| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
*
University of Iowa College of Pharmacy and
Interdisciplinary Graduate Program in Immunology and Department of Internal Medicine, University of Iowa College of Medicine; Iowa City, IA 52242; and
Department of Veteran Affairs Medical Center, Iowa City, IA 52246, and CpG ImmunoPharmaceuticals, Wellesley, MA 02481.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IFN-
, IL-6, and IL-12.
Here we demonstrate that the immunosuppressant cyclosporin A (CsA)
unexpectedly enhanced CpG DNA-induced IL-12 production in murine
splenocytes. CsA did not inhibit CpG DNA-induced TNF- or IL-6
production, but decreased the production of IFN- by CpG DNA. Upon
examining mechanisms by which CsA increases IL-12 production, we found
that CpG DNA can also induce IL-10 production in B cells and that this
production was sensitive to CsA. IL-10 has anti-inflammatory
effects and can reduce the production of IL-12. To determine the
possible role of CsA-modulated IL-10 production in mediating the
increased IL-12 levels, splenocytes from IL-10 gene-disrupted mice
(IL-10 -/-) and splenocytes cultured in anti-IL-10 Ab were
studied. CpG DNA-stimulated IL-10 (-/-) splenocytes demonstrated no
increase in IL-12 levels in the presence of CsA. Anti-IL-10 Ab
treatment of normal splenocytes increased the magnitude of CpG
DNA-induced IL-12 production to that seen with CsA. These results
suggest that CpG DNA induces CsA-sensitive IL-10 production in B cells
and that IL-10 acts as a negative feedback regulator of CpG DNA-induced
IL-12 production. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
,
IFN-, IL-6, and IL-12 (6, 7, 8, 9). CpG DNA also degrades I
B through a
reactive oxygen species-sensitive pathway, leading to subsequent
translocation of NF-B to the nucleus (10). CpG DNA enhances the
efficacy of mAb for cancer therapy (11), can prevent airway disease in
a murine asthma model (12), and acts as a potent vaccine adjuvant for
diverse Ags (13, 14, 15, 16, 17). While CpG DNA has these overwhelming beneficial
effects, aberrant immune responses to CpG DNA may have relevance in the
pathology of septic shock and autoimmune disease (18, 19).
Cyclosporin A (CsA)3 is a
potent immunosuppressant first used clinically in transplantation and
becoming more frequently used in the treatment of autoimmune diseases
(20). The immune-suppressive effects of CsA have been attributed to
binding of the drug to the intracellular protein cyclophilin, creating
a complex that inhibits the phosphatase calcineurin. Blockade of
calcineurin enzymatic activity prevents the translocation of NF-AT and
subsequent transcription of IL-2 by T cells (21, 22). These
observations have been extended to other cell types and other cytokines
under different experimental conditions. Whereas TNF- induction via
CD40 or Ag receptor stimulation in B cells is inhibited by CsA (23, 24), TNF- production in LPS-treated lymphocytes and monocytes is not
suppressed by CsA (25). Furthermore, CsA can inhibit the production of
IL-4, IL-5, IFN-, and TNF- in human PBMCs stimulated with PMA and
ionomycin (26).
To establish the role of CpG DNA in cytokine networks and in the course
of experiments to evaluate the possible role of NF-AT in mediating the
cytokine response to CpG DNA, we evaluated whether CsA can suppress CpG
DNA-mediated proinflammatory cytokine production. These experiments
were also undertaken to understand the possible effects of bacterial
DNA on patients receiving immunosuppressive therapy. We anticipated
that CsA would inhibit proinflammatory cytokine production, but found
that CsA did not alter CpG DNA-induced production of TNF- or IL-6 in
murine splenocytes (Fig. 1
, Aand B). Furthermore, CsA and CpG DNA appeared to
synergistically increase IL-12 production. Conversely, CsA decreased
CpG DNA-induced production of IL-10 and IFN- in primary splenocytes,
and CsA failed to enhance CpG DNA-induced IL-12 production in mice
genetically deficient in IL-10. T cell and macrophage depletion
experiments suggest that the B cell is the cellular source of
CsA-sensitive IL-10 production. These results suggest that CsA-mediated
suppression of IL-10 production in B cells in response to CpG DNA leads
to increased levels of IL-12.
|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Spleen cells and splenic B cells (97% B220 positive) were prepared from BALB/c or DBA2 mice (5–10 wk old; The Jackson Laboratory, Bar Harbor, ME) as described previously (27, 28). Murine B lymphoma WEHI-231 cells and murine monocyte J774 cells were purchased from American Type Culture Collection (Manassas, VA). Splenocytes from IL-10-/-129/SvEv strains as well as 129/SvEv wild-type control littermates were courtesy of D. J. Berg. All cells were cultured at 37°C in a 5% CO2 humidified incubator and maintained in RPMI 1640 supplemented with 10% FCS, 1.5 mM L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 pg/ml streptomycin.
Oligodeoxynucleotides and bacterial DNA
Most experiments used nuclease-resistant phosphorothioate oligodeoxynucleotides (S-ODN) purchased from Oligos Etc. (Wilsonville, OR). Escherichia coli DNA with a phosphodiester DNA backbone (EC-DNA) and calf thymus DNA (CT-DNA) were purchased from Sigma (St. Louis, MO) and dissolved in TE. The LPS level in ODN was <2.5 ng/mg of ODN and 40 ng/mg of EC-DNA by Limulus assay (29).
Cytokine assays
Murine spleen cells, WEHI-231 cells, or J774 cells were cultured
with CpG DNA (1826; TCCATGACGTTCCTGACGTT; S-ODN; 1 µM), non-CpG DNA
(1911; TCCAGGACTTTCCTCAGGTT; S-ODN; 1 µM), EC-DNA (10 µg/ml), or
CT-DNA (10 µg/ml) in the presence or the absence of CsA (10–250
ng/ml) for 6 to 48 h depending on the cytokine measured. The
levels of cytokines in the culture supernatants were analyzed by ELISA
for IL-6, IL-12, IFN-, or TNF- as previously described (27) and
for IL-10 according to the manufacturer’s instructions (PharMingen,
San Diego, CA). CsA was used in varying concentrations from 10 to 250
ng/ml and was purchased from Sigma. In all experiments, CsA was
dissolved in 50% ethanol, with the final volume never exceeding 0.05%
of the culture. A vehicle and CsA control was run for each experiment.
All experiments were performed at least three times.
RNase protection assay (RPA)
Murine splenocytes (2 x 106 cells/ml) were cultured for 15 min in the presence or the absence of CsA (100 ng/ml). Cells were then stimulated by the addition of CpG DNA for 6 h. Cells were harvested, and total RNA was prepared using the RNAzol method according to the manufacturer’s protocol (Tel-Test, Friendswood, TX). Levels of mRNA of specific genes were analyzed by RPA as described previously (4). Equal amounts of RNA (3 µg/sample) were used for the RPA, and L32, a gene coding for a ribosomal protein, was used as an equal loading control.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or IL-6,
but enhances the production of IL-12
To assess the effect of CsA on CpG DNA-induced cytokine
production, spleen cells were treated with CpG DNA (1 µM), non-CpG
DNA (1 µM), EC-DNA (10 µg/ml), or CT-DNA (10 µg/ml) with or
without CsA (250 ng/ml) for 6 h (TNF-) or for 24 h (IL-6
and IL-12). As previously reported, CpG DNA (CpG oligonucleotide and
EC-DNA) strongly induced the production of TNF-, IL-6, and IL-12,
while control non-CpG DNA (non-CpG ODN and calf thymus DNA) failed to
induce cytokine secretion (6, 8). Addition of CsA dramatically enhanced
the production of IL-12, but failed to show any effect on TNF- and
IL-6 production (Fig. 1
). The effect of CsA on CpG DNA-induced IL-12
production was dose dependent (Fig. 2).
|
production in response to CpG DNA
Since CsA is a known immune suppressor, the induction of IL-12 in
CpG-treated cells was initially surprising. However, results from our
laboratory and others have demonstrated that IL-10 has a regulatory
role in IL-12 production (30, 31, 32). Conversely, the observed increases
in IL-12 production may be stimulated by a positive feedback loop by
CpG DNA-induced IFN- (6, 33). Therefore, we tested whether CsA
enhances IL-12 secretion by modulation of either IL-10 or IFN-
production. Various concentrations of CsA were added to spleen cells 15
min before addition of CpG DNA or non-CpG DNA. Levels of IL-10 and
IFN- in culture supernatants were measured by ELISA. As demonstrated
in Figure 3, A and
B, IL-10 and IFN- production by CpG DNA were partially
inhibited in a dose-dependent manner. Our results for CsA-induced
IFN- suppression are in accordance with those of previous studies
using other stimuli (26, 34). The suppression of IFN- levels also
suggests that IFN- is neither acting through positive feedback
mechanisms nor inhibiting IL-10 production to increase IL-12
production. This raised the possibility that CsA induces increased
IL-12 production by directly preventing IL-10 production in response to
CpG DNA.
|
To further elucidate the role of IL-10 in the CsA-mediated
increase in CpG DNA-induced IL-12 production, we performed
experiments using IL-10 Ab and IL-10 gene-disrupted mice
(IL-10-/-). Inhibition by IL-10 Ab (5 µg/ml)
increased CpG DNA-induced IL-12 production to a similar degree as CsA
(250 ng/ml; Fig. 4). Combination of the
two inhibitors increased the amount of IL-12 secretion more than either
alone. This might be explained by the inability of CsA to completely
suppress CpG DNA-induced IL-10, even at the highest doses (Fig. 3A) and by the fact that IL-10 bound only secreted IL-10
and did not affect CsA-suppressed intracellular IL-10 production.
Consistent with our hypothesis that IL-10 inhibition results in
increased IL-12 production, CsA treatment of spleen cells from IL-10
gene-disrupted mice had no effect on CpG DNA-induced IL-12 secretion
(Fig. 5). Spleen cells from the wild-type
littermate showed a similar response to CsA as BALB/c splenocytes,
although at reduced levels due to the fewer number of cells used for
this assay.
|
|
To examine whether the CsA response at the protein level also
correlated with mRNA transcription, we performed an RPA on mRNA
extracted from whole splenocytes cultured with CpG DNA in the presence
or the absence of CsA (Fig. 6). The RPA
revealed that CsA causes a partial decrease in the level of CpG-induced
IL-10 mRNA with a corresponding increase in IL-12 mRNA, especially the
p40 subunit, consistent with the results observed from ELISA analysis
of protein levels.
|
Since CpG DNA stimulates cytokines primarily in B cells and
macrophages (27, 35, 36), we studied IL-10 production in primary
splenic B cells, a B cell line (WEHI-231), and a macrophage-like cell
line (J774) treated with or without CpG DNA and/or CsA. Of note, CpG
DNA directly induced IL-10 production in primary B cells and WEHI
cells, but not in J774 cells (Fig. 7). CsA blocked IL-10 production
induced by CpG DNA in a dose-dependent manner in primary B cells and
WEHI-231 cells, whereas J774 macrophages did not produce detectable
amounts of CpG-induced IL-10, regardless of the presence of CsA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-6, IL-12, and IFN-.
On the other hand, CpG DNA also induces IL-10 production, which can
antagonize the secretion of IL-12 (30, 31, 32). Here we demonstrate that
CpG DNA and CsA synergistically enhance IL-12 protein and mRNA
production. CsA had no apparent effect on TNF- or IL-6 levels, but
decreased IL-10 and IFN- production in cells stimulated with CpG
DNA. CpG DNA-induced IL-10 production in B cells is suppressed by CsA,
apparently leading to enhanced IL-12 production. These findings were
further supported in experiments on spleen cells of IL-10
gene-disrupted mice, in which CsA demonstrated no additional
enhancement of CpG DNA-induced IL-12 production. Of note, CsA
suppressed IL-10 production at 10 ng/ml, whereas the maximal CpG
DNA-induced IL-12 production appeared to occur at 100 ng/ml CsA. The
differences in dose response could represent inhibition of functional
effects of IL-10 at higher CsA doses, or they may suggest that other
factors, such as TGF-ß, in addition to IL-10 inhibition are enhancing
IL-12 production. We are currently examining these possibilities.
Although not analyzed in these experiments, but shown elsewhere, the
most likely cellular source of CpG DNA-induced IL-12 is the
monocyte/macrophage (37). Based on these observations, we propose that
CsA modulates the CpG DNA immune response by decreasing IL-10
production by B cells, which, in turn, promotes CsA-insensitive IL-12
production by macrophages.
The cellular mechanism by which CsA modulates CpG DNA-induced IL-10
with subsequent increased IL-12 levels is not known. IL-10 is a
pleiotropic cytokine first identified to reduce cytokines produced by
Th1 clones (38). IL-10 is a potent autocrine factor for proliferation
and differentiation of B cells (39) and is a known inhibitor of IL-12,
IL-2, and IFN- proinflammatory proteins associated with a Th1-type
or cell-mediated immune effector response (40). Such inhibition leads
to the development of a Th2-type or humoral response mainly
characterized by B cell proliferation and Ab secretion. We have shown
that primary splenic B cells and WEHI-231 murine B lymphoma cells
secrete IL-10 in response to CpG DNA and that this response is
sensitive to the effects of CsA. This induction of IL-10 may have
relevance in proliferative and antiapoptotic effects observed in B
cells stimulated with CpG DNA (3, 4). If IL-10 is involved in mediating
such effects, then theoretically CsA could prevent the proliferative
effects that CpG DNA has on B cells. Due to our B cell-purifying
methods, we cannot exclude the possibility that contaminating cells in
our B cell preparations are producing IL-10. However, based on
supporting evidence from B cell lines, our results suggest that CpG DNA
induces B cells to produce IL-10 in a CsA-sensitive manner. These
results conflict with those from an earlier report in which IL-10
secretion was not detected upon CpG DNA stimulation (6). The methods
used previously may not have had the sensitivity to detect IL-10
production, since our present findings and previous data (30) confirm
that CpG DNA induces IL-10.
It may also be possible that CsA may suppress IL-10 production
indirectly rather than directly. CsA inhibits other cytokines, such as
IL-2 or IFN-, which act as positive and negative regulators of IL-10
production, respectively (34, 41). However, CpG DNA does not appear to
stimulate T cells or induce IL-2 (6). We have also shown that CsA
down-regulates CpG DNA-induced IFN- production (Fig. 3B),
suggesting that IFN- is not suppressing IL-10 production.
CsA inhibits calcineurin activity, thereby preventing the translocation of NF-AT to the nucleus in response to leukocyte activation. Preliminary work in our laboratory suggests that CpG DNA activates NF-AT (M. Anitescu, T. W. Redford, A.-K. Yi, and A. M. Krieg, unpublished observations). Although there are no reports of NF-AT-regulated IL-10 transcription, recent studies suggest that NF-AT may be required for a Th2 immune response. In these studies, mice with disrupted genes for NF-AT1 (NF-ATp) and NF-AT2 (NF-ATc) displayed impaired Th2 responses, as demonstrated by decreases in IL-4 and IL-6 production (42, 43, 44). This observation might be extended to other Th2 cytokines, such as IL-10, and it may be possible that CsA is inhibiting NF-AT activation that is required for CpG DNA-induced IL-10 production. We are currently investigating such a possibility.
Clinically, these findings may have relevance in patients treated with CsA for organ transplant or autoimmune disease. IL-12 plays a role in exacerbating acute graft-vs-host disease (45, 46). It is possible that the risk of acute graft-vs-host disease may be compounded with concomitant bacterial or viral infection and subsequent IL-12 release in the presence of CsA-induced IL-10 suppression. Also of interest is the finding that IL-10 production is increased in a number of lymphoproliferative disorders, including Burkitt’s lymphoma and other non-Hodgkins lymphomas (47, 48), as well as autoimmune diseases, such as systemic lupus erythematosus (49). If IL-10 is promoting B cell proliferation and preventing apoptosis in these disorders, then CsA may be used therapeutically to down-regulate IL-10 production. Before such findings have clinical relevance, further work needs to be performed to elucidate the mechanisms involved in perturbation of the IL-10/IL-12 cytokine axis.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Arthur M. Krieg, University of Iowa, 540 EMRB, Iowa City, IA 52242. E-mail address:
3 Abbreviations used in this paper: CsA, cyclosporin A; S-ODN, phosphorothioate oligodeoxynucleotides; EC-DNA, Escherichia coli DNA; CT-DNA, calf thymus DNA; RPA, ribonuclease protection assay.
Received for publication March 23, 1998. Accepted for publication June 11, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and IBß and sustained activation of nuclear factor-B/c-rel. J. Immunol. 160:1240.. Proc. Natl. Acad. Sci. USA 93:2879. production by NK cells and increases sensitivity to endotoxin. J. Immunol. 157:1840.[Abstract]
. Cell. Immunol. 167:72.[Medline]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
gene in B cells and T cells by NFATp and ATF-2/JUN. Mol. Cell. Biol. 16:5232.[Abstract]
and tumor necrosis factor- expression in vivo: effects of cyclohexamide and cyclosporine in normal and lipopolysaccharide-treated mice. J. Immunol. 150:342.[Abstract]
-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041. in monocytic cells. J. Exp. Med. 183:147. inhibits interleukin 10 production by monocytes. J. Exp. Med. 177:523.-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
. J. Immunol. 157:2851.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  A. Ertesvag, H.-C. Aasheim, S. Naderi, and H. K. Blomhoff Vitamin A potentiates CpG-mediated memory B-cell proliferation and differentiation: involvement of early activation of p38MAPK Blood, May 1, 2007; 109(9): 3865 - 3872. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wittmann, C. Killig, M. Bruder, R. Gutzmer, and T. Werfel Critical involvement of IL-12 in IFN-{gamma} induction by calcineurin antagonists in activated human lymphocytes J. Leukoc. Biol., July 1, 2006; 80(1): 75 - 86. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Schirmbeck, P. Riedl, R. Zurbriggen, S. Akira, and J. Reimann Antigenic Epitopes Fused to Cationic Peptide Bound to Oligonucleotides Facilitate Toll-Like Receptor 9-Dependent, but CD4+ T Cell Help-Independent, Priming of CD8+ T Cells J. Immunol., November 15, 2003; 171(10): 5198 - 5207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Kemp, B. D. Elzey, and T. S. Griffith Plasmacytoid Dendritic Cell-Derived IFN-{alpha} Induces TNF-Related Apoptosis-Inducing Ligand/Apo-2L-Mediated Antitumor Activity by Human Monocytes Following CpG Oligodeoxynucleotide Stimulation J. Immunol., July 1, 2003; 171(1): 212 - 218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kitagaki, V. V. Jain, T. R. Businga, I. Hussain, and J. N. Kline Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses Clin. Vaccine Immunol., November 1, 2002; 9(6): 1260 - 1269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-C. Hong, T. W. Redford, and A. M. Krieg Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-{alpha} production through activation of NF-{kappa}B Int. Immunol., November 1, 2001; 13(11): 1391 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. K. Ballas, A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, and G. J. Weiner Divergent Therapeutic and Immunologic Effects of Oligodeoxynucleotides with Distinct CpG Motifs J. Immunol., November 1, 2001; 167(9): 4878 - 4886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-G. Zhu and J. S. Marshall CpG-containing oligodeoxynucleotides induce TNF-{alpha} and IL-6 production but not degranulation from murine bone marrow-derived mast cells J. Leukoc. Biol., February 1, 2001; 69(2): 253 - 262. [Abstract] [Full Text]
|
|
|
|
|
|
T. L. Warren, S. K. Bhatia, A. M. Acosta, C. E. Dahle, T. L. Ratliff, A. M. Krieg, and G. J. Weiner APC Stimulated by CpG Oligodeoxynucleotide Enhance Activation of MHC Class I-Restricted T Cells J. Immunol., December 1, 2000; 165(11): 6244 - 6251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Jin, D. P. Raymond, T. D. Crabtree, S. J. Pelletier, C. W. Houlgrave, T. L. Pruett, and R. G. Sawyer Enhanced Murine Macrophage TNF Receptor Shedding by Cytosine-Guanine Sequences in Oligodeoxynucleotides J. Immunol., November 1, 2000; 165(9): 5153 - 5160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wild, M. J. Grusby, R. Schirmbeck, and J. Reimann Priming MHC-I-Restricted Cytotoxic T Lymphocyte Responses to Exogenous Hepatitis B Surface Antigen Is CD4+ T Cell Dependent J. Immunol., August 15, 1999; 163(4): 1880 - 1887. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Schwartz, C. L. Wohlford-Lenane, T. J. Quinn, and A. M. Krieg Bacterial DNA or Oligonucleotides Containing Unmethylated CpG Motifs Can Minimize Lipopolysaccharide-Induced Inflammation in the Lower Respiratory Tract Through an IL-12-Dependent Pathway J. Immunol., July 1, 1999; 163(1): 224 - 231. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
