Cw*03/-) were derived from other metastatic melanoma lesions. SK23 MEL (HLA-A*0101/0201, B*0702/0801, Cw*0702/0702) and A375 MEL (HLA-A*01/0201, B*17/-, Cw*06/-) melanoma cell lines were purchased from American Type Culture Collection (ATCC, Rockville, MD). All cell lines were maintained in complete medium (CM) consisting of RPMI 1640 (Biofluids, Rockville, MD) supplemented with 10 mM HEPES buffer, 100 U/ml penicillin-streptomycin (Biofluids), 10 µg/ml Ciprofloxacin (Bayer, West Haven, CT), 0.03% L-glutamine (Biofluids), 0.5 mg/ml amphotericin B (Biofluids), and 10% heat-inactivated human AB serum (Gemini Bioproducts, Calabasas, CA). T2 (ATCC), a cell line defective of endogenous processing and expressing HLA-A*0201 (13), was used to test CTL specificity toward HLA-A*0201-restricted epitopes. 1520 TIL was expanded with IL-2 from a metastatic lesion of an HLA-A*0201 melanoma patient not previously exposed to vaccination. 1520 TIL naturally recognizes g209.
Peptides
All peptides were produced by solid-phase synthesis technique. The same gp100209217 (g209) (ITDQVPFSV; Chiron Mimotopes Peptide Systems, San Diego, CA), gp100209217(2M) (g209-2M) (IMDQVPFSV; Chiron Mimotopes), and MART-12735 (AAGIGILTV; Peptide Technologies, Gaithersburg, MD) produced for clinical use were used for the in vitro sensitization assays. The residue 2 (T to M) substitution in g209-2M enhances binding to HLA-A*0201, efficiency of T cell induction in vitro (11), and was, for these reasons, preferred to the wild type for vaccination.
HLA typing
HLA class I and II were determined on PBL or tumor cell lines using sequence-specific primer PCR (14). PCR was also used for molecular subtyping of HLA-A2 (15). When necessary, the identity of some HLA alleles was determined conclusively by sequencing of cDNA.
FACS analysis and immunocytochemistry
Cell surface expression of HLA and other surface Ags (CD8, CD4) was determined by flow cytometry. Intracellular staining for the detection of MAA was performed by fixing cells in 200 µl of acetone for 10 min at room temperature before staining with the primary Ab (16). The following mAbs were used: W6/32 (Sera Labs, Westbury, NY) specific for a monomorphic determinant of the HLA class I heavy chain (17); IVA-12 (ATCC) for HLA class II; KS-I (18) for HLA-A2, (FITC) anti-human CD8, and (FITC) anti-human CD4 (PharMingen, San Diego, CA); and anti-MART-1/Melan-A murine IgG2b (M2-7C10) (16, 19) and anti-Pmel17/gp100 mAbHMB45 (Enzo Diagnostics, Farmingdale, NY). Cytospin preparations of sequentially obtained FNA material were fixed in acetone and stained with the same mAbs used for the FACS analysis, with the exception of HMB45 (Biogenex, San Ramon, CA). For secondary staining, biotinylated goat anti-mouse IgG (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was used, followed by avidin-biotin-peroxidase (Vectasin Elite Kit; Vector Laboratories, Burlingame, CA) (16).
Preparation of dendritic cells (DC) and in vitro CTL cultures
Autologous DC utilized for in vitro sensitization of CD8+ T cells were prepared as previously described (20). PBMC were separated from blood by centrifugation on a Ficoll-Hypaque gradient, incubated for 3 h at 37°C, and, after removal of nonadherent cells, cultured for 5 days in CM with 1000 IU/ml IL-4 (PeproTech, Rocky Hill, NJ) and 1000 IU/ml GM-CSF (PeproTech). On day 5, detached DC were harvested and used for stimulation either by peptide pulsing (1 µg/ml g209/DC or g209-2M/DC) or by infection with recombinant vaccinia virus (rVV-MART/DC) (Therion Biologics, Cambridge, MA). CD8+ cells were isolated from PBMC by positive separation (Dynabeads; Dynal, Lake Success, NY). A total of 4 x 106 CD8+ cells/well was cultured in a 24-well plate with 1 x 106 DC. After 24 h and every 2 days thereafter, 300 IU/ml IL-2 was added to the cultures. After 7 days, the cultures were restimulated with rVV-MART-1/DC, g209/DC, or g209-2M/DC and maintained in IL-2 for another week. On days 7 and 14, the cultures were tested for Ag recognition.
Cloning of CTL by limiting dilution
After the second testing for MAA recognition (day 14 of culture), CTL cultures were plated at 100, 10, and 1 cell/well ratio in 96-well round-bottom plates with 5 x 104 irradiated (50 Gy) donor PBMC and 1 x 104 irradiated (100 Gy) EBV-B cells in 200 µl CM supplemented with 30 ng/ml OKT3. After 1 day and every 2 to 3 days thereafter, 300 IU/ml IL-2 was added for 14 to 21 days. Clones were then tested for MAA reactivity. MAA-specific clones were restimulated and expanded in T25 flasks (Costar, Cambridge, MA) with 2.5 x 107 donor PBMC and 5 x 106 1088-EBV-B cells in 25 ml CM with 30 ng/ml OKT3 and IL-2. After in vitro expansion, the cultures were retested for specificity and analyzed for clonality by TCR ß PCR, directed heteroduplex analysis (DHDA), and sequencing.
