|
|
||||||||
II-A2 Light Chain CDR-3 Junctional Residues in Human Antibody Binding to the Haemophilus influenzae Type b Polysaccharide1
Childrens Hospital Oakland Research Institute, Oakland, CA 94609
| Abstract |
|---|
|
|
|---|
II-A2 V gene segment predominate the human Ab
repertoire to the Haemophilus influenzae b (Hib)
polysaccharide (PS). All A2 anti-Hib PS Abs sequenced to date
possess a 10-amino acid L chain complementarity-determining region-3
(CDR-3) having an insertional arginine (Arg) at position 95a, the V-J
junction. These findings suggest an essential requirement for this
conserved Arg residue in determining Hib PS-binding affinity. We
examined this requirement by performing chain recombination experiments
in which a series of A2 L chains, differing at position 95a, were
combined individually with an Fd region known to generate a Hib
PS-combining site when paired with an A2-Arg(95a)-J
1 V region. Hib
PS binding of the recombinant Fabs was evaluated quantitatively using a
radioantigen-binding assay. Fabs having A2 L chains with either Arg or
lysine in position 95a in combination with J
1 gave equivalent and
strongest binding to Hib PS. Fabs having A2-J
1 L chains with either
tyrosine, glycine, alanine, leucine, serine, or threonine in position
95a, or having an A2-Arg(95a)-J
3 L chain, gave intermediate binding.
Fabs having A2-J
1 L chains with glutamate or aspartate at 95a or
with no junctional residue showed little or no Hib PS binding. These
results demonstrate the importance of L chain junctional residue, as
well as J
usage and CDR-3 length, in determining Hib PS-binding
affinity. Contrary to expectation, an Arg junctional residue is not
essential for generating either high or intermediate affinity-binding
sites. | Introduction |
|---|
|
|
|---|
gene usually in association
with the DP-47 VH gene (7, 8, 9, 10, 11, 12, 13, 14, 15, 16). Ten A2
anti-Hib PS Abs derived either from hybridomas or serum have been
sequenced to date, and all contain a 10-amino acid L chain
complementarity-determining region 3 (CDR-3) having a nontemplated
insertional arginine (Arg) residue at position 95a (14).
Moreover, two Hib PS-specific Fab fragments isolated from a
combinatorial library use the A2 VL gene with this same
CDR-3 (17), and L chain libraries prepared from adult
peripheral blood following Hib PS vaccination similarly show a
preponderance of A2 L chains with this rearrangement (18)
(D. C. Reason and A. H. Lucas, unpublished observation).
Thus, this L chain CDR-3 configuration can be considered canonical for
A2 anti-Hib PS Abs. These findings, when taken with the observation
that even anti-Hib PS Abs using V
genes also have a 10-amino
acid CDR-3 with an insertional Arg (13, 14, 15), suggest a
crucial role for this residue in mediating Hib PS binding possibly by
ionic interaction with the negatively charged phosphate groups of the
Hib PS. Previous studies have demonstrated the critical importance of particular L chain CDR-3 junctional amino acid residues in Ag binding (19, 20, 21, 22, 23, 24), and therefore we and others have presumed that Hib PS Abs would show a similar stringency for an Arg residue in position 95a. We recently demonstrated that Hib PS-specific Fab fragments could be isolated from combinatorial libraries prepared from peripheral blood of vaccinated adults (17). Since this molecular expression system is well suited for performing mutagenesis and chain-shuffling experiments, it provides an opportunity to test the hypothesis that the presence of an insertional Arg residue at position 95a is essential for Hib PS binding.
In this study, we constructed a series of Fab fragments differing only
at position 95a of the L chain CDR-3 and evaluated these recombinants
for Hib PS-binding activity. In addition, the availability of two
naturally derived A2 L chains, one lacking an insertional residue and
having a 9-amino acid CDR and the other consisting of an A2
rearrangement with J
3 and having an insertional Arg, permitted us to
assess the role of CDR-3 length and J usage on Hib PS binding.
| Materials and Methods |
|---|
|
|
|---|
The SOL10 Fd region was isolated from a bacteriophage
combinatorial library prepared from peripheral blood of an Hib
PS-vaccinated adult as described previously (17). SOL10 Fd
(GenBank accession no. U41571) is encoded by the DP-47 gene segment, a
D region of nine bases and JH4b1. The pairing of the SOL10 Fd with an L
chain consisting of the A2-Arg95a-J
1 (GenBank accession no. U41569)
generates a Fab fragment that binds Hib PS. SOL10 Fd was used with
sequence-defined L chains to prepare a series of Fd-L recombinants (see
below).
The L chains used in these experiments originally were derived from an L chain library prepared from a Hib PS-vaccinated adult as described previously (17). In addition, an A2 L chain was isolated from a library prepared from the peripheral blood of a 6-month-old African-American female 7 days after receiving a second vaccination of Hib-TITER (Lederle Praxis Biologicals, Wayne, NJ).
Construction of Fabs
A2c L chains having either alanine, glycine, leucine, serine,
threonine, tyrosine, aspartate, or glutamate at position 95a were
constructed by mutagenesis using the method of unique site elimination
(25). The template plasmid contained an A2c-Arg(95a)-J
1
L chain and the ST10 Fd region. The mutagenic primer was
GCCGAACGTCCASNNAGGAAGCTGTATACT, and the selection primer was
CTGTGACTGGTGACGCGTCAACCAAGTC. The mutagenic primer randomizes bases
at the A2-J
1 junction. The selection primer eliminates a unique
ScaI site in the pComb 3H vector (26). Both
primers bind to the noncoding strand. Phosphorylated primers were
annealed to the template and extended with T4 polymerase for 1 h
followed by digestion with ScaI for 1 h. The resulting
mutated circular DNA was electroporated into Escherichia
coli NM522mutS repair-deficient cells. Plasmid DNA was prepared
from overnight cultures and 250 ng was digested with ScaI
for 4 h. Digested plasmid DNA (125 ng) was electroporated into
E. coli XL1-Blue cells. The L chain having a lysine residue
at the V-J junction was generated as described above, except
GCCGAACGTCCACTTAGGAAGCTGTATACTTGG was used as the mutagenic primer.
Reagents for mutagenesis and the selection primer were purchased from
Amersham Pharmacia Biotech (Piscataway, NJ).
The Fab constructs having the ST10 Fd region paired with either
the A2c-Arg95a-J
3 (designated RJ3) or the A2c-J
1 VL
not containing a junctional residue at position 95a (designated ø95a)
were prepared by ligating the restricted L chains into the pComb 3H
vector containing the ST10 Fd region, followed by electroporation into
XL1-Blue cells as described previously (17). The pComb 3H
vector developed by Barbas et al. (26) was kindly provided
to us by The Scripps Research Institute, La Jolla, CA.
Phagemid DNA was purified from log-phase bacterial cultures using Wizard Plus Miniprep Kits (Promega, Madison, WI) and sequenced using Sequenase 2.0 (United States Biochemical, Cleveland, OH). Either the entire V region or the mutagenized regions of the L chain inserts were sequenced using the VK2dr, A2CDR2, VK3a, and HK3' primers as described previously (17).
The pComb 3H phagemid vector permits expression of Fab fragments either on the surface of bacteriophage particles as a fusion product of the minor coat protein III with the C terminus of the Fd chain or as a soluble, secreted molecule devoid of cpIII (26). However, we have found that expression of Fab fragments in "soluble" form does not require removal of coat protein III from the C terminus of the Fd chain. In this study, Fab fragments, expressed as coat protein fusion products and present in the bacterial cytosol and periplasm, were used for analysis. Quantitative radioantigen-binding assay (RABA) analysis of Hib PS binding by Fab containing cpIII or lacking cpIII shows that both constructs give identical binding curves when normalized for Fab concentration using the ELISA described below (our unpublished observations).
Clonal bacterial lysates containing Fab fragments were used for Hib
PS-binding analyses. Small scale overnight cultures of bacterial clones
containing pComb 3H phagemids were used to inoculate
100 ml of SB
broth containing antibiotics (50 µg/ml carbenicillin, 10 µg/ml
tetracycline, and 20 mM magnesium chloride). Bacteria were cultured for
6 h at 37°C with shaking and then overnight at 30°C with
shaking in the presence of 1 mM isopropyl
B-D-thiogalactoside. Bacteria were harvested by
centrifugation and resuspended in PBS containing aprotinin (2 µg/ml),
leupeptin (1 µg/ml), Pefabloc (0.5 mg/ml) (Boehringer Mannheim,
Indianapolis, IN), and 0.1% sodium azide. The bacterial suspension was
subjected to three cycles of freezing and thawing. Bacteria and debris
were removed by centrifugation at 21,000 x g for 15
min. The supernatants were then spun for 1 h at 100,000 x
g and stored at 4°C.
Fab ELISA
Fab concentration was determined by ELISA. A sheep
polyclonal IgG fraction specific for human IgG Fd (The Binding Site,
San Diego, CA) was diluted 1:2000 in PBS and incubated in microtiter
wells overnight at room temperature. Wells were blocked with 1% BSA,
washed with PBS-0.1% Tween-20, and then dilutions of culture
supernatants or the Fab standard were added for 2 h at 37°C.
After washing with PBS-Tween, alkaline phosphatase-conjugated Ab
specific for human
-chain (BioSource International, Camarillo, CA)
was added for 2 h. Wells were washed, and
p-nitrophenylphosphate in ethanolamine buffer was added.
Absorbance at 405 nm was determined after the Fab standard gave linear
absorbance readings at concentrations ranging from 10 to 125 ng/ml. The
assay was calibrated with purified ST10 Fab using an E280
of 1.37 for a 1.0 mg/ml solution (17).
RABA
Fab Hib PS binding was analyzed using a previously described
RABA (27). Diluent consisted of PBS with 10% FCS. Fifty
microliters of 125I-Hib PS containing
300,000 cpm (sp.
act.,
45 µCi/µg) was mixed with 50 µl of diluted
Fab-containing culture supernatants or control Fab. The mixtures were
incubated for 2 h at 37°C and overnight at 4°C. A total of 100
µl of 25% (w/v) polyethylene glycol 8000 in 2% FCS-PBS was added,
and the mixtures were incubated for 6 h at 4°C. The precipitates
were harvested by centrifugation (16,000 x g), washed
once with 200 µl of 12.5% polyethylene glycol, and counted in a
dry-well gamma counter. To examine Fab binding under multivalent
conditions, purified goat anti-human
Abs (Biosource
International) at a final concentration of 5 µg/ml were included in
the mixture of Fab and [125I]Hib PS.
Hib RIA
Following overnight culture on chocolate agar, a few Hib
(strain Eagan) colonies were inoculated into 20 ml of 3.7% (w/v) brain
heart infusion broth (Difco, Detroit, MI) supplemented with hemin at 10
µg/ml and ß-nicotinamide dinucleotide at 10 µg/ml. The culture
was shaken at 250 rpm at 37°C until the OD at 600 nm reached 0.4 to
0.5 absorbance units. The bacteria were washed three times in ice-cold
PBS-1% BSA-0.1% sodium azide (PBS-BSA), and resuspended in PBS-BSA at
4 x 108/ml using an OD at 600 nm = 1.0 for a
suspension of 1 x 109 bacteria/ml. Fifty microliters
of Fabs, diluted in PBS-BSA, was added to Eppendorf tubes. Fifty
microliters of the Hib suspension was added and the tubes were
incubated on ice for 3 h with occasional mixing. The tubes were
spun at 3000 x g at 4°C, and the bacterial pellet
was washed one time in 250 µl of PBS-BSA. The pellets were
resuspended in 100 µl of 125I-goat anti-human
(Biosource International) labeled with chloramine-T to a specific
activity of
1.5 x 107 cpm/µg, and the tubes were
incubated for 3 h on ice with occasional mixing. The tubes were
spun and the bacterial pellets were washed two times in PBS-BSA. Bound
radioactivity was determined by counting tubes in a dry-well gamma
counter. All determinations were performed in duplicate.
| Results |
|---|
|
|
|---|
1. The L chain
CDR-3 is 10 amino acids in length and contains a nontemplated
insertional Arg residue at position 95a. The Fabs used in this study
were prepared by mutagenesis of this construct or by insertion of
naturally occurring L chains into pComb 3H containing SOL10 Fd (Table I
|
. Since capture requires the
Fd chain and detection requires the L chain, this assay measures intact
Fab molecules and avoids problems associated with unbalanced synthesis
that may occur in such clones. Hib PS reactivity was evaluated
quantitatively using a RABA in which the Fabs were either in the
monomeric state (Fig. 1
Ab in order to
increase avidity and thereby promote maximal Hib PS binding (Fig. 2
3. Both RJ1 and RJ3
configurations occur in vivo although the usage of J
1 is more common
than J
3 (14). The presence of either Gly or Thr at
position 95a of the A2 L chain also generated Fabs with detectable Hib
PS binding, but this binding was only apparent when the Fabs were
cross-linked by anti-
Ab. While the Glu Fab did have some
detectable reactivity with Hib PS when cross-linked with anti-
Ab, this binding was severely diminished since approximately 100-fold
higher Fab concentration was required to achieve 50% binding as
compared with the intermediate binding Fab group. Little or no Hib PS
binding was shown by the Fab having Asp residue at 95a. A CDR-3 of 10
amino acids in length appears essential for Hib PS reactivity in
A2-containing Fabs as shown by the complete lack of binding by Fab
ø95a, which has a VL region resulting from the
recombination of A2 with J
1 but which lacks an insertional residue
and has a CDR-3 of 9 amino acids in length.
|
|
|
|
| Discussion |
|---|
|
|
|---|
The suggested role for bond formation between the L chain CDR-3 Arg and Hib PS is similar to previous analyses with Abs to anionic Ags such as DNA and azophenylarsonate (Ars), which have shown that an Arg residue at position 96 of the L chain is critical for binding activity (19, 22, 23). The Arg side chain in Ars Abs bearing the major cross-reactive Id bonds with the oxygen of the arsonate moiety (30, 31) and is an essential determinant of binding as replacement of the Arg with other residues, including Lys abolishes Ars binding (20). Thus, Hib PS Fabs differ from anti-Ars Abs in that they can accommodate a variety of amino acids including aromatic and aliphatic residues in position 95a and still retain binding activity. Indeed, the binding affinities of these Fabs are equivalent to that of the RJ3 Fab, which represents an L chain CDR-3 configuration expressed in vivo. While the proposed ionic interaction between residue 95a and Hib PS can exert either favorable or unfavorable consequences to binding, the ability to form a salt bridge at 95a appears not to be essential for generating binding sites with intermediate binding affinities for Hib PS. This binding may result from the more extensive and/or distributed bonding network of a large antigenic determinant as compared with a small hapten.
Our findings are somewhat surprising in light of previous studies showing that all in vivo-derived A2 anti-Hib PS Abs, either obtained from hybridomas or serum, contain an Arg residue at position 95a (14, 15). The in vitro data using recombinant Fab fragments would suggest that A2 anti-Hib PS Abs having non-Arg insertional residues, particularly those having either Lys, Leu, or Tyr residues at position 95a, i.e., that have Hib PS-binding affinities greater than or equal to RJ3, should be capable of contributing to the functional repertoire. Why then are these configurations not expressed in vivo?
One possible explanation for this discrepancy between the natural
repertoire and the in vitro findings is that RABA assessments of Fab
affinity, which presumably represent equilibrium measurements, do not
sufficiently discern Ag-binding parameters such as on-rate that could
be important in B cell selection or activation (32).
Perhaps characteristics of the Arg side chain, such as larger size,
partial aromatic character, or propensity to engage in more extensive
hydrogen bonding, impart advantages not offered by Lys or other
residues. These properties could affect chain pairing or main chain
conformation and thereby favorably influence binding kinetics. However,
several observations indicate that the RABA values may reflect true
binding potential. First, the relative Fab ranking obtained under
monovalent binding conditions was preserved after cross-linking with
anti-
, a result indicating that the affinity differences
observed between Fab fragments would be preserved in bivalent Abs.
Second, the correlation between Fab Hib PS binding and the character of
the insertional side chain, e.g., positively charged side chains being
permissive and negatively charged side chains being nonpermissive,
suggests that the RABA is a reliable indicator of relevant bonding
interactions between the combining site and Ag. Third, Fab binding to
native Hib PS presented on the surface of Hib bacteria paralleled the
RABA results. Fourth, many of the Fabs differing at residue 95a gave
Hib PS binding equivalent to that of the RJ3, which represents a
configuration expressed in vivo and which can serve as a demarcation
for physiologically relevant binding activity. Therefore, we suspect
that explanations other than methodology may be required to explain the
discordance between the in vivo and in vitro findings.
Since Arg codons at position 95a of the A2 L chain cannot be accounted
for by direct utilization of germ-line bases present at the 5' and 3'
ends of the germ-line A2 and J
segments, respectively, they are
presumed to derive from nontemplated nucleotide additions occurring
during the process of V-J joining (33). If incorporation
of bases during joint assembly is equiprobable, then biases toward
certain amino acids should occur as a function of codon frequency.
Although both Arg and Lys residues at position 95a contribute to high
affinity binding, Arg insertionals would be favored over Lys since Arg
has 6 codons and Lys has 2 codons. However, this explanation cannot
account for the lack of expression in vivo of Abs with either Leu or
Ser at 95a. Fab fragments with these insertional residues have
intermediate affinity Hib PS-binding sites similar to the in
vivo-expressed A2-Arg95a-J
3 configuration and, like Arg, Ser, and
Leu have six codons each. Perhaps a more likely explanation of biases
in codon usage results from the propensity of TdT, the enzyme thought
to mediate N region addition, to prefer G/C nucleotides
(33). This process would favor Arg insertional residues as
four of six Arg codons are GCX.
Finally, the data presented here also implicate other L chain CDR-3
characteristics, in addition to junctional diversity, as determinants
of Hib PS binding. The 10- to 20-fold differences in binding between
the RJ1 and RJ3 Fabs suggest that J usage affects binding affinity.
However, this attribution is not precise since, in addition to the
amino acid differences resulting from J usage (positions 96 in the
CDR-3 as well as position 100 and 105 of framework 4), the RJ-3 Fab
also differs from RJ1 at one other residue in CDR-3, a conservative
replacement of Ser to Thr at position 92 that presumably resulted from
somatic mutation (see Table I
). Length of CDR-3 also appears to affect
Ag binding as shown by the absence of Hib PS binding by Fab ø95a. Fab
ø95a lacks an insertional residue, has a CDR-3 of 9 amino acids in
length, and represents the direct germ-line recombination of the A2 V
gene segment with J
1. Thus, an L chain CDR-3 of 10 amino acids in
length appears essential for generating Hib PS-binding sites using the
A2 V region. These results parallel those of Kabat and colleagues
(34, 35) in their studies of Abs to (
1-6)dextran.
Alterations in the length of L CDR-3 had a more profound effect on
binding than did amino acid substitutions resulting from usage of
different J
segments. They proposed that groove-type dextran-binding
sites may be sensitive to CDR-3 length, which in their model alters the
loop configuration of L chain CDR-3 and drastically affects the shape
of the combining site. A2 anti-Hib PS Abs have features resembling
groove-type sites. They contain short D segments and they presumably
react with antigenic determinants (phosphate residues) along the length
of the PS polymer.
In summary, the results presented here underscore the importance of L chain CDR-3 diversity in determining Hib PS-binding affinity. The challenge for future studies will be to broaden the in vivo data base to determine the extent to which polymorphisms in A2 L chain CDR-3 occur in vivo and how they might impact functionality of the repertoire. The Hib PS Ab repertoire of infants would be an appropriate subject for study as previous work has documented significant differences in avidity and protective function of A2 anti-Hib PS Abs elicited in infants following vaccination with different Hib PS protein conjugates (36).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alexander H. Lucas, Childrens Hospital Oakland Research Institute, 747 52nd Street, Oakland, CA 94609. ![]()
3 Abbreviations used in this paper: Hib, Haemophilus influenzae type b; PS, polysaccharide; RABA, radioantigen binding assay; CDR, complementarity-determining region; Ars, p-azophenylarsonate. ![]()
Received for publication March 17, 1998. Accepted for publication May 29, 1998.
| References |
|---|
|
|
|---|
(1,3) dextran. Cold Spring Harbor Symp. Quant. Biol. 41:743.
II gene and one of several J genes are joined by an invariant arginine to form the most common L chain V region. J. Immunol. 143:4110.[Abstract]
light chain variable region that predominates the vaccine-induced human antibody response to the Haemophilus influenzae b polysaccharide. J. Clin. Invest. 88:1811.
light chain-associated idiotype and the relation between idiotype expression, avidity, and vaccine formulation. J. Clin. Invest. 91:788.
and V
segments and VJ recombinations. J. Clin. Invest. 89:729.
-J
junctional change in an anti-digoxin recombinant antibody destroys digoxin-binding activity. J. Immunol. 145:2718.[Abstract]
region on antigen binding and idiotype expression by antibodies binding
(1-6) dextran. J. Immunol. 142:1235.[Abstract]
1-6) dextrans. J. Biol. Chem. 268:20584.This article has been cited by other articles:
![]() |
H. E. Baxendale and D. Goldblatt Correlation of Molecular Characteristics, Isotype, and In Vitro Functional Activity of Human Antipneumococcal Monoclonal Antibodies Infect. Immun., February 1, 2006; 74(2): 1025 - 1031. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Smithson, K. Kolibab, A. K. Shriner, N. Srivastava, S. Khuder, and M. A. J. Westerink Immune Response to Pneumococcal Polysaccharides 4 and 14 in Elderly and Young Adults: Analysis of the Variable Light Chain Repertoire Infect. Immun., November 1, 2005; 73(11): 7477 - 7484. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghosh, A. C. Steere, B. D. Stollar, and B. T. Huber In Situ Diversification of the Antibody Repertoire in Chronic Lyme Arthritis Synovium J. Immunol., March 1, 2005; 174(5): 2860 - 2869. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhou, K. R. Lottenbach, S. J. Barenkamp, and D. C. Reason Somatic Hypermutation and Diverse Immunoglobulin Gene Usage in the Human Antibody Response to the Capsular Polysaccharide of Streptococcus pneumoniae Type 6B Infect. Immun., June 1, 2004; 72(6): 3505 - 3514. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Lucas, K. D. Moulton, V. R. Tang, and D. C. Reason Combinatorial Library Cloning of Human Antibodies to Streptococcus pneumoniae Capsular Polysaccharides: Variable Region Primary Structures and Evidence for Somatic Mutation of Fab Fragments Specific for Capsular Serotypes 6B, 14, and 23F Infect. Immun., February 1, 2001; 69(2): 853 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Reason, T. C. Wagner, V. R. Tang, K. D. Moulton, and A. H. Lucas Polysaccharide Binding Potential of the Human A2 or A18 Kappa Light Chain Homologues Infect. Immun., February 1, 1999; 67(2): 994 - 997. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |