| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
CUTTING EDGE |
*
Department of Pathology and Center for Immunology, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110;
Department of Immunology, University of California, Berkeley, CA 94720; and
Roche Bioscience, Palo Alto, CA 94303
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
While previous studies of IL-4 gene regulation in T cells focused on the proximal 800 base pairs (8, 9, 10, 11, 12, 13, 14, 15), this promoter region is not sufficient to direct full IL-4 gene activity (16). The 800-bp promoter was able to direct some degree of Th2-selective expression in several transgenic reporter lines. However, the amount of reporter mRNA was virtually undetectable compared with the levels of endogenous IL-4 mRNA. Thus, other regulatory elements outside of the 800-bp proximal promoter are required to direct full IL-4 gene activity (16).
By scanning the IL-4/IL-13 locus, we identified several genomic regions having enhancer activity that increase IL-4 promoter transactivation by GATA-3. GATA elements from these regions bind Th2-specific complexes. Using retroviral transduction of GATA-3 into naive T cells, we show that GATA-3 induces IL-5 expression to levels equivalent with Th2 controls, but does not similarly restore full IL-4 expression. This suggests that GATA-3 is not sufficient for full IL-4 gene activity in Th2 cells, and in fact, may be one permissive factor required to enhance IL-4 expression through distal sites rather than acting exclusively within the IL-4 proximal promoter.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
M12 cells were maintained in Iscove’s modified Dulbecco’s medium and Jurkat in RPMI 1640 supplemented as described (8). M12 cells (107) or 2 x 107 Jurkat cells were electroporated as described (8) with 20 µg/ml of the indicated reporter plasmid, 20 µg/ml of the expression plasmid, and 0.5 µg/ml pRL-CMV (Promega, Madison, WI) to monitor transfection efficiency. M12 cells were transfected as described (8), and Jukat cells were transfected at 300 V, 960 µF. Cells were harvested at 16 h and left unstimulated or stimulated with 50 ng/ml PMA and 1 µM ionomycin. Cells were lyzed at 4 h in 100 µl of 10 mM KH2PO4/500 mM NaCl/1 mM EDTA, pH 8, and lysates were assayed for firefly and renilla luciferase activities.
Cloning and plasmid construction
An 86-kb genomic P1 clone was identified as positive by PCR for
IL-4 and IL-13 (Genome Systems, St. Louis, MO). The clone was
sequenced (InCyte, Palo Alto, CA) at 12-fold redundancy to yield
four contiguous DNA sequences. All BamHI fragments
were subcloned upstream of the 800-bp IL-4 luciferase reporter
construct (IL-4 Luc, here named -800
Luc).3 One 20-kb fragment was
further subcloned as five BamHI/HindIII or
HindIII fragments into -800 Luc (see Fig. 3
).
Restriction digest and Southern mapping confirmed the order and
position of all fragments. Trimerized sites containing the IL-2
promoter NF-AT consensus (3xNFAT) and 202-bp IFN-
promoter (IFN-
Luc) were placed into the luciferase plasmid pBS-LUC (8).
|
EMSAs were performed as described (8). Nuclear extract was incubated (6.6 µg) in a 10-µl reaction with 5 x 104 cpm of probe, 0.15 mg/ml BSA, 1 µg poly(dI:dC). After 30 min at 4 C, complexes were electrophoresed through 4.5% polyacrylamide at 4 C in 0.4x TBE for 4 h at 150 V. Fully annealed EMSA probes were as follows: probe 1, GAGAAATGATAAATGATAAGAAAAGTTGAAGAAC; probe 2, GTAACAGAGTGATAGGAGATAGATACAATCAGCC; probe 3, GGTGTAATAGATAATTGGAGCAGGCTGGCC; probe 4, CAACCCTACGCTGATAAGATTAGTCTGAAAG; probe 5, TGTGATAGAAACCCAGGAGGCCCAAAGGAGTGCT; and UTR, TGCATTGTTAGCATCTCTTGATAAACTTAATTGTCT.
Retroviral transduction
The retroviral vector GFP-RV was made by placing the 600-bp EcoRI-NcoI EMCV IRES fragment from pCITE-1 (Novagen, Madison, WI) upstream of the 700-bp NcoI-EcoRI humanized green fluorescent protein (GFP) allele (hGFP-S65T; Clontech, Palo Alto, CA) in a trimolecular ligation into the EcoRI site of pBSSKII(-) (Stratagene, La Jolla, CA). The 1.3-kb XhoI/BamHI IRES-hGFP cassette was cut from pBSSKII(-) ligated into the XhoI/BamHI site of the MSCV2.2 retroviral vector, replacing the 1.3-kb phosphoglycerate kinase-neomycin cassette. A BglII/SalI GATA-3 cDNA PCR fragment was ligated into the unique BglII and XhoI sites of GFP-RV to produce GATA3-RV. Phoenix-Eco packaging cells (Dr. G. Nolan, Stanford, CA) were transfected according to Dr. Nolan’s online protocol (http://www-leland.standford.edu/group/nolan/NL-phnxr.html). DO11.10 T cells were activated as described and infected with retroviral supernatant on day 2. On day 7, infected T cells were purified by sorting for GFP expression to a purity of >95% GFP-positive following postsort analysis.
Western blot analysis
T cells (107) were stimulated under the indicated conditions, lysed in 30 µl of cell lysis buffer (5% SDS, 0.5 M Tris, pH 6.8, 0.5 mM EDTA, 1 mM DTT, 1 mM PMSF, 10 µg leupeptin) for 10 min at room temperature, and centrifuged at 100,000 x g for 10 min. Supernatants were resolved by SDS-PAGE, transferred to nitrocellulose (Bio-Rad, Hercules, CA), and probed with murine monoclonal anti-GATA3 (1:3000; Santa Cruz Biotechnology, Santa Cruz, CA) , Goat anti-mouse (1:2000; Santa Cruz Biotechnology) and developed by enhanced chemiluminescence (ECL; Amersham, Arlington Heights, IL).
|
Results and Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
We examined the effects of GATA-3 in both M12 and Jurkat cells for
two different IL-4 promoters (-157 Luc and -800 Luc reporters). Using
20 µg of GATA3-RV expression plasmid (GATA3-RV), we observed 
8- to
12-fold augmentation in M12 cells and only 4- to 6-fold in Jurkat cells
for both reporters (Fig. 1). We observed
a dose-dependent effect of GATA-3 expression for this augmentation
(Fig. 1B), because when using 5 µg rather than 20 µg of
GATA3-RV, the augmentation was not significant. The level of
augmentation seen in both M12 and Jurkat cells was significantly lower
than previously reported for the IL-4 promoter (3) using the same M12
system. To determine whether the GATA-3 actions were specific to the
IL-4 promoter, we examined four other cytokine reporters, as well as an
NF-
B and an NF-AT reporter construct, for activation by GATA-3 (Fig. 2A). The IL-2 reporter
(8) was unaffected by GATA-3, while the IFN-ß, NF-B (17), and
IFN- reporters were augmented twofold. As noted above, the -800 Luc
reporter showed 6-fold activation by GATA-3, as did the trimerized
NF-AT site reporter construct (Fig. 2A).
|
|
A, probe 4),
which binds a Th2-specific complex that is shifted by the
anti-GATA3 Ab HG3–31 (Fig. 3C). To test the role of
this element in augmenting the IL-4 promoter, we examined a series of
promoter truncations and deletion constructs (Fig. 2B).
Removal of this GATA element, either by 5' truncation (DM3) or internal
deletion (ID5), reduced responsiveness to GATA3-RV only slightly (Fig. 2C), suggesting that this single GATA element is not the
only element required for enhancement of IL-4 reporter activity. A
sequence between -112 to -107 which was recently suggested (7) to be
a potential GATA site has already been shown by supershift analysis to
interact with NF-Y (8) rather than GATA-3. A final GATA sequence is
present at +19 to +24 of the 5' untranslated IL-4 promoter region.
However, this sequence does not interact with a complex characteristic
of GATA-3, since it is not shifted by HG3-31 and is present in both Th1
and Th2 cells (Fig. 3C). Also, removal of this GATA element
from the context of the -157 Luc reporter only slightly reduced the
degree of GATA-3 inducibility (Fig. 2C). In summary, while we confirm that GATA-3 augments IL-4 reporter activity, we observed substantially lower levels of transactivation than reported earlier. Our deletion/mutation analysis suggests that the consensus GATA elements present between -741 and +60 of the IL-4 promoter may not represent the relevant or only targets for this transactivation. In fact, a recent study showed that that GATA-3 and GATA-2 exhibit distinct DNA-binding properties from GATA-1 based on their unique N-terminal zinc finger domains, (18), suggesting that perhaps nonconsensus GATA elements may need examination in future studies.
Identification of regions that enhance IL-4 promoter activity
Since the 800-bp promoter was insufficient to direct reporter
expression in transgenic mice to the levels of endogenous IL-4 (16), we
searched for enhancer activity within a 45-kb region spanning the IL-13
and IL-4 genes (Fig. 3A). Several regions directly increased
reporter activity of the -800 Luc reporter (Fig. 3B, open
bars). However, more significant increases were seen in response to
transactivation by GATA-3 (Fig. 3B, closed bars). The two
most active fragments (A and B) contained sequences with consensus
WGATAR motifs, both upstream and downstream of the IL-13 gene. Two
other active fragments (C and D) however had no GATA motifs, suggesting
that other factors might participate in their enhancer activity.
Notably, the least active region was that immediately upstream of the
IL-4 promoter (E). Several predicted GATA motifs from A and B bind
Th2-specific complexes in EMSA (Fig. 3C). Thus, the
Th2-specific expression of GATA-3 could potentially influence
IL-4/IL-13 gene expression as an enhancer binding factor that augments
gene expression from sites at a distance from the promoter rather than
acting exclusively within the promoter region.
GATA-3 does not restore IL-4 gene expression
We wished to test the role of GATA-3 in the context of
normal CD4+ T helper development rather than in transformed
cells. We used retrovirus to direct GATA-3 expression independently of
its normal extinction during Th1 development (Fig. 4A) to allow us to ascertain
whether GATA-3 is necessary and sufficient for IL-4 gene
expression in normal T cells. We infected GATA-3-expressing or control
retrovirus into T cells and induced either Th1 or Th2 development (Fig. 4B). GATA-3-transduced or control T cells were analyzed for
effects on cytokine expression. Forced GATA-3 expression in Th2 cells
did not increase IL-4 production, but nearly doubled IL-5 production
(Fig. 4, C and D). However, GATA-3 expression in
Th1 cells led to only a 30% restoration of IL-4 relative to the Th2
control level, but led to a full restoration of IL-5 production.
Western analysis showed that the level of GATA-3 achieved by retroviral
expression is equivalent to that of a Th2 control (Fig. 4E),
indicating that lowered cytokine levels of the transduced Th1 cells is
not simply a result of lower GATA-3 levels. Thus, in the context of
normally developing Th cells, GATA-3 appears to influence the
expression of IL-5 more strongly than that of IL-4. GATA-3
appears to be sufficient to induce full IL-5 levels in T cells, even
those treated to undergo Th1 development (by exposure to IL-12 and
anti-IL-4 Ab). In contrast, GATA-3 was less potent in restoring
IL-4 expression in T cells treated by IL-12.
|
|
Acknowledgments |
|---|
Luc, Doug Engel for
R/m-GATA3, Richard Flavell for the -157 Luc reporter, and David
Baltimore for the IFN-ß and NF-B reporters. |
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenneth M. Murphy, Department of Pathology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. E-mail address:
3 Abbreviations used in this paper: -800 Luc, 800-bp IL-4 luciferase reporter construct; EMSA, electrophoretic mobility shift assay; NF-AT, NF of activated T cells; EMCV, encephalomyocarditis virus; IRES, internal ribosomal entry sequence; GFP, green fluorescent protein; RV, retrovirus.
Received for publication June 10, 1998. Accepted for publication August 20, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
B. Genes Dev. 6:775.. J. Immunol. 152:1883.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  T. J. Nice, L. Coscoy, and D. H. Raulet Posttranslational regulation of the NKG2D ligand Mult1 in response to cell stress J. Exp. Med., February 16, 2009; 206(2): 287 - 298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhao, B. Zheng, Y. Huang, D. Yang, S. Katzman, C. Chang, D. Fowell, and W.-p. Zeng Interaction between GATA-3 and the Transcriptional Coregulator Pias1 Is Important for the Regulation of Th2 Immune Responses J. Immunol., December 15, 2007; 179(12): 8297 - 8304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Matsuno, Y. Ishii, K. Yoh, Y. Morishima, N. Haraguchi, N. Kikuchi, T. Iizuka, T. Kiwamoto, S. Homma, A. Nomura, et al. Overexpression of GATA-3 Protects against the Development of Hypersensitivity Pneumonitis Am. J. Respir. Crit. Care Med., November 15, 2007; 176(10): 1015 - 1025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Ramos, A. M. Davis, T. C. George, and J. D. Farrar IFN-{alpha} Is Not Sufficient to Drive Th1 Development Due to Lack of Stable T-bet Expression J. Immunol., September 15, 2007; 179(6): 3792 - 3803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. K. Weaver, E. Bohn, B. A. Judd, M. P. Gil, and R. D. Schreiber ABIN-3: a Molecular Basis for Species Divergence in Interleukin-10-Induced Anti-Inflammatory Actions Mol. Cell. Biol., July 1, 2007; 27(13): 4603 - 4616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Strempel and D. Vercelli Functional Dissection Identifies a Conserved Noncoding Sequence-1 Core That Mediates IL13 and IL4 Transcriptional Enhancement J. Biol. Chem., February 9, 2007; 282(6): 3738 - 3746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. C. Lindsley, J. G. Gill, M. Kyba, T. L. Murphy, and K. M. Murphy Canonical Wnt signaling is required for development of embryonic stem cell-derived mesoderm Development, October 1, 2006; 133(19): 3787 - 3796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kimura, Y. Ishii, K. Yoh, Y. Morishima, T. Iizuka, T. Kiwamoto, Y. Matsuno, S. Homma, A. Nomura, T. Sakamoto, et al. Overexpression of the Transcription Factor GATA-3 Enhances the Development of Pulmonary Fibrosis Am. J. Pathol., July 1, 2006; 169(1): 96 - 104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Hou, L. Liu, S. Anees, S. Hiroyasu, and N. E.S. Sibinga The Fat1 cadherin integrates vascular smooth muscle cell growth and migration signals J. Cell Biol., May 8, 2006; 173(3): 417 - 429. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Berenson, J. Yang, B. P. Sleckman, T. L. Murphy, and K. M. Murphy Selective Requirement of p38{alpha} MAPK in Cytokine-Dependent, but Not Antigen Receptor-Dependent, Th1 Responses. J. Immunol., April 15, 2006; 176(8): 4616 - 4621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Shoemaker, M. Saraiva, and A. O'Garra GATA-3 Directly Remodels the IL-10 Locus Independently of IL-4 in CD4+ T Cells J. Immunol., March 15, 2006; 176(6): 3470 - 3479. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jimenez-Perianez, G. Ojeda, G. Criado, A. Sanchez, E. Pini, J. Madrenas, J. M. Rojo, and P. Portoles Complement regulatory protein Crry/p65-mediated signaling in T lymphocytes: role of its cytoplasmic domain and partitioning into lipid rafts J. Leukoc. Biol., December 1, 2005; 78(6): 1386 - 1396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Feinberg, Z. Cao, A. K. Wara, M. A. Lebedeva, S. SenBanerjee, and M. K. Jain Kruppel-like Factor 4 Is a Mediator of Proinflammatory Signaling in Macrophages J. Biol. Chem., November 18, 2005; 280(46): 38247 - 38258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-O. Tykocinski, P. Hajkova, H.-D. Chang, T. Stamm, O. SOzeri, M. LOhning, J. Hu-Li, U. Niesner, S. Kreher, B. Friedrich, et al. A Critical Control Element for Interleukin-4 Memory Expression in T Helper Lymphocytes J. Biol. Chem., August 5, 2005; 280(31): 28177 - 28185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Lo, R. M. Brazas, and M. J. Holtzman Respiratory Syncytial Virus Nonstructural Proteins NS1 and NS2 Mediate Inhibition of Stat2 Expression and Alpha/Beta Interferon Responsiveness J. Virol., July 15, 2005; 79(14): 9315 - 9319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Jimi, R. J. Phillips, M. Rincon, R. Voll, H. Karasuyama, R. Flavell, and S. Ghosh Activation of NF-{kappa}B promotes the transition of large, CD43+ pre-B cells to small, CD43- pre-B cells Int. Immunol., June 1, 2005; 17(6): 815 - 825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Marusina, D.-K. Kim, L. D. Lieto, F. Borrego, and J. E. Coligan GATA-3 Is an Important Transcription Factor for Regulating Human NKG2A Gene Expression J. Immunol., February 15, 2005; 174(4): 2152 - 2159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-L. Ma, M. J. Whitters, B. A. Jacobson, D. D. Donaldson, M. Collins, and K. Dunussi-Joannopoulos Tumor cells secreting IL-13 but not IL-13R{alpha}2 fusion protein have reduced tumorigenicity in vivo Int. Immunol., July 1, 2004; 16(7): 1009 - 1017. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Wu, L. Rinaldi, K. A. Fortner, J. Q. Russell, J. Tschopp, C. Irvin, and R. C. Budd Cellular FLIP Long Form-Transgenic Mice Manifest a Th2 Cytokine Bias and Enhanced Allergic Airway Inflammation J. Immunol., April 15, 2004; 172(8): 4724 - 4732. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. You, T. Huang, E. J. Richer, J.-E. H. Schmidt, J. Zabner, Z. Borok, and S. L. Brody Role of f-box factor foxj1 in differentiation of ciliated airway epithelial cells Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L650 - L657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Lu, P. Zagouras, J. E. Fischer, J. Lu, B. Li, and R. A. Flavell Kinetic analysis of genomewide gene expression reveals molecule circuitries that control T cell activation and Th1/2 differentiation PNAS, March 2, 2004; 101(9): 3023 - 3028. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tamauchi, M. Terashima, M. Ito, H. Maruyama, N. Ikewaki, M. Inoue, X. Gao, K. Hozumi, and S. Habu Evidence of GATA-3-dependent Th2 commitment during the in vivo immune response Int. Immunol., January 1, 2004; 16(1): 179 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Y. Cho, V. Grigura, T. L. Murphy, and K. Murphy Identification of cooperative monomeric Brachyury sites conferring T-bet responsiveness to the proximal IFN-{gamma} promoter Int. Immunol., October 1, 2003; 15(10): 1149 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Sundrud, S. M. Grill, D. Ni, K. Nagata, S. S. Alkan, A. Subramaniam, and D. Unutmaz Genetic Reprogramming of Primary Human T Cells Reveals Functional Plasticity in Th Cell Differentiation J. Immunol., October 1, 2003; 171(7): 3542 - 3549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yoh, K. Shibuya, N. Morito, T. Nakano, K. Ishizaki, H. Shimohata, M. Nose, S. Izui, A. Shibuya, A. Koyama, et al. Transgenic Overexpression of GATA-3 in T Lymphocytes Improves Autoimmune Glomerulonephritis in Mice with a BXSB/MpJ-Yaa Genetic Background J. Am. Soc. Nephrol., October 1, 2003; 14(10): 2494 - 2502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-L. Ma, M. J. Whitters, R. F. Konz, M. Senices, D. A. Young, M. J. Grusby, M. Collins, and K. Dunussi-Joannopoulos IL-21 Activates Both Innate and Adaptive Immunity to Generate Potent Antitumor Responses that Require Perforin but Are Independent of IFN-{gamma} J. Immunol., July 15, 2003; 171(2): 608 - 615. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Franzke, W. Piao, J. Lauber, P. Gatzlaff, C. Konecke, W. Hansen, A. Schmitt-Thomsen, B. Hertenstein, J. Buer, and A. Ganser G-CSF as immune regulator in T cells expressing the G-CSF receptor: implications for transplantation and autoimmune diseases Blood, July 15, 2003; 102(2): 734 - 739. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Taha, Q. Hamid, L. Cameron, and R. Olivenstein T Helper Type 2 Cytokine Receptors and Associated Transcription Factors GATA-3, c-MAF, and Signal Transducer and Activator of Transcription Factor-6 in Induced Sputum of Atopic Asthmatic Patients Chest, June 1, 2003; 123(6): 2074 - 2082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Klein-Hessling, M. K. Jha, B. Santner-Nanan, F. Berberich-Siebelt, T. Baumruker, A. Schimpl, and E. Serfling Protein Kinase A Regulates GATA-3-Dependent Activation of IL-5 Gene Expression in Th2 Cells J. Immunol., March 15, 2003; 170(6): 2956 - 2961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Banerjee, M. W. Feinberg, M. Watanabe, S. Gray, R. L. Haspel, D. J. Denkinger, R. Kawahara, H. Hauner, and M. K. Jain The Kruppel-like Factor KLF2 Inhibits Peroxisome Proliferator-activated Receptor-gamma Expression and Adipogenesis J. Biol. Chem., January 17, 2003; 278(4): 2581 - 2584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. F. Schwenger, C. C. Kok, E. Arthaningtyas, M. A. Thomas, C. J. Sanderson, and V. A. Mordvinov Specific Activation of Human Interleukin-5 Depends on de Novo Synthesis of an AP-1 Complex J. Biol. Chem., November 27, 2002; 277(49): 47022 - 47027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Takemoto, K.-i. Arai, and S. Miyatake Cutting Edge: The Differential Involvement of the N-Finger of GATA-3 in Chromatin Remodeling and Transactivation During Th2 Development J. Immunol., October 15, 2002; 169(8): 4103 - 4107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Butler, M. M. Monick, T. O. Yarovinsky, L. S. Powers, and G. W. Hunninghake Altered IL-4 mRNA Stability Correlates with Th1 and Th2 Bias and Susceptibility to Hypersensitivity Pneumonitis in Two Inbred Strains of Mice J. Immunol., October 1, 2002; 169(7): 3700 - 3709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gray, M. W. Feinberg, S. Hull, C. T. Kuo, M. Watanabe, S. Sen-Banerjee, A. DePina, R. Haspel, and M. K. Jain The Kruppel-like Factor KLF15 Regulates the Insulin-sensitive Glucose Transporter GLUT4 J. Biol. Chem., September 6, 2002; 277(37): 34322 - 34328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Bhattacharya, D. U. Lee, and W. C. Sha Regulation of Ig class switch recombination by NF-{kappa}B: retroviral expression of RelB in activated B cells inhibits switching to IgG1, but not to IgE Int. Immunol., September 1, 2002; 14(9): 983 - 991. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Fields, S. T. Kim, and R. A. Flavell Cutting Edge: Changes in Histone Acetylation at the IL-4 and IFN-{gamma} Loci Accompany Th1/Th2 Differentiation J. Immunol., July 15, 2002; 169(2): 647 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Bhattacharya, E. C. Logue, S. Bakkour, J. DeGregori, and W. C. Sha Identification of gene function by cyclical packaging rescue of retroviral cDNA libraries PNAS, June 25, 2002; 99(13): 8838 - 8843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kurata, H.-J. Lee, T. McClanahan, R. L. Coffman, A. O'Garra, and N. Arai Friend of GATA Is Expressed in Naive Th Cells and Functions As a Repressor of GATA-3-Mediated Th2 Cell Development J. Immunol., May 1, 2002; 168(9): 4538 - 4545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. D. L. Savage, S. L. Kimzey, S. K. Bromley, K. G. Johnson, M. L. Dustin, and J. M. Green Polar Redistribution of the Sialoglycoprotein CD43: Implications for T Cell Function J. Immunol., April 15, 2002; 168(8): 3740 - 3746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Justice, M. T. Borchers, J. J. Lee, W. H. Rowan, Y. Shibata, and M. R. Van Scott Ragweed-induced expression of GATA-3, IL-4, and IL-5 by eosinophils in the lungs of allergic C57BL/6J mice Am J Physiol Lung Cell Mol Physiol, February 1, 2002; 282(2): L302 - L309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. F. Schwenger, R. Fournier, C. C. Kok, V. A. Mordvinov, D. Yeoman, and C. J. Sanderson GATA-3 Has Dual Regulatory Functions in Human Interleukin-5 Transcription J. Biol. Chem., December 14, 2001; 276(51): 48502 - 48509. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhou, W. Ouyang, Q. Gong, S. G. Katz, J. M. White, S. H. Orkin, and K. M. Murphy Friend of GATA-1 Represses GATA-3-dependent Activity in CD4+ T Cells J. Exp. Med., November 12, 2001; 194(10): 1461 - 1471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Wensky, M. C. Garibaldi Marcondes, and J. J. Lafaille The Role of IFN-{gamma} in the Production of Th2 Subpopulations: Implications for Variable Th2-Mediated Pathologies in Autoimmunity J. Immunol., September 15, 2001; 167(6): 3074 - 3081. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Nawijn, G. M. Dingjan, R. Ferreira, B. N. Lambrecht, A. Karis, F. Grosveld, H. Savelkoul, and R. W. Hendriks Enforced Expression of GATA-3 in Transgenic Mice Inhibits Th1 Differentiation and Induces the Formation of a T1/ST2-Expressing Th2-Committed T Cell Compartment In Vivo J. Immunol., July 15, 2001; 167(2): 724 - 732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhu, J. Yang, T. L. Murphy, W. Ouyang, F. Wagner, A. Saparov, C. T. Weaver, and K. M. Murphy Unexpected Characteristics of the IFN-{{gamma}} Reporters in Nontransformed T Cells J. Immunol., July 15, 2001; 167(2): 855 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Wallin, L. Liang, A. Bakardjiev, and W. C. Sha Enhancement of CD8+ T Cell Responses by ICOS/B7h Costimulation J. Immunol., July 1, 2001; 167(1): 132 - 139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Finotto, G. T. De Sanctis, H. A. Lehr, U. Herz, M. Buerke, M. Schipp, B. Bartsch, R. Atreya, E. Schmitt, P. R. Galle, et al. Treatment of Allergic Airway Inflammation and Hyperresponsiveness by Antisense-Induced Local Blockade of Gata-3 Expression J. Exp. Med., June 4, 2001; 193(11): 1247 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Burr, N. D. L. Savage, G. E. Messah, S. L. Kimzey, A. S. Shaw, R. H. Arch, and J. M. Green Cutting Edge: Distinct Motifs Within CD28 Regulate T Cell Proliferation and Induction of Bcl-XL J. Immunol., May 1, 2001; 166(9): 5331 - 5335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ranganath and K. M. Murphy Structure and Specificity of GATA Proteins in Th2 Development Mol. Cell. Biol., April 15, 2001; 21(8): 2716 - 2725. [Abstract] [Full Text]
|
|
|
|
|
|
J. D. Farrar, W. Ouyang, M. Lohning, M. Assenmacher, A. Radbruch, O. Kanagawa, and K. M. Murphy An Instructive Component in T Helper Cell Type 2 (Th2) Development Mediated by Gata-3 J. Exp. Med., March 5, 2001; 193(5): 643 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Takemoto, Y. Kamogawa, H. Jun Lee, H. Kurata, K.-i. Arai, A. O'Garra, N. Arai, and S. Miyatake Cutting Edge: Chromatin Remodeling at the IL-4/IL-13 Intergenic Regulatory Region for Th2-Specific Cytokine Gene Cluster J. Immunol., December 15, 2000; 165(12): 6687 - 6691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Chen, D.-H. Zhang, J. M. LaPorte, and A. Ray Cyclic AMP Activates p38 Mitogen-Activated Protein Kinase in Th2 Cells: Phosphorylation of GATA-3 and Stimulation of Th2 Cytokine Gene Expression J. Immunol., November 15, 2000; 165(10): 5597 - 5605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Murphy, E. D. Geissal, J. D. Farrar, and K. M. Murphy Role of the Stat4 N Domain in Receptor Proximal Tyrosine Phosphorylation Mol. Cell. Biol., October 1, 2000; 20(19): 7121 - 7131. [Abstract] [Full Text]
|
|
|
|
|
|
H. J. Lee, N. Takemoto, H. Kurata, Y. Kamogawa, S. Miyatake, A. O'Garra, and N. Arai Gata-3 Induces T Helper Cell Type 2 (Th2) Cytokine Expression and Chromatin Remodeling in Committed Th1 Cells J. Exp. Med., July 3, 2000; 192(1): 105 - 116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Farrar, J. D. Smith, T. L. Murphy, and K. M. Murphy Recruitment of Stat4 to the Human Interferon-alpha /beta Receptor Requires Activated Stat2 J. Biol. Chem., January 28, 2000; 275(4): 2693 - 2697. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Chen, T. F. Burke, J. E. Cumberland, M. Brummet, L. A. Beck, V. Casolaro, and S. N. Georas Glucocorticoids Inhibit Calcium- and Calcineurin-Dependent Activation of the Human IL-4 Promoter J. Immunol., January 15, 2000; 164(2): 825 - 832. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Randolph, G. Huang, C. J. Carruthers, L. E. Bromley, and D. D. Chaplin The Role of CCR7 in TH1 and TH2 Cell Localization and Delivery of B Cell Help in Vivo Science, December 10, 1999; 286(5447): 2159 - 2162. [Abstract] [Full Text]
|
|
|
|
|
|
W. Ouyang, N. G. Jacobson, D. Bhattacharya, J. D. Gorham, D. Fenoglio, W. C. Sha, T. L. Murphy, and K. M. Murphy The Ets transcription factor ERM is Th1-specific and induced by IL-12 through a Stat4-dependent pathway PNAS, March 30, 1999; 96(7): 3888 - 3893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.A. FLAVELL, B. LI, C. DONG, H.-T. LU, D. D. YANG, H. ENSLEN, C. TOURNIER, A. WHITMARSH, M. WYSK, D. CONZE, et al. Molecular Basis of T-cell Differentiation Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 563 - 572. [Abstract] [PDF]
|
|
|
|
|
|
K.M. MURPHY, W. OUYANG, S. RANGANATH, and T.L. MURPHY Bi-stable Transcriptional Circuitry and GATA-3 Auto-activation in Th2 Commitment Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 585 - 588. [Abstract] [PDF]
|
|
|
|
|
|
N. ARAI, H.J. LEE, I. FERBER, H. KURATA, and A. O'GARRA Multiple Levels of Regulation of Th2 Cytokine Gene Expression Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 589 - 598. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
probe (8) was used to show uniformity of nuclear extract.