In vitro expansion of TIL and autologous tumor from FNA
Using a 23-gauge needle, cells were aspirated from a metastatic lesion of patient F001 and plated immediately in CM. For TIL expansion, total cells were counted and plated in 24-well plates (of 4 x 106 cells/well) in the presence of 6000 IU/ml IL-2. After 2 wk, the cultures were further expanded in T25 flasks. For expansion of tumor cells, culture conditions were identical to TIL cultures, with the exception of IL-2. The F001TU autologous cell lines were totally HLA class I and II matched to the phenotype of patient F001 and had electron microscopy and karyotyping characteristics consistent with malignant melanoma.
Assessment of Ag recognition by CTL and TIL
IFN-
release assay.
A total of 1 x 105 effector cells was plated with
5 x 104 stimulator cells in 96-well round-bottom
plates in 200 µl CM. After 24-h incubation at 37°C, the plates were
centrifuged and the supernatant was harvested for analysis by ELISA
(Endogen, Cambridge, MA). IFN-
is reported as pg/ml IFN-
secreted
by 5 x 104 effector cells in 24 h.
Calcein-AM fluorescent cytotoxicity assay. A total of 106 target cells/well was incubated with 15 µl Calcein-AM (Molecular Probes, Eugene, OR) for fluorescent labeling. After 30 min, all targets were washed three times in CM and plated in triplicate in 96-well flat-bottom plates at 3000 target cells/100 µl. Effector cells were harvested and added to the target cells at E:T ratios of 10:1, 2.5:1, and 0.625:1 in 100 µl CM. The plates were centrifuged at 500 rpm for 3 min. After 3 h at 37°C, 5 µl of FluoroQuench (One Lambda, Canoga Park, CA) was added to each well to extinguish background fluorescence. The plates were centrifuged, incubated for an additional 60 min, and then scanned on a FluorImager 595 (Molecular Dynamics, Sunnyvale, CA). Fluorescence was quantified using ImageQuant software (Molecular Dynamics). Lysis was calculated using the following formula: (1 - [experimental fluorescence - background fluorescence]/[target only fluorescence - background fluorescence]) x 100.
RNA isolation and cDNA synthesis
For RNA isolation, cells were either taken directly from culture or, if frozen, after overnight culture to allow recovering of physiologic cell metabolism. RNeasy mini or midi kit (Qiagen, Santa Clarita, CA) was used for all RNA isolations. The RNA was eluted with water and stored at -70°C. For cDNA synthesis, about 1 µg of total RNA was transcribed with the SuperScript preamplification system (Life Technologies, Gaithersburg, MD) using the oligo(dT) primer. cDNA was eluted and stored at -25°C.
TCR Vß PCR and clone-specific PCR
A set of 35 primers was selected to amplify 45 functional Vß. Each primer mix was composed of 10 x PCR buffer, 1.5 mM MgCl2, 200 µM dNTP, 1.25 U AmpliTaq Gold, 0.5 µl cDNA, 0.5 µM Vß primer, 0.5 µM TC-1 constant region primer (AYACCAGTGTGGCCTTTT), and water up to 20 µl final reaction volume. A total of 10 µl of light mineral oil covered the reaction mixture, and PCR was run using the following protocol: initial activation of the enzyme at 94°C for 9 min; 10 high-stringency cycles of 94°C for 30-s denaturation, 65°C for 1-min annealing, and 72°C for 1-min elongation; 20 low-stringency cycles of 94°C for 30 s, 60°C for 1 min, and 72°C for 1 min; and final extension at 72°C for 10 min. The following 35 primers were used for the Vß region: TV2 CGAGTTTCTGGTTTCCTTTT for Vß22s1; TV3-1 ATTTCTGAAGATAATGTTTAGC for Vß9s1; TV4-1 GAAAGCTAAGAAGCCACCG for Vß7s1; TV4-2/3 TACAAGCAAAGTGCTAAGAAGC for Vß7s2, 7s3; TV5-1 GCCTTCAGTTCCTCTTTGA for Vß5s1; TV5-4/5/6 GGCCCCAGTTTATCTTTC for Vß5s2, 5s3, 5s6; TV5-8 TCCAGTTCCTCCTTTGGTATG for Vß5s4; TV6-1 TGGGACTGAGGCTGATTT for Vß13s3; TV6-2/3/5 GGCTGAGGCTGATTCATTAC for Vß13s1, 13s2; TV6-4 GGCTAAGGCTCATCCATTAT for Vß13s5; TV6-6 GGCTGAAGCTGATTTATTAT for Vß13s6; TV7-2/3 GAGTTTTTAATTTACTTCCAAGGCA for Vß6s1, 6s5; TV7-6/7/9 CCCAGAGTTTCTGACTTACTTC for Vß6s3, 6s4, 6s6; TV7-8 GGCCAGAGTTTCTGACTTATT for Vß6s2; TV9 CCTCCAGTTCCTCATTCAG for Vß1s1; TV10-1/3 GGCTGAGGCTGATCCATTAC for Vß12s1, 12s2; TV10-2 CATGGGCTGAGGCTGATCTA for Vß12s3; TV11-1 GAGCTTCTGGTTCAATTTCA for Vß21s1; TV11-2 CCAAAGCTTCTGATTCAGTT for Vß21s3; TV11-3 GAGCTTCTGATTCGATATGAGA for Vß21s2; TV12-3/4 GGACTGGAGTTGCTCATTT for Vß8s1, 8s2; TV12-5 CAGACAGACCATGATGCAA for Vß8s3; TV13 CCCAGTTCCTCATTTCGTT for Vß23s1; TV14 TCGACGTGTTATGGGAAA for Vß16s1; TV15 CAAAGCTGCTGTTCCACTACTA for Vß24s1; TV16 GGTCCTGAAAAACGAGTTCAAG for Vß25s1; TV18 GGTCTGAAATTCATGGTTTATCT for Vß18s1; TV19 GACAGGACCCAGGGCAAG for Vß17s1; TV20-1 ATGCTGATGGCAACTTCCA for Vß2s1; TV24-1 CCTACGGTTGATCTATTACTCCTT for Vß15s1; TV25-1 CTACACCTCATCCACTATTCCTA for Vß11s1; TV27 GGGCTTAAGGCAGATCTACT for Vß14s1; TV28 GGGCTACGGCTGATCTATTTC for Vß3s1; TV29-1 CACTGATCGCAACTGCAA for Vß4s1; and TV30 CCTCCAGCTGCTCTTCTA for Vß20s1.
After PCR, 6 µl of the product and 3 µl of bromphenol blue-loading buffer were mixed and run on a 1% agarose gel for 45 min at 150 V. The gel was stained with Vistra Green (Amersham Life Science, Arlington Heights, IL) 1/10,000 dilution in 1x TBE for 50 min and analyzed on a FluorImager 595.
Directed heteroduplex analysis (DHDA)
Vß-specific DHDA was established by a modification of a previously described technique (21). From a donor CD8+ cell pool, a TCR with Vß6s2 was amplified using TV7-8 and TC-1. The PCR product was cloned into pCR2.1 plasmid (TA-cloning kit; Invitrogen, San Diego, CA) and sequenced to ensure the correct Vß. From this reference sequence and from C1-35, probes were generated using 6-carboxyfluorescein-labeled TC-1 primer. PCR was performed to obtain the fragments of the samples and the probes for DHDA. To chelate the Mg, 0.2 x vol of 25 mM EDTA was added to the probe. The heteroduplex generation was done with 2 µl of the sample PCR product and 2 µl of the probe by denaturating at 96°C for 5 min, then cooling rapidly to 50°C, and renaturating at this temperature for 45 min. The samples were mixed with 2 µl of loading buffer/Prism Genescan-500 TAMRA size marker (ABI Perkin-Elmer, Foster City, CA) and loaded on a native gel (4% bis-acrylamide:acrylamide 1:19). The gel was run in an ABI Sequencer 377 at 50°C for 2 h. The result was analyzed using the GeneScan software (ABI Perkin-Elmer).
Sequencing of the TCR ß-chain
The TCR ß-chain of C1-35 was amplified with TC-1 and TV7-8 using Pfu polymerase, and the product was cloned into the TA vector. Sequences from both directions were obtained from five bacterial clones using the ABI PRISM Dye Primer kit and the ABI PRISM 377 DNA Sequencer. The sequences were analyzed with the ABI software, Sequence Analysis and Sequence Navigator. The Vß6s2 PCR products of the other 16 cultures that were analyzed for clonal identity were sequenced directly from PCR products using ABI PRISM Dye Terminator kit. The sequences of the H.3-1 and F001TIL-9 were also obtained directly from PCR products using TV12-3/4 and TV4-2/3, respectively.
Direct PCR and nested PCR with clone-specific CDR3 primers
Clone-specific TCR ß-chain primers were derived from the
sequence of the CDR3 region of C1-35 (C35-2 CAT CGCCCCGCTCCCCCCAG) and
F001TIL-9 (T9-2 AAGAACTGCTCATTGTAGTAAGTA). The direct PCR used the
primers TV7-8 and C35-2 for the amplification of the C1-35 TCR ß, and
TV4-2/3 and T9-2 for the amplification of F001TIL-9 TCR ß. The
reaction mixture was composed of 10x PCR buffer, 1.5 mM MgCl2, 200
µM dNTP, 1.25 U AmpliTaq Gold, 0.5 µl cDNA, 1 µl each primer (10
µM), and water up to 20 µl. A total of 10 µl of light mineral oil
covered the reaction mixtures, and PCR was run as described for TCR ß
PCR. A total of 6 µl of the PCR product and 3 µl of bromphenol
blue-loading buffer were mixed and run on a 1% agarose gel for
45 min at 150 V. The gel was stained and analyzed as described for TCR
ß PCR. To control for the relative amount of T cells, a C
control
was run with the primers TAC-F1 (ATATCCAGAACCCTGACCTGC) and TCA-R1
(GCTTTTCTCGACCAGCTTGACATC). For the nested PCR, an amplification
using the external primer RTV7-2 (ATCACACAGGRGCTGGAGT) for C1-35 and
RTV4-2 (ATGGAAACGGGAGTTACG) for F001TIL-9 was performed before the
clone-specific amplification. After the first amplification, the PCR
product was diluted 1/5 with water, and from the dilution 1 µl used
for the second amplification. The second amplification was done as
described above for the direct PCR.
| Results |
|---|
|
|
|---|
A single lesion from a patient with metastatic melanoma (F001) undergoing vaccination with g209-2M peptide was followed. The protocol was approved by Institutional Review Board of National Cancer Institute. The patients HLA class I phenotype determined by sequencing was A*0201/0301, B*0702/0801, Cw*0701/0702. After two vaccinations with g209-2M in combination with IL-12, an initial reduction of the tumor mass was observed on physical examination and radiographic evaluation. PBMC were collected before and after vaccination. Within 1 mo, the tumor mass became unresponsive to further treatment and progressed in size. At this point, a FNA of the mass was performed for analysis of tumor cells and TIL.
In vitro reactivity to g209 and g209-2M is observed only in postvaccination CTL cultures
Cultures of CD8+ cells from pre- and postvaccination
PBMC were generated using autologous DC either infected with rVV-MAA or
loaded with 1 µg/ml g209 or g209-2M. When tested for MAA recognition
after 2 wk in culture, no reactivity to g209 or g209-2M could be
detected in prevaccination cultures, whereas postvaccination cultures
demonstrated a strong sensitization against the natural as well as the
modified gp100 epitope (Fig. 1
). Although
the patient had not been exposed to exogenous administration of MART-1,
MART-1 reactivity could be equally observed in pre- and postvaccination
cultures. This is not uncommon, as naturally occurring MART-1-specific
reactivity can be readily detected in the peripheral circulation of
HLA-A*0201-expressing melanoma patients (4).
|
CTL clones were raised by limiting dilution from postvaccination
CTL cultures induced in vitro. Cloning efficiency was about 100, 30,
and 10% for the 100, 10, and 1 cell/well plates, respectively.
Proliferating wells were tested for recognition of g209/g209-2M. From
all g209/g209-2M-reactive 10 and 1 cell/well cultures, 25 clones were
randomly selected for further expansion. After 2 wk of expansion, 18 of
25 cultures induced with g209-2M-pulsed DC maintained their specific
reactivity. To assess the clonality of these 18 cultures, TCR ß PCR
was performed for a general overview: 17 of the 18 cultures showed a
common strong band in Vß6s2 (Fig. 2
A). Among these, all 12
cultures expanded from the 10 cell/well plates demonstrated additional
weaker bands specific for other Vß families, whereas no other bands
were observed in the five cultures from 1 cell/well plates, suggesting
the purity of these clones.
To
determine whether the Vß6s2 bands represented the same TCR or
originated from a different TCR utilizing the same Vß, DHDA was
performed with the Vß6s2 PCR products from the 17 samples (Fig. 2
B). When an irrelevant TCR ß with Vß6s2 from a healthy
donor was utilized as probe, all 17 samples showed a single
heteroduplex band that migrated with identical delay relative to the
homoduplex band. This indicated that the samples contained only one TCR
and that the mismatches between the sample TCR ß and the probe were
similar, if not identical, among the clones. To validate the identity
of these clones, one of the sample TCR ß was labeled and used as
probe against all other samples. With this probe, only a homoduplex was
detected in all samples. These data strongly suggested identity of TCR
ß among the clones. The identity of the 17 TCR ß-chains was
verified additionally by sequencing each of them (Fig. 3
). Thus, a predominant
g209/g209-2M-specific clone expanded by the g209-2M vaccine was
identified. For functional studies, one clone (C1-35) was selected as
representative of the g209/g209-2M-reactive CTL population. The 18th
clone (C10-80) included in the TCR ß PCR analysis showed only a faint
Vß6s2 band and two strong bands in other Vß.
|
|
C1-35 was able to lyse HLA-A*0201, gp100-expressing melanoma cell
lines, including 624.38 MEL matched at three alleles
(HLAA*0201/0301, -B*1402, -Cw*0702/0802), 526 MEL
and 1102 MEL matched only at HLA-A*0201, but could not lyse the totally
mismatched 888 MEL. Furthermore, the HLA-A*0201-expressing,
gp100-negative F001TU-3 autologous cell line was insensitive to
lysis by C1-35 (Fig. 4
A). Upon
stimulation with other HLA-A*0201-matched melanoma cell lines, C1-35
was noted to secrete IFN-
only in response to some targets
characterized by high expression of HLA-A*0201 and gp100 (Fig. 4
B). As the ability of C1-35 to release IFN-
when
stimulated with HLA-A*0201-matched tumor lines could be dependent upon
the avidity of TCR/epitope interactions (22), epitope density
requirements for IFN-
release were compared between C1-35 and a
clone (H.3-1) from 1520 TIL. This TIL was derived from a metastatic
lesion of a different patient not previously exposed to
epitope-specific vaccination, and is characterized by high avidity
interactions with gp100/HLA-A*0201-expressing melanoma cells. Loading
T2 cells with decremental g209 or g209-2M doses, the epitope density
needed to activate IFN-
release by the two clones was compared.
Although both were sensitive to stimulation, a 50- and a 100-fold lower
concentration of g209 and g209-2M, respectively, were found to
stimulate comparable amounts of IFN-
release by H.3-1 compared with
C1-35 (Fig. 4
C). Apparently, the g209-2M vaccination had
induced and expanded in vivo a CTL clone with an avidity for its target
that was lower than the one observed in a naturally occurring
g209-specific TIL clone. As a consequence, C1-35 could recognize some,
although not all, gp100-expressing, HLA-A*0201-matched melanoma cell
lines recognized by H.3-1.
|
Progressive tumor growth could have been due to lack of CTL localization at the tumor site, despite the presence of g209-specific CTL in the peripheral blood. To examine molecularly and functionally whether C1-35 was detectable at the time of progression, we performed a FNA of the growing metastasis at the moment of clinical progression. From the FNA material, expansion of TIL (IL-2, 6000 IU/ml added to CM) and autologous tumor was attempted. Twenty separate TIL cultures (F001TIL-1 to -20) and two tumor cell lines (F001TU-3 and -4) were generated.
TCR ß-chain repertoire in PBMC, immune CTL, and TIL
To characterize the TCR repertoire in the PBMC, CTL cultures, and
TIL, TCR ß PCR with 35 Vß-specific primers for 45 functional Vß
was performed (Fig. 5
). CD8+
T cells from pre- and postvaccination PBMC showed a broad usage of Vß
with bands in 23 of 35 reactions. Postvaccination g209 CTL cultures
showed little variation compared with the PBMC with losses of bands in
Vß8s3 (lane 7), Vß13s3 (lane
29), Vß13s5 (lane 30), and Vß1s1
(lane 35), and relatively denser bands in Vß21s3
(lane 4), Vß15s1 (lane 16), and
Vß6s3/6s4/6s6 (lane 33). Postvaccination g209-2M
CTL cultures presented a denser band corresponding to the Vß6s2
(lane 34) chain utilized by the majority of the CTL
clones expanded from the bulk culture, suggesting that C1-35 TCR
expansion was not an artifact related to the cloning conditions. C1-35,
representative of all other related clones, showed a dominant band
corresponding to Vß6s2 (lane 34). Faint bands for
Vß13s1/13s2 (lane 9), Vß17s1 (lane
14), Vß14s1 (lane 18), and Vß3s1
(lane 19) were not detected with ethidium bromide
staining, but only with the more sensitive Vistra Green staining, and
were regarded as trace contamination. C10-80, the only clone of 18 that
did not present a dominant Vß6s2 (only a weak band in
lane 34), was found to have predominantly Vß8s1/8s2
(lane 6) and Vß22s1 (lane 15).
The FNA, which represents the local TCR ß repertoire of the lesion,
displayed bands for Vß13s1/13s2 (lane 9),
Vß17s1 (lane 14), Vß14s1 (lane
18), Vß4s1 (lane 20), Vß7s1
(lane 24), Vß7s2/7s3 (lane 25),
and Vß6s2 (lane 34). Due to low amount of RNA from
the FNA material, the intensity of the bands was much weaker, and
it cannot be ruled out that other Vßs were missed for technical
reasons. When F001TIL-9 was tested, it appeared to be almost pure, with
only a faint band for Vß6s2 (lane 34), besides the
dominant band for Vß7s2/7s3 (lane 25). Taken
together, the monitoring of the TCR ß repertoire of different
original and in vitro culture samples allowed a general overview of the
changes and clonality status. For example, based on TCR ß PCR alone,
cultures such as C10-80 could be identified as not clonal. This method,
however, could not provide any information about the composition of a
band, nor could it tell whether the same clone was responsible for
corresponding bands in different samples. For the former limitation,
DHDA and sequencing were applied as described above, and for the
latter, clone-specific PCR analysis was performed.
|
To assess the presence of clone C1-35 TCR in the different
samples, clone-specific PCR was performed using a primer for the CDR3
region of the C1-35 TCR ß-chain. The direct PCR clearly detected the
clone in the g209-2M bulk culture from which the clone was derived. In
addition, weak bands were visible in the postvaccination PBL,
g209/g209-2M cultures, FNA, and F001TIL (Fig. 6
). To corroborate this result, a nested
PCR consisting of a Vß-specific first amplification and a
clone-specific second amplification was performed. The results of the
nested PCR confirmed the bands in the postvaccination samples, while
all prevaccination samples remained negative. By clone-specific
analysis, F001TIL-9 could be detected only in TIL cultures, but not in
the FNA from which it was expanded. This sensitivity limitation could
not be overcome even by nested PCR (Fig. 6
). Several unsuccessful
attempts to tailor the PCR conditions to this specific reaction
suggested that F001TIL-9 was present in minor proportion in vivo,
although was readily sensitive to the proliferative stimulus provided
in vitro by high dose IL-2. A panel of C region
-chain (C-
)
amplifications was run along with the direct amplification to make
semiquantitative assessments of the PCR results. Considering the low
signal intensity for the C-
and the stronger signal for clone C1-35
TCR ß-chain in FNA compared with the postvaccination CD8+
PBL preparations, the technically inevitable contamination of the FNA
with peripheral blood is unlikely to solely account for the C1-35 TCR
ß signal detected in the FNA. These data suggested that lack of
localization of C1-35 at tumor site could not explain the regained
tumor growth.
|
From the FNA material, two autologous tumor cell lines (F001TU-3
and F001TU-4) and 20 separate TIL cultures were generated. The TIL
cultures were >95% CD8+ and were tested for recognition
of g209 and HLA-matched tumors (Fig. 7
).
