| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Institut National de la Santé et de la Recherche Médicale U430, and Université Pierre et Marie Curie, Hopital Broussais, Paris, France; and
Institute of Cell Biology, National Research Council, Rome, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several experimental and human autoimmune diseases are associated with altered regulation of cell proliferation or apoptosis (15, 16, 17, 18, 19, 20). In this study, we report that IVIg induces cell death in human monocytic and lymphoblastoid cell lines and CD40-activated normal human B lymphocytes in vitro, and that the cell death is associated with nucleosomal cleavage of cellular DNA and the expression of phosphatidylserines on the cell surface, an early event of apoptosis occurring before membrane disruption (21). We demonstrate that IVIg-induced apoptosis of lymphocytes is dependent on Fas and on activation of the caspase family of proteases. We further show the presence of anti-Fas Abs in IVIg that can efficiently induce apoptosis upon affinity purification. Taken together, these observations provide new insights into the mechanisms of action of IVIg in autoimmune diseases and suggest a role of normal circulating Ig in controlling cell proliferation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Intravenous Ig preparations were Gammagard (Baxter Hyland,
Glendale, CA) and Sandoglobulin (Novartis, Basel, Switzerland). When
reconstituted for therapeutic use, Gammagard contains 50 mg/ml IgG, 40
mg/ml glucose, 4 mg/ml polyethylene glycol, 0.6 M glycine, 6 mg/ml
human serum albumin, and 0.15 M NaCl (osmolality 655 mOsmol).
Sandoglobulin contains 50 mg/ml IgG, 25 to 35 mg/ml sucrose, 6 to 10
mg/ml glucose, and 40 to 100 mM NaCl (osmolality 515 mOsmol). For the
present study, a stock solution of 100 mg/ml (0.6 mM) of either IVIg
was prepared in serum-free RPMI 1640 containing
L-glutamine, 50 U/ml penicillin, and 50 µg/ml
streptomycin. IVIg was dialyzed twice against large volumes of
serum-free RPMI 1640 at 4°C before use in MTT assay (Fig. 1
). F(ab')2 of IVIg were
prepared by pepsin digestion and chromatography on protein G-Sepharose
(Pharmacia, Uppsala, Sweden), and stock solutions (0.6 mM) were made in
serum-free RPMI 1640 medium. The human IgG1
myeloma Prez. was
obtained and purified as described (22).
|
The DX2 IgG1 murine anti-Fas mAb was kindly provided by Dr. Testi (University of Rome "Tor Vergata," Italy). Anti-Fas Ab CH-11 (IgM) was purchased from Upstate Biotechnology (Lake Placid, NY). FITC-conjugated mAbs to CD3, CD14, and CD19, and phycoerythrin-conjugated mAb to CD95 (7C11) were purchased from Immunotech (Marseilles, France). Anti-CD40 Ab was obtained from PharMingen (San Diego, CA). Polyclonal rabbit Abs to Fas, FasN18, and FasC20 were from Santa Cruz Biotechnology (Santa Cruz, CA). FasN18 is specific for an epitope of Fas corresponding to amino acids 21 to 38 mapped to the amino terminus of Fas, and FasC20 recognizes an epitope mapped to amino acids 316 to 335 at the carboxyl terminus of the molecule. GST-specific Ab was from Pharmacia. mAb C-2-10 directed against poly(A)DP-ribose polymerase (PARP) was obtained from Dr. Poirier (University of Laval, Ste-Foy, Canada). Human serum albumin was obtained from Laboratoire Français des Biotechnologies (LFB, les Ulis, France).
The peptide inhibitors of ICE, Ace-YVAD-cho, and of Yama, Ace-DEVD-cho, were obtained from Neosystem Laboratories (Strasbourg, France). The peptides were dissolved in serum-free RPMI 1640 to a final concentration of 20 mM. Leupeptin and the calpain inhibitor E64 were from Sigma (St. Louis, MO).
Soluble Fas molecules
The DAP.3 and DAP.3 Fas-soluble variant-transfected cells were grown in DMEM containing 10% FCS (23). Supernatants containing Fas-soluble proteins were produced and assayed by an ELISA, as previously described (23).
GST fusion proteins
The cDNA sequences encoding the extracytoplasmic and intracytoplasmic regions of human Fas were cloned into the EcoRI and XhoI sites of pGEX-4T-1 in frame with the open reading frame of GST and expressed in BL21 by induction with 0.1 mM isopropyl-ß-D-thiogalactopyranoside for 4 h at 37°C. GST fusion proteins were purified from bacterial lysates with glutathione-Sepharose 4B, according to the manufacturer’s instructions (Pharmacia).
Immunoaffinity purification of anti-Fas Abs from IVIg
Purified human extracytoplasmic Fas-GST fusion protein was coupled to CNBr-activated Sepharose 4B (Pharmacia). A total of 50 mg of IVIg was allowed to interact with 1 ml of affinity gel in PBS, pH 7.4, on a rocking platform overnight at 4°C. After extensive washing, bound IgG was eluted using 0.2 M glycine-HCl, pH 2.8. Eluted fractions were immediately brought to pH 7 with 2 M Tris and dialyzed against PBS and once against serum-free RPMI 1640.
Cell lines and transfectants
The human T cell line CEM, B lymphoblastoid line Raji, and the promonocytic cell line MM6 were maintained in RPMI 1640 supplemented with 1% L-glutamine, 50 U/ml penicillin, 50 mg/ml streptomycin, and 10% FCS (HyClone). The Fas-sensitive human T cell lymphoma line HuT78 and the Fas-resistant subclone HuT78.B1 (24) were maintained in RPMI 1640 medium supplemented with 5% FCS.
The Fas BW transfectant cell lines were established by using the tetracycline-controlled transactivator (tTA) system (25). The pUHD15-1 neo and the pUHD10-3 (26) plasmids were provided by Dr. Bujard (Heidelberg, Germany). The full-length coding region of the human Fas cDNA with a point mutation, Val/Asn238, in the intracellular domain (F3) with the addition of a FLAG (F) epitope tag at the N terminus was cloned into the XbaI site of pUHD10-3 vector (pUHFF3). Such mutation is analogous to an identified mutant allele of Fas in the cg strain of lpr autoimmune mice, which is deficient in Fas-mediated induction of apoptosis (27). The FF3 cDNA was produced by PCR with the following primers: HFas5' (GGCGATCTAGAATGCTGGGCATCTGGACCCT; the XbaI site is underlined) and GR91 (CTTGTCATCGTCGTCCTTGTAGTCTTTGGACGATAATCTAGC; the sequence coding for the Flag peptide is underlined); GR108 (AAAGACTACAAGGACGACGATGACAAGAGTGTTAATGCCCAAGTG; the sequence coding for the Flag peptide is underlined) and HFasRev (GGCGATCTAGACCAAGCTTTGGATTTC; the XbaI site is underlined) using pcDNA3FP1 plasmid as template. pcDNA3FP1 was also constructed by PCR essentially as previously described (27). Plasmid pUHD15-1 neo linearized with ScaI (5 µg) was transfected by electroporation. Clones were selected in the presence of 800 µg/ml of active G418 (Geneticin; Life Technologies) and tested for their ability to induce, in transient transfection experiments with the pUHG16-3 plasmid (26) tetracycline-regulated expression of ß-galactosidase. One such clone, BWtTA, was selected as recipient for the pUHFF3. A linearized pUHFF3 plasmid (5 µg) was transfected together with the pBABEPuro vector (0.3 µg) (28) into BwtTA. Clones were selected against puromycin and in the presence of tetracycline. However, we were unable to isolate clones with tetracycline-inducible expression of FF3. A clone that constitutively expressed high levels of Fas protein, as assessed by cytofluorometry using the DX2 anti-Fas Ab, was selected and used in all experiments. The cells were maintained in RPMI 1640 with the addition of nonessential amino acids, sodium pyruvate, and 0.1 mM ß-mercaptoethanol.
B cell preparations
Normal B cells were purified from tonsils, as described previously (29). T cells were eliminated by rosetting with SRBC. Purified B cell preparations contained >90% B cells and <7% T cells and monocytes, as determined by cytofluorometry using fluorochrome-conjugated anti-CD19, anti-CD3, and anti-CD14 mAbs. Ligation of B cells with CD40 was conducted by incubating the cells with soluble anti-CD40 mAb (1 µg/ml) for 18 h under culture conditions, as described above.
Assays for apoptosis
To perform the MTT assay (colorimetric cell viability assay based on conversion of tetrazolium salts to formazan crystals by mitochondrial enzymes), target cells that had been cultured in the presence of inducers of apoptosis were interacted with the MTT reagent (Boehringer Mannheim, Mannheim, Germany) before extraction using an SDS/HCl solution. Absorbance was recorded at 490 to 650 nm using an ELISA reader, and values normalized by subtracting the background corresponding to samples in the absence of cells. The viability data were expressed as percentage of control cells cultured in the absence of apoptosis-inducing agents.
For measuring propidium iodide (PI) uptake, cells that had been cultured in the presence of apoptosis-inducing agents in RPMI 1640 containing 10% FCS were harvested by centrifugation at 750 x g, washed in ice-cold PBS before resuspending the pellet in PBS containing 0.02% sodium azide (PBS-azide). PI (50 µg/ml) was then added, and the dye uptake was analyzed by fluorescence analysis for red fluorescence (30).
Analysis of DNA fragmentation was performed following extraction of DNA and agarose gel electrophoresis, as described (31). In brief, cells were harvested by centrifugation, washed with PBS, and lysed in lysis buffer containing 20 mM Tris, pH 7.4, 0.4 mM EDTA, and 0.4% Triton X-100 (500 µl/2 x 106 cells). Solubilized cells were centrifuged at 10,000 x g for 5 min. DNA fragments in the supernatants were precipitated overnight with 0.5 M NaCl and an equal volume of isopropanol at -70°C. Samples were thawed, centrifuged at 10,000 x g, and washed with 70% ethanol. Dried pellets were resuspended in 10 to 20 µl of 1x TE (10 mM Tris.HCl, pH 7.4, and 1 mM EDTA) containing 0.1 mg/ml RNase and incubated at 37°C for 30 min. DNA samples from equivalent number of cells were then electrophoresed with an appropriate volume of 10x loading buffer (50% glycerol, 10% bromophenol blue, and 1% xyalene cyanol in 1x TE) in 0.8% agarose minigels for 1 h before revelation with ethidium bromide.
Annexin V labeling was conducted by staining cells with Annexin V-FITC (Bender Medsystems, BioWhittaker, Gagny, France) (2.5 µg/ml) for 30 min on ice. As negative control, duplicate samples were incubated in staining buffer without CaCl2 instead containing 2 mM EGTA. Cells were washed with 1x PBS-azide with 2 mM CaCl2 (for negative control samples, PBS-azide with 2 mM EGTA was used) and resuspended in PBS-azide before adding PI (50 µg/ml) to each sample. Samples were analyzed for green fluorescence (Annexin V labeling) and for red fluorescence (PI uptake) using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA).
Surface biotinylation and immunoprecipitation of Fas
Biotinylation of surface proteins was conducted as described (32). Briefly, 107 cells were washed with PBS and resuspended in 1 ml PBS, pH 8.5. D-biotinyl-e-amido caproic acid N-hydroxysuccinimide ester (Boehringer Mannheim) was dissolved in DMSO and incubated with the cell suspension at 50 µg/ml final concentration. The reaction was terminated by the addition of 10 mM NH4Cl. Fifty milliliters of 50 mM Tris/HCl, pH 7.4, 25 mM KCl, 5 mM MgCl2, and 1 mM EGTA were added; the cells were centrifuged and lysed in 1 ml lysis buffer (50 mM Tris/HCl, pH 8, 150 mM NaCl, 1% Nonidet P-40, 1 mM PMSF, aprotinin (2 µg/ml), and leupeptin (2 µg/ml)) for 20 min on ice. A total of 5 µg of DX2 Ab or 100 µg of preadsorbed IVIg (obtained by incubating 4 x 106 cells BWtTA cells with 800 µg of IVIg in RPMI 1640 for 12 h at 37°C) was added to lysates (300–500 µg) and rotated for 90 min at 4°C. Beads were washed once in 1x lysis buffer, once in 0.1x lysis buffer, and in water. Immune complexes captured on beads were boiled in Laemmli’s buffer and loaded onto a reducing 10% SDS-PAGE gel. Immunoprecipitated biotinylated surface proteins were transferred to a Hybond nitrocellulose membrane, incubated with streptavidin horseradish peroxidase, and developed using ECL chemiluminescence system (Amersham, Arlington Heights, IL). GST-Fas fusion proteins were separated on a 10% SDS-PAGE, transferred to nitrocellulose membrane, and detected with N18 (0.5 µg/ml) and C20 (0.5 µg/ml) anti-Fas Abs (specific respectively for the extracytoplasmic and intracytoplasmic domains of Fas), preadsorbed IVIg (100 µg/ml), anti-GST Ab (1 µg/ml) (Pharmacia), followed by protein A-horseradish peroxidase and ECL (Amersham).
Western blot analysis for PARP
Cell extracts were analyzed on 8% SDS-PAGE, as described (33). Separated proteins were transferred onto nitrocellulose membranes, blocked for 1 h in PBS-MT (PBS with nonfat dried milk 5% and 0.1% Tween-20), and incubated overnight with anti-PARP mouse mAb C2-10. Membranes were washed with PBS-MT, incubated with secondary goat anti-mouse IgG (The Jackson Laboratory, Bar Harbor, ME) before detection using the ECL chemoluminescence system (Amersham).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cells of the promonocytic cell line MM6, the T cell line CEM, and
the B cell line Raji were cultured in RPMI 1640/10% FCS for 24 h
before the addition of IVIg at increasing concentrations and further
culturing the cells for 12 h. Viability of the cells was assessed
using the MTT assay. A dose- and time-dependent loss of viability was
observed in the presence of IVIg in all three cell lines tested (Fig. 1
and data not shown). In 12 h, there was a 50 to 60% reduction in
viability in all three cell types, following incubation with 50 mg/ml
of IVIg. No significant reduction in cell viability was observed with
equimolar amounts of human serum albumin or 50 mg/ml of control myeloma
protein (not shown). A similar loss of cell viability was observed with
IVIg of either of the two sources used (Sandoglobulin and Gammagard)
(not shown), and with IVIg that had been dialyzed against RPMI
1640 before incubation with the cells, ruling out a role for the
stabilizers in the IVIg preparations in induction of cell death (Fig. 1). The induction of cell death by IVIg was further documented by
measuring the uptake of PI by the cells, followed by FACS analysis
(Fig. 2). Cell death was detected within
6 h of IVIg treatment. Of the three lines tested, CEM T cells were
most sensitive to IVIg-mediated cell death. F(ab')2
fragments of IVIg induced between 35 and 50% mortality in the cell
lines under conditions in which equimolar amounts of intact IVIg
induced more than 70% cell death (Fig. 2). Human serum albumin and
myeloma protein did not induce significant loss of cell viability.
|
IVIg-induced cell death was associated with characteristic DNA
ladder formation in the three cell lines that we tested (Fig. 3). DNA fragmentation was due to
oligonucleosomal cleavage, as evidenced by the appearance of DNA
fragments of approximately 200 bases and its multiples. DNA
fragmentation upon activation of endonucleases is known to be
associated with apoptosis. Kinetics of induction of DNA fragmentation
differed with the cell line and correlated with the kinetics observed
by dye uptake analysis (data not shown). DNA fragmentation was
detectable, within 4 h in CEM cells (not shown), 24 h in MM6
cells, and 36 h in Raji cells, of IVIg treatment.
|
depicts the double staining with
annexin V-FITC and PI of cells that had been cultured in the presence
of 50 mg/ml IVIg for 12 h. All three cell lines tested
demonstrated two major population of cells: one that contained
dye-negative/annexin V-positive (early apoptosis) cells, which
represented 39% of MM6 cells, 8% of Raji cells, and 17.5% of CEM
cells; another that contained double-positive (late apoptosis or
necrosis) cells, which represented 11% of MM6 cells, 17% of Raji
cells, and 61% of CEM cells. The kinetics of apoptosis differed with
the cell type, and the relative proportion of dye-negative/annexin
V-positive cells varied with the duration of IVIg treatment. The
kinetics of annexin V labeling indicated that cells are progressing
through dye-negative/annexin V-positive (early apoptosis) to
double-positive (late apoptosis or necrosis) status (data not shown).
We thus interpret that the double-positive cells in Figure 4 correspond
to late apoptotic and not to necrotic cells, since these cells, after
prolonged IVIg treatment, displayed characteristic DNA ladder
formation, as exemplified in Figure 3.
|
Cytokines of the TNF ligand family and their cognate receptors
such as TNFR-1 and Fas (also known as APO-1 or CD95) trigger apoptosis
(35, 36). Fas is constitutively expressed on a variety of tumor cell
lines of hemopoietic and nonhemopoietic origin (35). Fas cross-linking
induced by its natural ligand or by agonistic Abs induces apoptosis of
Fas-positive cells (37, 38, 39, 40, 41). Thus, we investigated the possibility that
Fas was at least partially responsible for the apoptosis observed upon
IVIg treatment by using two experimental approaches. First,
Fas-sensitive and Fas-resistant cell lines were treated with IVIg, and
cell death was evaluated. HuT78 is a human T cell lymphoma line, highly
sensitive to Fas-mediated apoptosis, while the HuT78.B1 cells are
resistant to Fas-mediated apoptosis due to the expression of a
wild-type and a truncated Fas receptor (24). We observed a
dose-dependent induction of apoptosis of HuT78 cells upon treatment
with IVIg for 16 h, as measured by means of PI uptake and by using
the MTT assay (Fig. 5 and data not
shown). The extent of apoptosis in HuT78 cells was lower than that
observed in the established lines described above, when PI uptake,
rather than the MTT assay, was used to assess the mortality. Using both
of the approaches, we observed that IVIg-mediated apoptosis in
Fas-resistant HuT78.B1 cells was significantly lower than that in the
parental Fas-sensitive HuT78 cells (Fig. 5A and data not
shown). As a second approach, soluble Fas molecules that block
Fas-mediated apoptosis induced by Fas agonistic Ab and Fas ligand
recombinant protein (23) were used along with IVIg, and the outcome on
apoptosis was studied. Supernatants containing Fas molecules were
obtained from cultures of DAP.3 fibroblast clones transfected with
expression vectors encoding soluble Fas molecules (Fas
Exo3, 4 and
FasExo4). Negative control supernatants were harvested from DAP.3
fibroblast clones transfected with the vector alone. CEM cells were
cultured in the presence of IVIg (50 mg/ml) and different dilutions of
the supernatants in RPMI 1640 for 6 h. Cell death was measured by
PI uptake. Soluble Fas molecules inhibited up to 50%, of IVIg-mediated
apoptosis, as compared with negative controls, providing further
evidence for involvement of Fas in IVIg-induced cell death (Fig. 5).
|
To investigate the presence of Abs with Fas specificity in IVIg,
we used a Fas transfectant mouse BW cell line that overexpresses the
human Fas molecule. Stable transfectants were generated in the BW
murine T cell line, using a cDNA of Fas with a point lpr
mutation in the cytoplasmic tail, as detailed in Materials and
Methods. Clone BWtTAFF3 that expressed high levels of surface Fas
Ag was selected for further analysis (Fig. 6A). BWtTAFF3 and parental
BWtTA cells were surface biotinylated and subjected to
immunoprecipitation with Fas mAb, DX2, or IVIg. Both sources of Ig
immunoprecipitated a unique 48-kDa protein band (Fig. 6B,
lanes 2 and 4) that was not detected in parental
BWtTA cells (Fig. 6B, lanes 1 and 3).
We then immunoblotted recombinant Fas-GST fusion proteins using IVIg
that had been preadsorbed with BWtTA cells. As shown in Figure 7, IVIg recognized both Fas
extracytoplasmic and Fas intracytoplasmic GST fusion proteins (Fig. 7A; lanes 1 and 2), but not GST-Jun or
GST control proteins (Fig. 7A; lanes 3 and
4). Anti-Fas mAbs N18 and C20 blotted the extra- and
intracytoplasmic Fas-GST proteins, respectively (Fig. 7B,
lane 1, and Fig. 7C, lane 2). No
reactivity of the latter Abs was observed toward GST-Jun or GST (Fig. 7, B and C, lanes 3 and 4),
while the proteins were detected using a GST-specific Ab (Fig. 7D). Taken together, these results demonstrate that
Fas-reactive Abs are present in IVIg.
|
|
). MTT assays consistently indicated
more than 90% mortality after 12-h treatment with affinity-purified
anti-Fas preparations (380 µg/ml). Anti-Fas mAb CH-11 induced
apoptosis to a similar extent when used at a concentration of 50 ng/ml.
The difference in the ability of IgM CH-11 and IgG affinity purified
from IVIg to induce apoptosis may reflect differences in the avidity of
binding to membrane Fas of the two types of Abs (42). Dye uptake
assays, on the other hand, displayed about 50% mortality of CEM T
cells with both affinity-purified anti-Fas from IVIg and CH-11 mAb
(Fig. 8). In a separate set of experiments, we observed that
affinity-purified anti-Fas Abs induced a threefold higher extent of
apoptosis in Fas-sensitive HuT78 cells, as compared with the HuT78.B1
Fas-resistant cells (not shown). The difference in apoptosis observed
in Fas-sensitive and resistant cells was higher when affinity-purified
anti-Fas Abs were tested than we previously observed with
unfractionated IVIg (Fig. 5).
|
The capacity of IVIg and affinity-purified anti-Fas Abs from
IVIg to induce apoptosis of normal, nontransformed cells was then
examined. Ligation of CD40 is known to induce the expression of Fas on
B lymphocytes and facilitate apoptosis through the Fas pathway (29).
Purified human tonsillar B cells were incubated with anti-CD40 mAb
for 18 h, which resulted in a dose-dependent up-regulation of Fas
expression, as demonstrated by staining of B cells with
phycoerythrin-labeled anti-Fas mAb 7C11 (not shown). Further
incubation of the CD40-activated cells with IVIg resulted in induction
of apoptosis in a dose-dependent manner, as assessed by the uptake of
PI (Fig. 9).
At 45 mg/ml, IVIg induced apoptosis in both resting and CD40-activated
cells. The extent of apoptosis was twofold higher in CD40-activated
cells when a concentration of 22 mg/ml of IVIg was used.
Affinity-purified anti-Fas Abs from IVIg consistently induced
increased apoptosis in activated cells expressing Fas, as compared with
resting B cells. Incubation of activated cells with control
anti-Fas mAb CH-11 also resulted in apoptosis. The overall extent
of apoptosis of resting and activated cells was significantly lower
than that observed with transformed cells.
|
Activation of caspases, a family of cysteine proteases, is an
important event in the execution phase of apoptosis. Apoptosis induced
by a variety of agents could be blocked by inhibiting the caspase
activity (43, 44, 45). To assess the possible role of cysteine proteases in
IVIg-mediated apoptosis, CEM T cells (1.25 x 105
cells/well) were pretreated with inhibitors of the proteases for 3
h before culture with IVIg (50 mg/ml; 0.3 mM) for 6 h. Cell death
was assessed by measuring PI uptake. The peptide inhibitors for caspase
1 (ICE) and for caspase 3 (CPP32ß/Yama), YVAD, and DEVD,
respectively, inhibited IVIg-induced apoptosis (Fig. 10). At optimal
concentrations, the inhibition observed with the tetrapeptide DEVD was
35%, and that observed with YVAD was 25%. A combination of YVAD and
DEVD resulted in inhibition similar to that observed with DEVD alone
(data not shown). The control peptides, leupeptin and calpain inhibitor
E64(d), failed to inhibit IVIg-dependent apoptosis of CEM cells. These
data indicate that activation of the caspase family of proteases is, at
least in part, associated with IVIg-induced apoptosis. Since caspase 3
has been involved in Fas-mediated as well in other apoptotic process
(43, 45, 46, 47), we further tested the fate of PARP, a key substrate of
caspase 3, in IVIg-treated CEM T cells. CEM cells were treated with
IVIg for up to 24 h. Whole cell extracts were then obtained,
subjected to electrophoresis, and immunoblotted with the anti-PARP
Ab C2-10. The cleavage of PARP into an 85-kDa signature death fragment
was evident within 6 h in IVIg-treated cells, and its amount
progressively increased during the following 24 h. No such
cleavage was observed in control cells that had been incubated in the
presence of medium alone (Fig. 10B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Involvement of Fas in IVIg-induced cell death was obtained by two approaches. The Fas-sensitive HuT78, a human T lymphoblastic cell line, was compared for its sensitivity to IVIg-mediated apoptosis with that of a Fas apoptosis-resistant variant, HuT78.B1. HuT78.B1 contains a wild-type and a truncated Fas receptor (24). In addition, these cells are defective in eliciting some early signal-transduction events upon Fas cross-linking, such as activation of the acidic sphingomyelinase (48). Our results indicate that the variant cells were resistant to IVIg-mediated apoptosis. This, together with the observation that IVIg-mediated apoptosis is inhibited in the presence of soluble Fas molecules, provided strong evidence for the interaction between IVIg and Fas. Taken together, these experiments suggest that the presence of anti-Fas molecules in IVIg is important for apoptosis. In addition, IVIg specifically immunoprecipitated a 48-kDa protein species from Fas-transfected cells and not from nontransfected parental cells. On Western blots, IVIg preparations specifically recognized Fas-GST fusion proteins and not GST alone. It is interesting that reactivity toward both the extracytoplasmic and intracytoplasmic regions of the Fas receptor was detected. A Fas-splicing variant coding for a secreted protein lacking the transmembrane domain, but identical to the membrane-bound receptor in both the extracytoplasmic and intracytoplasmic regions, has been described (49, 50). Thus, Abs in IVIg may recognize both wild-type and soluble forms of molecule. These data together provided a molecular basis implicating Fas in IVIg-induced cytotoxic effect. A conclusive evidence for the role of Fas in IVIg-induced apoptosis came from the fact that affinity-purified anti-Fas Abs from IVIg pool efficiently induced apoptosis of CEM cells and HuT78 cells. IVIg also induced apoptosis in normal, nontransformed tonsillar B cells. While unfractionated IVIg induced apoptosis in both resting and CD40-activated cells to a similar extent, affinity-purified anti-Fas Abs from IVIg consistently induced increased apoptotic cell death in activated cells with induced surface expression of Fas as compared with resting B cells. The apparent discrepancy between the almost similar capacity of unfractionated IVIg to induce apoptosis in CD40-stimulated and unstimulated B cells and the selective ability of anti-Fas Abs to induce apoptosis of CD40-activated cells, supports the involvement of several pathways in addition to the Fas pathway, in IVIg-mediated cell death. The overall extent of apoptosis of resting and activated B cells was significantly lower than that observed with transformed cells. These findings are consistent with the observations that the transformed cells are more sensitive to apoptosis (51, 52).
Although our experiments clearly pointed out a role for Fas in
IVIg-induced cell death, the fact that variant HuT78.B1 cells with
mutant Fas underwent apoptosis, albeit to a lesser extent, indicates
the involvement of additional apoptotic pathways. This is consistent
with the observation that soluble Fas molecules partially inhibited,
approximately 50%, IVIg-induced cell death. Moreover, apoptosis
occurred in the presence of F(ab')2 fragments of IVIg to a
lesser extent than that of intact IVIg, indicating either the
involvement of Fc
receptors on target cells, or a partial loss of Ab
activity upon enzymatic digestion of IgG and purification of
F(ab')2 fragments. The indication that multiple apoptotic
pathways may be activated upon IVIg treatment prompted us to test
downstream signal-transduction events. Experiments to assess the role
of caspase family members indicated a modest inhibition of apoptosis in
the presence of peptide inhibitors for caspase 1 (Ac-YVAD-CHO) and
caspase 3 (Ac-DEVD-CHO). Inhibition observed was more pronounced with
DEVD, indicating a more critical requirement for caspase 3 or a closely
related caspase. However, the inhibition observed was only partial, and
apoptosis still occurred in the presence of caspase inhibitors. This
would indicate the involvement of other members of caspases and a
possible redundancy in their action, and is consistent with the
suggestion that multiple members of caspases might be activated,
perhaps as a cascade of events (53, 54, 55). It is clear that IVIg actively
induces apoptosis in lymphoid cells and through activation of
classical apoptotic signaling pathways. On the other hand, our data
rule out any role for calpain protease in IVIg apoptosis. The calpain
inhibitor, E64(d), in fact, sensitized the cells for IVIg apoptosis.
Several mechanisms of action have been proposed to explain the immunomodulatory properties of IVIg in autoimmune and inflammatory diseases (56). These include reversible functional blockade of FcR on phagocytic cells (57), modulation of B and T cell functions through interactions of IVIg with FcR on lymphocytes (58), inhibition of the binding of complement components to cellular targets of complement activation (59), modulation of the synthesis and release of cytokines by lymphocytes and monocytes (7), and interaction with several surface molecules of immunocompetent cells (2). Induction of apoptosis by IVIg is of interest in the context of the beneficial effects of IVIg in the treatment of several autoimmune diseases and lymphoproliferative disorders. Apoptosis plays an important role in selection of lymphocyte repertoires, and defective apoptosis is associated with the pathogenesis of several autoimmune diseases (60, 61, 62, 63, 64).
It has been proposed that too little apoptosis would lead to persistence of autoreactive cells, resulting in the production of autoantibodies and subsequently autoimmune conditions (65). The importance of Fas/APO-1-mediated apoptosis in various immune disorders and lymphoproliferative disorders is well documented. MRL mice homozygous for lpr (lymphoproliferation) or gld (generalized lymphoproliferative disease) develop a systemic autoimmune disease resembling systemic lupus erythematosus, Sjögren’s disease, and rheumatoid arthritis (66). Defective apoptosis has been implicated in the pathogenesis of several conditions in which IVIg treatment has proven beneficial (2, 3, 65, 67, 68). The presence of anti-Fas molecules in IVIg may be significant in interfering with the pathogenic processes involved in certain autoimmune diseases and lymphoproliferative disorders. These functionally active anti-Fas molecules may induce apoptosis in activated self-reactive T and B cell clones that express Fas on their cell surface. Furthermore, IVIg has also been used in the treatment of clinical stage III and IV chronic lymphocytic leukemia associated with autoimmune hemolytic anemia or immune thrombocytopenic purpura, in which a decrease in total lymphocyte counts was observed (69, 70). The persistent lowering of the lymphocyte count was associated with diminution in the size of the lymph nodes and the spleen. The plasma concentration of IgG reached in a recipient of IVIg is in the range of 20 to 35 mg/ml, that is within the range of concentrations that were used in in vitro experiments reported in this work.
Recent evidence indicates that in autoimmune thyroiditis, thyrocytes that constitutively express Fas ligand were apoptosed upon induction of Fas expression by disease-associated local production of IL-1 (71). These findings suggest that some of the autoimmune conditions may be associated with increased apoptosis of target tissue cells in an indirect fashion mediated by altered functioning of immune system. In such circumstances, reported beneficial effects of IVIg could be explained by its observed effects on the modification of production of cytokines and/or the existence of functionally active molecules against several cell surface Ags. Thus, normal serum and pooled normal human IgG have been shown to contain autoantibody activity against a number of molecules involved in the regulation of the immune response, such as idiotypic determinants of Ig (72, 73), determinants of TCR (74), CD4 (75), CD5 (76), HLA class I (12), ß2-microglobulin (77), and the RGD motif (78). Such natural autoantibodies are found in newborns in cord blood IgM in mice and humans, probably being positively selected by self ligands rather than resulting from cross-reactive responses to nonself determinants (79).
Information from this study provides valuable and novel insights into mechanisms of action of IVIg in autoimmune, inflammatory, and lymphoproliferative disorders. The observation that IVIg induces apoptosis in human lymphocytes and monocytes with varied degree of effectiveness might be important in view of the beneficial effects observed with IVIg therapy in a broad spectrum of autoimmune disorders. IVIg may in fact render autoreactive T cells of the patients more sensitive to apoptosis. This may be followed by deletion of these cells apparently through classical apoptotic pathways. The signal-transduction events in response to IVIg at the molecular level, although unclear at present, provide a plausible working hypothesis to further elucidate the mechanisms underlying the immunoregulatory effects of IVIg. In addition, our results suggest that normal Igs participate in the selection of immune repertoires.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 The first two authors have contributed equally to this work.
3 Current address: Department of Hematology-Oncology, Istituto Superiore di Sanità, Rome, Italy.
4 Current address: UCSF Cancer Center, 2340 Sutter St., San Francisco, CA 94115.
5 Address correspondence and reprint requests to Dr. Giovina Ruberti, Institute of Cell Biology, National Research Council, Via E. Ramarini 32, 00016 Monterotondo Scalo (Rome), Italy. E-mail address: , or Dr. Srini V. Kaveri, INSERM U430, Hopital Broussais, 96 rue Didot, 75014 Paris, France. E-mail address:
6 Abbreviations used in this paper: IVIg, i.v. IgG; ECL, enhanced chemiluminescence; GST, glutathione-S-transferase; ICE, IL-1ß-converting enzyme; MTT, 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PARP, poly(A)DP-ribose polymerase; tTA, tetracycline-controlled transactivator.
Received for publication October 16, 1997. Accepted for publication June 2, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and interleukin-1 production. Immunology 72:497.[Medline]
ß T cells induced by superantigen. Scand. J. Immunol. 43:277.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. Kessel, H. Ammuri, R. Peri, E. R. Pavlotzky, M. Blank, Y. Shoenfeld, and E. Toubi Intravenous Immunoglobulin Therapy Affects T Regulatory Cells by Increasing Their Suppressive Function J. Immunol., October 15, 2007; 179(8): 5571 - 5575. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Blank, L. Anafi, G. Zandman-Goddard, I. Krause, S. Goldman, E. Shalev, R. Cervera, J. Font, M. Fridkin, H.-J. Thiesen, et al. The efficacy of specific IVIG anti-idiotypic antibodies in antiphospholipid syndrome (APS): trophoblast invasiveness and APS animal model Int. Immunol., July 1, 2007; 19(7): 857 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. von Gunten, A. Schaub, M. Vogel, B. M. Stadler, S. Miescher, and H.-U. Simon Immunologic and functional evidence for anti-Siglec-9 autoantibodies in intravenous immunoglobulin preparations Blood, December 15, 2006; 108(13): 4255 - 4259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Arredondo, A. I. Chernyavsky, A. Karaouni, and S. A. Grando Novel Mechanisms of Target Cell Death and Survival and of Therapeutic Action of IVIg in Pemphigus Am. J. Pathol., December 1, 2005; 167(6): 1531 - 1544. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shioji, Z. Yuan, T. Kita, and C. Kishimoto Immunoglobulin treatment suppressed adoptively transferred autoimmune myocarditis in severe combined immunodeficient mice Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2619 - H2625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Triolo, A Ferrante, A Accardo-Palumbo, F Ciccia, M Cadelo, A Castelli, A Perino, and G Licata IVIG in APS pregnancy Lupus, September 1, 2004; 13(9): 731 - 735. [Abstract] [PDF]
|
|
|
|
|
|
A. R. Crow, S. Song, J. Freedman, C. D. Helgason, R. K. Humphries, K. A. Siminovitch, and A. H. Lazarus IVIg-mediated amelioration of murine ITP via Fc{gamma}RIIB is independent of SHIP1, SHP-1, and Btk activity Blood, July 15, 2003; 102(2): 558 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. de Grandmont, C. Racine, A. Roy, R. Lemieux, and S. Neron Intravenous immunoglobulins induce the in vitro differentiation of human B lymphocytes and the secretion of IgG Blood, April 15, 2003; 101(8): 3065 - 3073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bayry, S. Lacroix-Desmazes, C. Carbonneil, N. Misra, V. Donkova, A. Pashov, A. Chevailler, L. Mouthon, B. Weill, P. Bruneval, et al. Inhibition of maturation and function of dendritic cells by intravenous immunoglobulin Blood, January 15, 2003; 101(2): 758 - 765. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Dalakas Mechanisms of action of IVIg and therapeutic considerations in the treatment of acute and chronic demyelinating neuropathies Neurology, December 24, 2002; 59(90126): S13 - 21. [Abstract] [Full Text]
|
|
|
|
|
|
A. Mouzaki, M. Theodoropoulou, I. Gianakopoulos, V. Vlaha, M.-C. Kyrtsonis, and A. Maniatis Expression patterns of Th1 and Th2 cytokine genes in childhood idiopathic thrombocytopenic purpura (ITP) at presentation and their modulation by intravenous immunoglobulin G (IVIg) treatment: their role in prognosis Blood, August 13, 2002; 100(5): 1774 - 1779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. MARCHALONIS, S. KAVERI, S. LACROIX-DESMAZES, and M. D. KAZATCHKINE Natural recognition repertoire and the evolutionary emergence of the combinatorial immune system FASEB J, June 1, 2002; 16(8): 842 - 848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. K. Bleeker, J. L. Teeling, and C. E. Hack Accelerated autoantibody clearance by intravenous immunoglobulin therapy: studies in experimental models to determine the magnitude and time course of the effect Blood, November 15, 2001; 98(10): 3136 - 3142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Kazatchkine and S. V. Kaveri Immunomodulation of Autoimmune and Inflammatory Diseases with Intravenous Immune Globulin N. Engl. J. Med., September 6, 2001; 345(10): 747 - 755. [Full Text] [PDF]
|
|
|
|
|
|
V Strand Monoclonal antibodies and other biologic therapies Lupus, March 1, 2001; 10(3): 216 - 221. [Abstract] [PDF]
|
|
|
|
|
|
A. Moreau, S. Lacroix-Desmazes, N. Stieltjes, E. Saenko, S. V. Kaveri, R. D'Oiron, Y. Sultan, D. Scandella, and M. D. Kazatchkine Antibodies to the FVIII light chain that neutralize FVIII procoagulant activity are present in plasma of nonresponder patients with severe hemophilia A and in normal polyclonal human IgG Blood, June 1, 2000; 95(11): 3435 - 3441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Papoff, P. Hausler, A. Eramo, M. G. Pagano, G. Di Leve, A. Signore, and G. Ruberti Identification and Characterization of a Ligand-independent Oligomerization Domain in the Extracellular Region of the CD95 Death Receptor J. Biol. Chem., December 31, 1999; 274(53): 38241 - 38250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Vassilev, M. D. Kazatchkine, J.-P. D. Van Huyen, M. Mekrache, E. Bonnin, J. C. Mani, C. Lecroubier, D. Korinth, D. Baruch, F. Schriever, et al. Inhibition of Cell Adhesion by Antibodies to Arg-Gly-Asp (RGD) in Normal Immunoglobulin for Therapeutic Use (Intravenous Immunoglobulin, IVIg) Blood, June 1, 1999; 93(11): 3624 - 3631. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