Surprisingly, none of the 20 TIL cultures recognized T2 targets pulsed
with either g209 or g209-2M. TIL were also unable to recognize other
known HLA-A*0201-associated MAA epitopes, including
MART-12735 (2, 3, 23, 24, 25). However, 12 of 20 cultures
could recognize autologous as well as other HLA-B*0702- and
HLA-Cw*0702-matched melanoma targets, but not the autologous EBV-B nor
other matched nonmelanoma cells. To exclude the possibility of a
transplantation Ag reaction, HLA typing of TIL was performed and found
to be identical to the patients (A*0201/0301, B*0702/0801,
Cw*0701/0702). Attempts to expand TIL populations from the FNA with
OKT-3 and feeder cells (as used for cloning of CTL) also failed to
generate g209/g209-2M-reactive TIL (data not shown). Thus, C1-35 and
F001TIL-9 demonstrated a functional dissociation in epitope specificity
between reagents obtained from the peripheral circulation and those
obtained from the tumor (Fig. 4
B).
|
As noted in Figure 4
B, C1-35, 1520 TIL,
and its high avidity clone H.3-1 failed to recognize F001TU-3. These
findings suggested loss of either HLA-A*0201 or gp100 expression by the
autologous tumor. FACS analysis of F001TU-3 and -4 demonstrated loss of
gp100 expression and retention of expression of HLA-A*0201 (Fig. 8
A). Sequencing of F001TU-3
cDNA ruled out mutations of the HLA-A*0201 heavy chain. Because of the
possibility that F001TU-3 and -4 had originated from rare cells in the
FNA material not representative of the tumor, cytospin preparations
from the original FNA were analyzed by immunocytochemistry and compared
with FNA material obtained from the same lesion at various time points.
This analysis confirmed a marked decrease in gp100-expressing cells
postvaccination (Fig. 8
B), while the expression of
HLA-A*0201 remained unchanged. Indeed, while gp100 was detectable in
>75% of tumor cells in the prevaccination FNA, less than 5% of cells
expressed gp100 postvaccination (Table I
). MART-1 expression was not affected by
the vaccination, although analysis of F001TU-3 and -4 revealed
decreased expression of this MAA. Expression of HLA-A*0201 was similar
in all FNA analyzed. Although C1-35 and H.3-1 could not naturally
recognize F001TU-3 and -4 (Fig. 4
, A and B),
exogenous loading of peptide on F001TU and other HLA-A*0201 melanomas
not recognized by C1-35 could stimulate IFN-
release (Fig. 9
). These
data suggest that the poor recognition of autologous tumor by C1-35 and
H.3-1 was due to inadequate epitope density on the cell surface rather
than abnormalities of the HLA-A2 heavy chain or killer inhibitory
receptor-HLA interactions (26).
Thus, tumor escape from peptide
vaccination was associated with severely decreased expression of target
Ag by the tumor, which led to proliferation of a cell population not
recognizable not only by the intermediate avidity CTL elicited by the
vaccination, but also by high affinity CTL effectors.
|
|
|
| Discussion |
|---|
|
|
|---|
To overcome the limitations posed by excisional biopsy, we suggest following metastases by serial FNA, which allows the evaluation of tumors at various points (16). By following the same lesion serially, heterogeneity among tumors can be avoided as a confounding factor. The ability to expand TIL and autologous tumor from the FNA permits the analysis of CTL localization and function at tumor site. This strategy was tested on a melanoma patient with a metastasis of particular interest: the mass had shrunk after vaccination with g209-2M, suggesting effectiveness of treatment. However, after the initial shrinkage, the lesion became insensitive to further g209-2M vaccines.
The identification of g209/g209-2M-reactive CTL from postvaccination PBMC, in concordance with the lack of C1-35 detection by PCR in prevaccination samples, was an indication of successful systemic induction and expansion of vaccine-specific CTL. The presence of g209-reactive CTL at that time point suggested that tumor progression was not the result of functional deletion of tumor-specific CTL by the vaccine, as suggested by some murine models (31). The predominance of a single clone after vaccination was of interest and contrasted with the capacity observed in naturally occurring CTL, recognizing immunodominant epitopes such as MART-12735 (32) or EBNA4416424 (33) to maintain a broad TCR repertoire. In fact, we observed, in a second melanoma patient not previously exposed to MAA-specific vaccination, a widely polyclonal, MART-12735-specific CTL population characterized by broad Vß usage.
Several explanations are plausible for the predominance of C1-35, including an artifact of in vitro culture (34), a consequence of the vaccination procedure, or a direct effect of the high affinity interactions between g209-2M and HLA-A*0201 (11). In a functional peptide dilution assay, C1-35 demonstrated a lower avidity for its target than the naturally occurring H.3-6 TIL. Alexander-Miller et al. proposed that high dose peptide stimulation could inhibit high avidity CTL while maximally stimulating low avidity CTL (35). Since g209-2M is characterized by high affinity for HLA-A*0201 (11), it is possible that the epitope density reached in vivo as a result of dose and route of administration led to extinction of high avidity CTL in this patient and stimulated the expansion of a low avidity clone, C1-35. This finding, if confirmed, will have important implications for the administration of vaccines, and studies of the avidity of the predominant CTL after vaccination could become necessary to find optimal dose ranges for peptide-based vaccines. It could be postulated that the vaccination led to the in vivo loss of highly reactive g209-specific CTL, and such loss could explain the progression of tumor after initial response. Furthermore, the repeated in vitro sensitizations with g209-2M could have skewed the original proportion of g209-specific CTL present in postvaccination PBMC. One cannot rule out that we may have missed other g209-specific CTL, possibly with higher avidity. To minimize this bias, we reduced the time in bulk culture to 14 days before cloning. Direct cloning from peripheral blood would be the preferred method with minimal in vitro bias. However, multiple attempts to directly clone PBMC resulted in poor efficiency and lack of generation of reactive CTL.
Although C1-35 demonstrated lower avidity for its target compared with
a naturally occurring TIL, it could kill with high efficiency all
HLA-A*0201-matched, gp100-expressing melanoma targets and could release
IFN-
in response to stimulation with several melanoma cell lines
characterized by combined high expression of HLA-A2 and gp100. Gervois
et al. have shown that the epitope density requirements necessary to
stimulate target cell kill by CTL are 10- to 10,000-fold less than that
required for induction of IL-2 and IFN-
release by the same CTL
(22). Tumor cells that could be efficiently lysed by MAA-specific CTL
could not stimulate IFN-
and/or IL-2 release unless exogenously
supplemented with the appropriate peptide. In this study, we confirm
this finding and we postulate that C1-35 could have been responsible
for the initial response of the metastasis by killing melanoma cells,
while the stimulatory requirements for its expansion and activation
were provided by the systemic administration of g209-2M in IFA. At the
time of tumor progression, although vaccine-induced stimulation was
ongoing, most tumor cells became resistant to lysis by losing
expression of target Ag. Comparison of FNA material obtained before and
after vaccination revealed that the tumor had drastically decreased the
fraction of cells expressing the gp100 over time. We hypothesize that
this loss was due to specific killing of gp100-positive cells by CTL
expanded by the vaccine, including C1-35. C1-35 appeared to still be
present in the tumor mass at the time of progression (perhaps in
response to few remaining gp100-expressing tumor cells or the effects
of the still ongoing vaccination). However, its presence correlated
with an inactive status, as none of 20 TIL bulk cultures expanded from
the postvaccination FNA reacted to g209/g209-2M. This might indicate a
dormant state of C1-35 in the tumor secondary to the decreased
expression of gp100. The detection of TIL that recognize tumor cells,
but not g209-2M or g209, suggests that gp100 loss by the tumor was
counteracted, at that time point, by induction of CTL with another
specificity, and underscores the dynamic and interactive nature of the
immune response at the tumor site.
In this study, several observations could be made that would have escaped detection by monitoring the systemic immune response alone. First, CTL activated by the vaccine, although capable of recognizing and killing other gp100-expressing melanomas, were unable to recognize autologous tumor from a progressing metastatic lesion. The finding could be best explained by lost (or severely decreased) expression of the target MAA at that point in time. Second, despite the lack of target Ag by the tumor, C1-35 was found to localize at tumor site by molecular methods. The presence at tumor site, however, was associated with a dormant state, as this CTL could not be expanded by general proliferative stimuli consisting of IL-2 or OKT-3. Third, a new TIL emerged that could recognize an unidentified MAA in association with a restriction element unrelated to the vaccination (HLA-Cw*0702). Furthermore, the use of FNA allowed for serial sampling of the same metastasis without interference with its clinical course throughout treatment and afterward. This permitted a direct correlation between functional studies and therapeutic outcome.
This study illustrates the necessity of analyzing target tissue/host interactions at the site in which they are likely to occur. Such information may complement data obtained with the analysis of the systemic effects of vaccination and might enhance the understanding of the complex mechanisms underlying the success and failure of vaccination.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: MAA, melanoma-associated antigen; CDR, complementarity-determining region; CM, complete medium; DHDA, direct heteroduplex analysis; FNA, fine needle aspirate; rVV, recombinant vaccinia virus; TIL, tumor-infiltrating lymphocyte. ![]()
Received for publication May 1, 1998. Accepted for publication June 19, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. T. Ahlen, A. Husebekk, M. K. Killie, B. Skogen, and T. B. Stuge T-cell responses associated with neonatal alloimmune thrombocytopenia: isolation of HPA-1a-specific, HLA-DRB3*0101-restricted CD4+ T cells Blood, April 16, 2009; 113(16): 3838 - 3844. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yee Adoptive T Cell Therapy: Stratagems and Spoils ASCO Educational Book, January 1, 2009; 2009(1): 511 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Deola, M. C. Panelli, D. Maric, S. Selleri, N. I. Dmitrieva, C. Y. Voss, H. Klein, D. Stroncek, E. Wang, and F. M. Marincola Helper B Cells Promote Cytotoxic T Cell Survival and Proliferation Independently of Antigen Presentation through CD27/CD70 Interactions J. Immunol., February 1, 2008; 180(3): 1362 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Andersen, I. M. Svane, J. C. Becker, and P. t. Straten The Universal Character of the Tumor-Associated Antigen Survivin Clin. Cancer Res., October 15, 2007; 13(20): 5991 - 5994. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Keilholz, P. Martus, and C. Scheibenbogen Immune monitoring of T-cell responses in cancer vaccine development. Clin. Cancer Res., April 1, 2006; 12(7): 2346s - 2352s. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Hsiao, K.-W. Liao, S.-W. Hung, and R.-M. Chu Tumor-Infiltrating Lymphocyte Secretion of IL-6 Antagonizes Tumor-Derived TGF-{beta}1 and Restores the Lymphokine-Activated Killing Activity J. Immunol., February 1, 2004; 172(3): 1508 - 1514. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Disis, N. Scholler, A. Dahlin, J. Pullman, K. L. Knutson, K.-E. Hellstrom, and I. Hellstrom Plasmid-based vaccines encoding rat neu and immune stimulatory molecules can elicit rat neu-specific immunity Mol. Cancer Ther., October 1, 2003; 2(10): 995 - 1002. [Abstract] [Full Text] |
||||
![]() |
S. M. Schmidt, K. Schag, M. R. Muller, M. M. Weck, S. Appel, L. Kanz, F. Grunebach, and P. Brossart Survivin is a shared tumor-associated antigen expressed in a broad variety of malignancies and recognized by specific cytotoxic T cells Blood, July 15, 2003; 102(2): 571 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Andersen, L. O. Pedersen, B. Capeller, E.-B. Brocker, J. C. Becker, and P. thor Straten Spontaneous Cytotoxic T-Cell Responses against Survivin-derived MHC Class I-restricted T-Cell Epitopes in Situ As Well As ex Vivo in Cancer Patients Cancer Res., August 1, 2001; 61(16): 5964 - 5968. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Ohnmacht, E. Wang, S. Mocellin, A. Abati, A. Filie, P. Fetsch, A. I. Riker, U. S. Kammula, S. A. Rosenberg, and F. M. Marincola Short-Term Kinetics of Tumor Antigen Expression in Response to Vaccination J. Immunol., August 1, 2001; 167(3): 1809 - 1820. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Monsurro, M.-B. Nielsen, A. Perez-Diez, M. E. Dudley, E. Wang, S. A. Rosenberg, and F. M. Marincola Kinetics of TCR Use in Response to Repeated Epitope-Specific Immunization J. Immunol., May 1, 2001; 166(9): 5817 - 5825. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Rakhmilevich, M. Imboden, Z. Hao, M. D. Macklin, T. Roberts, K. M. Wright, M. R. Albertini, N.-S. Yang, and P. M. Sondel Effective Particle-mediated Vaccination against Mouse Melanoma by Coadministration of Plasmid DNA Encoding Gp100 and Granulocyte-Macrophage Colony-Stimulating Factor Clin. Cancer Res., April 1, 2001; 7(4): 952 - 961. [Abstract] [Full Text] |
||||
![]() |
B. W. Anderson, G. E. Peoples, J. L. Murray, M. A. Gillogly, D. M. Gershenson, and C. G. Ioannides Peptide Priming of Cytolytic Activity to HER-2 Epitope 369-377 in Healthy Individuals Clin. Cancer Res., November 1, 2000; 6(11): 4192 - 4200. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-B. Nielsen, V. Monsurro, S. A. Migueles, E. Wang, A. Perez-Diez, K.-H. Lee, U. Kammula, S. A. Rosenberg, and F. M. Marincola Status of Activation of Circulating Vaccine-Elicited CD8+ T Cells J. Immunol., August 15, 2000; 165(4): 2287 - 2296. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Panelli, M. P. Bettinotti, K. Lally, G. A. Ohnmacht, Y. Li, P. Robbins, A. Riker, S. A. Rosenberg, and F. M. Marincola A Tumor-Infiltrating Lymphocyte from a Melanoma Metastasis with Decreased Expression of Melanoma Differentiation Antigens Recognizes MAGE-12 J. Immunol., April 15, 2000; 164(8): 4382 - 4392. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Panelli, A. Riker, U. Kammula, E. Wang, K.-H. Lee, S. A. Rosenberg, and F. M. Marincola Expansion of Tumor-T Cell Pairs from Fine Needle Aspirates of Melanoma Metastases J. Immunol., January 1, 2000; 164(1): 495 - 504. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. thor Straten, P. Guldberg, K. Gronbak, M. R. Hansen, A. F. Kirkin, T. Seremet, J. Zeuthen, and J. C. Becker In Situ T Cell Responses Against Melanoma Comprise High Numbers of Locally Expanded T Cell Clonotypes J. Immunol., July 1, 1999; 163(1): 443 - 447. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |