The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lucas, A. H.
Right arrow Articles by Reason, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucas, A. H.
Right arrow Articles by Reason, D. C.
The Journal of Immunology, 1998, 161: 3776-3780.
Copyright © 1998 by The American Association of Immunologists

Role of {kappa}II-A2 Light Chain CDR-3 Junctional Residues in Human Antibody Binding to the Haemophilus influenzae Type b Polysaccharide1

Alexander H. Lucas2, Karen D. Moulton and Donald C. Reason

Children’s Hospital Oakland Research Institute, Oakland, CA 94609


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abs using the {kappa}II-A2 V gene segment predominate the human Ab repertoire to the Haemophilus influenzae b (Hib) polysaccharide (PS). All A2 anti-Hib PS Abs sequenced to date possess a 10-amino acid L chain complementarity-determining region-3 (CDR-3) having an insertional arginine (Arg) at position 95a, the V-J junction. These findings suggest an essential requirement for this conserved Arg residue in determining Hib PS-binding affinity. We examined this requirement by performing chain recombination experiments in which a series of A2 L chains, differing at position 95a, were combined individually with an Fd region known to generate a Hib PS-combining site when paired with an A2-Arg(95a)-J{kappa}1 V region. Hib PS binding of the recombinant Fabs was evaluated quantitatively using a radioantigen-binding assay. Fabs having A2 L chains with either Arg or lysine in position 95a in combination with J{kappa}1 gave equivalent and strongest binding to Hib PS. Fabs having A2-J{kappa}1 L chains with either tyrosine, glycine, alanine, leucine, serine, or threonine in position 95a, or having an A2-Arg(95a)-J{kappa}3 L chain, gave intermediate binding. Fabs having A2-J{kappa}1 L chains with glutamate or aspartate at 95a or with no junctional residue showed little or no Hib PS binding. These results demonstrate the importance of L chain junctional residue, as well as J{kappa} usage and CDR-3 length, in determining Hib PS-binding affinity. Contrary to expectation, an Arg junctional residue is not essential for generating either high or intermediate affinity-binding sites.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well known that, despite the high potential to generate a diverse Ab repertoire, certain prototypic VH-VL germ-line combinations recur in the Ab responses of inbred mice to haptenic and carbohydrate Ags (1, 2, 3, 4, 5, 6). Perhaps less well known is that a similar phenomenon occurs among human populations in the protective Ab response to the Haemophilus influenzae b (Hib)3 capsular polysaccharide (PS). Although three to four VHIII gene segments and as many as 12 distinct VL genes potentially may contribute to the repertoire, the serum response in most individuals is oligoclonal and dominated by Abs encoded by the A2 V{kappa} gene usually in association with the DP-47 VH gene (7, 8, 9, 10, 11, 12, 13, 14, 15, 16). Ten A2 anti-Hib PS Abs derived either from hybridomas or serum have been sequenced to date, and all contain a 10-amino acid L chain complementarity-determining region 3 (CDR-3) having a nontemplated insertional arginine (Arg) residue at position 95a (14). Moreover, two Hib PS-specific Fab fragments isolated from a combinatorial library use the A2 VL gene with this same CDR-3 (17), and L chain libraries prepared from adult peripheral blood following Hib PS vaccination similarly show a preponderance of A2 L chains with this rearrangement (18) (D. C. Reason and A. H. Lucas, unpublished observation). Thus, this L chain CDR-3 configuration can be considered canonical for A2 anti-Hib PS Abs. These findings, when taken with the observation that even anti-Hib PS Abs using V{lambda} genes also have a 10-amino acid CDR-3 with an insertional Arg (13, 14, 15), suggest a crucial role for this residue in mediating Hib PS binding possibly by ionic interaction with the negatively charged phosphate groups of the Hib PS.

Previous studies have demonstrated the critical importance of particular L chain CDR-3 junctional amino acid residues in Ag binding (19, 20, 21, 22, 23, 24), and therefore we and others have presumed that Hib PS Abs would show a similar stringency for an Arg residue in position 95a. We recently demonstrated that Hib PS-specific Fab fragments could be isolated from combinatorial libraries prepared from peripheral blood of vaccinated adults (17). Since this molecular expression system is well suited for performing mutagenesis and chain-shuffling experiments, it provides an opportunity to test the hypothesis that the presence of an insertional Arg residue at position 95a is essential for Hib PS binding.

In this study, we constructed a series of Fab fragments differing only at position 95a of the L chain CDR-3 and evaluated these recombinants for Hib PS-binding activity. In addition, the availability of two naturally derived A2 L chains, one lacking an insertional residue and having a 9-amino acid CDR and the other consisting of an A2 rearrangement with J{kappa}3 and having an insertional Arg, permitted us to assess the role of CDR-3 length and J usage on Hib PS binding.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sources of Fd and L chains

The SOL10 Fd region was isolated from a bacteriophage combinatorial library prepared from peripheral blood of an Hib PS-vaccinated adult as described previously (17). SOL10 Fd (GenBank accession no. U41571) is encoded by the DP-47 gene segment, a D region of nine bases and JH4b1. The pairing of the SOL10 Fd with an L chain consisting of the A2-Arg95a-J{kappa}1 (GenBank accession no. U41569) generates a Fab fragment that binds Hib PS. SOL10 Fd was used with sequence-defined L chains to prepare a series of Fd-L recombinants (see below).

The L chains used in these experiments originally were derived from an L chain library prepared from a Hib PS-vaccinated adult as described previously (17). In addition, an A2 L chain was isolated from a library prepared from the peripheral blood of a 6-month-old African-American female 7 days after receiving a second vaccination of Hib-TITER (Lederle Praxis Biologicals, Wayne, NJ).

Construction of Fabs

A2c L chains having either alanine, glycine, leucine, serine, threonine, tyrosine, aspartate, or glutamate at position 95a were constructed by mutagenesis using the method of unique site elimination (25). The template plasmid contained an A2c-Arg(95a)-J{kappa}1 L chain and the ST10 Fd region. The mutagenic primer was GCCGAACGTCCASNNAGGAAGCTGTATACT, and the selection primer was CTGTGACTGGTGACGCGTCAACCAAGTC. The mutagenic primer randomizes bases at the A2-J{kappa}1 junction. The selection primer eliminates a unique ScaI site in the pComb 3H vector (26). Both primers bind to the noncoding strand. Phosphorylated primers were annealed to the template and extended with T4 polymerase for 1 h followed by digestion with ScaI for 1 h. The resulting mutated circular DNA was electroporated into Escherichia coli NM522mutS repair-deficient cells. Plasmid DNA was prepared from overnight cultures and 250 ng was digested with ScaI for 4 h. Digested plasmid DNA (125 ng) was electroporated into E. coli XL1-Blue cells. The L chain having a lysine residue at the V-J junction was generated as described above, except GCCGAACGTCCACTTAGGAAGCTGTATACTTGG was used as the mutagenic primer. Reagents for mutagenesis and the selection primer were purchased from Amersham Pharmacia Biotech (Piscataway, NJ).

The Fab constructs having the ST10 Fd region paired with either the A2c-Arg95a-J{kappa}3 (designated RJ3) or the A2c-J{kappa}1 VL not containing a junctional residue at position 95a (designated ø95a) were prepared by ligating the restricted L chains into the pComb 3H vector containing the ST10 Fd region, followed by electroporation into XL1-Blue cells as described previously (17). The pComb 3H vector developed by Barbas et al. (26) was kindly provided to us by The Scripps Research Institute, La Jolla, CA.

Phagemid DNA was purified from log-phase bacterial cultures using Wizard Plus Miniprep Kits (Promega, Madison, WI) and sequenced using Sequenase 2.0 (United States Biochemical, Cleveland, OH). Either the entire V region or the mutagenized regions of the L chain inserts were sequenced using the VK2dr, A2CDR2, VK3a, and HK3' primers as described previously (17).

The pComb 3H phagemid vector permits expression of Fab fragments either on the surface of bacteriophage particles as a fusion product of the minor coat protein III with the C terminus of the Fd chain or as a soluble, secreted molecule devoid of cpIII (26). However, we have found that expression of Fab fragments in "soluble" form does not require removal of coat protein III from the C terminus of the Fd chain. In this study, Fab fragments, expressed as coat protein fusion products and present in the bacterial cytosol and periplasm, were used for analysis. Quantitative radioantigen-binding assay (RABA) analysis of Hib PS binding by Fab containing cpIII or lacking cpIII shows that both constructs give identical binding curves when normalized for Fab concentration using the ELISA described below (our unpublished observations).

Clonal bacterial lysates containing Fab fragments were used for Hib PS-binding analyses. Small scale overnight cultures of bacterial clones containing pComb 3H phagemids were used to inoculate ~100 ml of SB broth containing antibiotics (50 µg/ml carbenicillin, 10 µg/ml tetracycline, and 20 mM magnesium chloride). Bacteria were cultured for 6 h at 37°C with shaking and then overnight at 30°C with shaking in the presence of 1 mM isopropyl B-D-thiogalactoside. Bacteria were harvested by centrifugation and resuspended in PBS containing aprotinin (2 µg/ml), leupeptin (1 µg/ml), Pefabloc (0.5 mg/ml) (Boehringer Mannheim, Indianapolis, IN), and 0.1% sodium azide. The bacterial suspension was subjected to three cycles of freezing and thawing. Bacteria and debris were removed by centrifugation at 21,000 x g for 15 min. The supernatants were then spun for 1 h at 100,000 x g and stored at 4°C.

Fab ELISA

Fab concentration was determined by ELISA. A sheep polyclonal IgG fraction specific for human IgG Fd (The Binding Site, San Diego, CA) was diluted 1:2000 in PBS and incubated in microtiter wells overnight at room temperature. Wells were blocked with 1% BSA, washed with PBS-0.1% Tween-20, and then dilutions of culture supernatants or the Fab standard were added for 2 h at 37°C. After washing with PBS-Tween, alkaline phosphatase-conjugated Ab specific for human {kappa}-chain (BioSource International, Camarillo, CA) was added for 2 h. Wells were washed, and p-nitrophenylphosphate in ethanolamine buffer was added. Absorbance at 405 nm was determined after the Fab standard gave linear absorbance readings at concentrations ranging from 10 to 125 ng/ml. The assay was calibrated with purified ST10 Fab using an E280 of 1.37 for a 1.0 mg/ml solution (17).

RABA

Fab Hib PS binding was analyzed using a previously described RABA (27). Diluent consisted of PBS with 10% FCS. Fifty microliters of 125I-Hib PS containing ~300,000 cpm (sp. act., ~45 µCi/µg) was mixed with 50 µl of diluted Fab-containing culture supernatants or control Fab. The mixtures were incubated for 2 h at 37°C and overnight at 4°C. A total of 100 µl of 25% (w/v) polyethylene glycol 8000 in 2% FCS-PBS was added, and the mixtures were incubated for 6 h at 4°C. The precipitates were harvested by centrifugation (16,000 x g), washed once with 200 µl of 12.5% polyethylene glycol, and counted in a dry-well gamma counter. To examine Fab binding under multivalent conditions, purified goat anti-human {kappa} Abs (Biosource International) at a final concentration of 5 µg/ml were included in the mixture of Fab and [125I]Hib PS.

Hib RIA

Following overnight culture on chocolate agar, a few Hib (strain Eagan) colonies were inoculated into 20 ml of 3.7% (w/v) brain heart infusion broth (Difco, Detroit, MI) supplemented with hemin at 10 µg/ml and ß-nicotinamide dinucleotide at 10 µg/ml. The culture was shaken at 250 rpm at 37°C until the OD at 600 nm reached 0.4 to 0.5 absorbance units. The bacteria were washed three times in ice-cold PBS-1% BSA-0.1% sodium azide (PBS-BSA), and resuspended in PBS-BSA at 4 x 108/ml using an OD at 600 nm = 1.0 for a suspension of 1 x 109 bacteria/ml. Fifty microliters of Fabs, diluted in PBS-BSA, was added to Eppendorf tubes. Fifty microliters of the Hib suspension was added and the tubes were incubated on ice for 3 h with occasional mixing. The tubes were spun at 3000 x g at 4°C, and the bacterial pellet was washed one time in 250 µl of PBS-BSA. The pellets were resuspended in 100 µl of 125I-goat anti-human {kappa} (Biosource International) labeled with chloramine-T to a specific activity of ~1.5 x 107 cpm/µg, and the tubes were incubated for 3 h on ice with occasional mixing. The tubes were spun and the bacterial pellets were washed two times in PBS-BSA. Bound radioactivity was determined by counting tubes in a dry-well gamma counter. All determinations were performed in duplicate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To examine the role of the A2 L chain CDR-3 junctional residue in Hib PS binding, a series of Fab fragments was prepared that consisted of the same Fd region paired with A2 L chains differing at position 95a. The starting material for these experiments was a Hib PS-specific Fab fragment designated SOL10 that was isolated from a bacteriophage combinatorial library prepared from the peripheral blood of a Hib PS-vaccinated adult (17). SOL10 expresses what may be considered a prototypic Hib PS-specific V domain; the Fd V region consists of DP-47 having 98% identity to the translation product of the germ-line gene, a 3-amino acid D region and JH4b. This Fd region is paired with an L chain formed by the joining of the A2c V region (having 100% identity to the translation product of the germ-line gene) with J{kappa}1. The L chain CDR-3 is 10 amino acids in length and contains a nontemplated insertional Arg residue at position 95a. The Fabs used in this study were prepared by mutagenesis of this construct or by insertion of naturally occurring L chains into pComb 3H containing SOL10 Fd (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. L chains crossed with the ST10 Fd region1

 
Fab-containing supernatants were generated from cultures of bacterial clones. The Fab concentrations were determined by an ELISA in which Fabs were captured on wells coated with anti-Fd Ab and detected with enzyme-coupled anti-{kappa}. Since capture requires the Fd chain and detection requires the L chain, this assay measures intact Fab molecules and avoids problems associated with unbalanced synthesis that may occur in such clones. Hib PS reactivity was evaluated quantitatively using a RABA in which the Fabs were either in the monomeric state (Fig. 1Go) or were polymerized by addition of polyclonal anti-human {kappa} Ab in order to increase avidity and thereby promote maximal Hib PS binding (Fig. 2Go). Table IIGo summarizes the binding data obtained for each Fab as determined in several independent RABAs. These results show the RJ1 Fab, which represents the canonical in vivo configuration, and the Fab having a Lys residue at position 95a to be the most avid binders of Hib PS. Thus, replacement of Arg with a Lys had little or no effect upon Hib PS-binding activity. Fabs having either a Leu, Tyr, Ala, or Ser residue at position 95a gave intermediate binding, and this binding resembled that of the RJ3 Fab, which contains a junctional Arg at position 95a in association with J{kappa}3. Both RJ1 and RJ3 configurations occur in vivo although the usage of J{kappa}1 is more common than J{kappa}3 (14). The presence of either Gly or Thr at position 95a of the A2 L chain also generated Fabs with detectable Hib PS binding, but this binding was only apparent when the Fabs were cross-linked by anti-{kappa} Ab. While the Glu Fab did have some detectable reactivity with Hib PS when cross-linked with anti-{kappa} Ab, this binding was severely diminished since approximately 100-fold higher Fab concentration was required to achieve 50% binding as compared with the intermediate binding Fab group. Little or no Hib PS binding was shown by the Fab having Asp residue at 95a. A CDR-3 of 10 amino acids in length appears essential for Hib PS reactivity in A2-containing Fabs as shown by the complete lack of binding by Fab ø95a, which has a VL region resulting from the recombination of A2 with J{kappa}1 but which lacks an insertional residue and has a CDR-3 of 9 amino acids in length.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. Binding of [125I]Hib PS by various Fabs as determined by RABA in the absence of anti-human {kappa} Abs (monovalent Fab condition). RJ3 is shown in both panels to facilitate comparisons. Fab concentration was measured by an ELISA in which Fabs were captured with anti-human Fd and detected with enzyme-coupled anti-human {kappa}.

 


View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Binding of [125I]Hib PS by various Fabs as determined by RABA in the presence of anti-human {kappa} Abs (polyvalent condition). RJ3 is shown in both panels to facilitate comparisons. Fab concentration was measured by an ELISA in which Fabs were captured with anti-human Fd and detected with enzyme-coupled anti-human {kappa}.

 

View this table:
[in this window]
[in a new window]
 
Table II. Fab Hib PS binding as determined by RABA1

 
To determine whether Fab Hib PS reactivity assessed in the soluble phase with chemically modified and iodinated Hib PS (RABA conditions) reflected recognition of native Hib PS, we evaluated the binding of selected Fabs to Hib bacteria. Figure 3Go shows that the rank order of Fab binding to Hib bacteria paralleled that obtained with the RABA.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Binding of Fab fragments to Hib bacteria. Fabs were incubated with Hib bacteria. After washing bacteria, bound Fab was detected using 125I-labeled anti-human {kappa}. Fab concentration was measured by an ELISA in which Fabs were captured with anti-human Fd and detected with enzyme-coupled anti-human {kappa}.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The findings reported here demonstrate that in Hib PS Fab fragments using A2 L chains the identity of residue 95a of the L chain CDR-3 can profoundly affect binding affinity. The cationic residues Arg and Lys at L chain 95a were permissive for high affinity Hib PS binding whereas the anionic residues Glu and Asp severely reduced or abolished the ability of Fabs to bind Hib PS. This pattern of Fab reactivity, when taken with the fact that Hib PS is negatively charged because of the presence of a phosphate residue in each repeating unit, strongly implicates ionic interactions between residue 95a and the Hib PS phosphate as a major determinant of binding affinity. These observations are in keeping with functional, modeling, and crystallographic studies indicating that the L chain CDR-3 occupies an important position in the combining site and frequently engages in direct contact with Ag (28, 29).

The suggested role for bond formation between the L chain CDR-3 Arg and Hib PS is similar to previous analyses with Abs to anionic Ags such as DNA and azophenylarsonate (Ars), which have shown that an Arg residue at position 96 of the L chain is critical for binding activity (19, 22, 23). The Arg side chain in Ars Abs bearing the major cross-reactive Id bonds with the oxygen of the arsonate moiety (30, 31) and is an essential determinant of binding as replacement of the Arg with other residues, including Lys abolishes Ars binding (20). Thus, Hib PS Fabs differ from anti-Ars Abs in that they can accommodate a variety of amino acids including aromatic and aliphatic residues in position 95a and still retain binding activity. Indeed, the binding affinities of these Fabs are equivalent to that of the RJ3 Fab, which represents an L chain CDR-3 configuration expressed in vivo. While the proposed ionic interaction between residue 95a and Hib PS can exert either favorable or unfavorable consequences to binding, the ability to form a salt bridge at 95a appears not to be essential for generating binding sites with intermediate binding affinities for Hib PS. This binding may result from the more extensive and/or distributed bonding network of a large antigenic determinant as compared with a small hapten.

Our findings are somewhat surprising in light of previous studies showing that all in vivo-derived A2 anti-Hib PS Abs, either obtained from hybridomas or serum, contain an Arg residue at position 95a (14, 15). The in vitro data using recombinant Fab fragments would suggest that A2 anti-Hib PS Abs having non-Arg insertional residues, particularly those having either Lys, Leu, or Tyr residues at position 95a, i.e., that have Hib PS-binding affinities greater than or equal to RJ3, should be capable of contributing to the functional repertoire. Why then are these configurations not expressed in vivo?

One possible explanation for this discrepancy between the natural repertoire and the in vitro findings is that RABA assessments of Fab affinity, which presumably represent equilibrium measurements, do not sufficiently discern Ag-binding parameters such as on-rate that could be important in B cell selection or activation (32). Perhaps characteristics of the Arg side chain, such as larger size, partial aromatic character, or propensity to engage in more extensive hydrogen bonding, impart advantages not offered by Lys or other residues. These properties could affect chain pairing or main chain conformation and thereby favorably influence binding kinetics. However, several observations indicate that the RABA values may reflect true binding potential. First, the relative Fab ranking obtained under monovalent binding conditions was preserved after cross-linking with anti-{kappa}, a result indicating that the affinity differences observed between Fab fragments would be preserved in bivalent Abs. Second, the correlation between Fab Hib PS binding and the character of the insertional side chain, e.g., positively charged side chains being permissive and negatively charged side chains being nonpermissive, suggests that the RABA is a reliable indicator of relevant bonding interactions between the combining site and Ag. Third, Fab binding to native Hib PS presented on the surface of Hib bacteria paralleled the RABA results. Fourth, many of the Fabs differing at residue 95a gave Hib PS binding equivalent to that of the RJ3, which represents a configuration expressed in vivo and which can serve as a demarcation for physiologically relevant binding activity. Therefore, we suspect that explanations other than methodology may be required to explain the discordance between the in vivo and in vitro findings.

Since Arg codons at position 95a of the A2 L chain cannot be accounted for by direct utilization of germ-line bases present at the 5' and 3' ends of the germ-line A2 and J{kappa} segments, respectively, they are presumed to derive from nontemplated nucleotide additions occurring during the process of V-J joining (33). If incorporation of bases during joint assembly is equiprobable, then biases toward certain amino acids should occur as a function of codon frequency. Although both Arg and Lys residues at position 95a contribute to high affinity binding, Arg insertionals would be favored over Lys since Arg has 6 codons and Lys has 2 codons. However, this explanation cannot account for the lack of expression in vivo of Abs with either Leu or Ser at 95a. Fab fragments with these insertional residues have intermediate affinity Hib PS-binding sites similar to the in vivo-expressed A2-Arg95a-J{kappa}3 configuration and, like Arg, Ser, and Leu have six codons each. Perhaps a more likely explanation of biases in codon usage results from the propensity of TdT, the enzyme thought to mediate N region addition, to prefer G/C nucleotides (33). This process would favor Arg insertional residues as four of six Arg codons are GCX.

Finally, the data presented here also implicate other L chain CDR-3 characteristics, in addition to junctional diversity, as determinants of Hib PS binding. The 10- to 20-fold differences in binding between the RJ1 and RJ3 Fabs suggest that J usage affects binding affinity. However, this attribution is not precise since, in addition to the amino acid differences resulting from J usage (positions 96 in the CDR-3 as well as position 100 and 105 of framework 4), the RJ-3 Fab also differs from RJ1 at one other residue in CDR-3, a conservative replacement of Ser to Thr at position 92 that presumably resulted from somatic mutation (see Table IGo). Length of CDR-3 also appears to affect Ag binding as shown by the absence of Hib PS binding by Fab ø95a. Fab ø95a lacks an insertional residue, has a CDR-3 of 9 amino acids in length, and represents the direct germ-line recombination of the A2 V gene segment with J{kappa}1. Thus, an L chain CDR-3 of 10 amino acids in length appears essential for generating Hib PS-binding sites using the A2 V region. These results parallel those of Kabat and colleagues (34, 35) in their studies of Abs to ({alpha}1-6)dextran. Alterations in the length of L CDR-3 had a more profound effect on binding than did amino acid substitutions resulting from usage of different J{kappa} segments. They proposed that groove-type dextran-binding sites may be sensitive to CDR-3 length, which in their model alters the loop configuration of L chain CDR-3 and drastically affects the shape of the combining site. A2 anti-Hib PS Abs have features resembling groove-type sites. They contain short D segments and they presumably react with antigenic determinants (phosphate residues) along the length of the PS polymer.

In summary, the results presented here underscore the importance of L chain CDR-3 diversity in determining Hib PS-binding affinity. The challenge for future studies will be to broaden the in vivo data base to determine the extent to which polymorphisms in A2 L chain CDR-3 occur in vivo and how they might impact functionality of the repertoire. The Hib PS Ab repertoire of infants would be an appropriate subject for study as previous work has documented significant differences in avidity and protective function of A2 anti-Hib PS Abs elicited in infants following vaccination with different Hib PS protein conjugates (36).


    Acknowledgments
 
We thank Nancy Kennedy (Children’s Hospital Oakland Pediatric Clinical Research Center) for her assistance.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AI25008 and RR01271-16. Back

2 Address correspondence and reprint requests to Dr. Alexander H. Lucas, Children’s Hospital Oakland Research Institute, 747 52nd Street, Oakland, CA 94609. Back

3 Abbreviations used in this paper: Hib, Haemophilus influenzae type b; PS, polysaccharide; RABA, radioantigen binding assay; CDR, complementarity-determining region; Ars, p-azophenylarsonate. Back

Received for publication March 17, 1998. Accepted for publication May 29, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kuettner, M. G., A. Wang, A. Nisonoff. 1972. Quantitative investigations of idiotypic antibodies. VI. Idiotypic specificity as a potential genetic marker for the variable regions of mouse immunoglobulin polypeptide chains. J. Exp. Med. 135:579.[Abstract]
  2. Siekevitz, M., M. L. Gefter, P. Brodeur, R. Riblet, A. Marshak-Rothstein. 1982. The genetic basis of antibody production: the dominant anti-arsonate idiotype response of the strain A mouse. Eur. J. Immunol. 12:1023.[Medline]
  3. Kaartinen, M., G. M. Griffiths, A. F. Markham, C. Milstein. 1983. mRNA sequences define an unusually restricted IgG response to 2-phenyl-oxazolone and its early diversification. Nature 304:320.[Medline]
  4. Cumano, A., K. Rajewsky. 1985. Structure of primary anti-(4-hydroxy-3-nitropheny)acetyl (NP) antibodies in normal and idiotypically suppressed C57BL/6 mice. Eur. J. Immunol. 15:512.[Medline]
  5. Clarke, S. J., J. L. Claflin, M. Potter, S. Rudikoff. 1983. Polymorphisms in anti-phosphocholine antibodies reflecting evolution of immunoglobulin families. J. Exp. Med. 157:98.[Abstract/Free Full Text]
  6. Geckeler, W., B. Blomberg, C. de Preval, M. Cohn. 1977. On the genetic dissection of a specific humoral immune response to {alpha}(1,3) dextran. Cold Spring Harbor Symp. Quant. Biol. 41:743.
  7. Scott, M. G., J. J. Tarrand, D. L. Crimmins, D. W. McCourt, N. R. Siegel, C. E. Smith, M. H. Nahm. 1989. Clonal characterization of the human antibody repertoire to Haemophilus influenzae b polysaccharide. II. IgG antibodies contain VH genes from a single VH family and VL genes from at least four VL families. J. Immunol. 143:293.[Abstract]
  8. Scott, M. G., D. L. Crimmins, D. W. McCourt, I. Zocher, R. Thiebe, H. G. Zachau, M. H. Nahm. 1989. Clonal characterization of the human IgG antibody repertoire to Haemophilus influenzae type b polysaccharide. III. A single V{kappa}II gene and one of several J genes are joined by an invariant arginine to form the most common L chain V region. J. Immunol. 143:4110.[Abstract]
  9. Scott, M. G., D. L. Crimmins, D. W. McCourt, G. K. Chung, F. Schable, R. Thiebe, H. G. Zachau. 1991. Clonal characterization of the human IgG antibody repertoire to Haemophilus influenzae type b polysaccharide. IV. The less frequently expressed VL are heterogeneous. J. Immunol. 147:4007.[Abstract]
  10. Lucas, A. H., R. J. Langley, D. M. Granoff, M. H. Nahm, M. Y. Kitamura, M. G. Scott. 1991. An idiotypic marker associated with a germ-line encoded {kappa} light chain variable region that predominates the vaccine-induced human antibody response to the Haemophilus influenzae b polysaccharide. J. Clin. Invest. 88:1811.
  11. Granoff, D. M., P. G. Shackelford, S. J. Holmes, A. H. Lucas. 1993. Variable region expression in the antibody responses of infants vaccinated with Haemophilus influenzae type b polysaccharide-protein conjugates: description of a new {lambda} light chain-associated idiotype and the relation between idiotype expression, avidity, and vaccine formulation. J. Clin. Invest. 91:788.
  12. Adderson, E. E., P. G. Shackleford, A. Quinn, W. L. Carroll. 1991. Restricted Ig heavy chain usage in the human antibody response to Haemophilus influenzae type b polysaccharide. J. Immunol. 147:1667.[Abstract]
  13. Adderson, E. E., P. G. Shackelford, R. A. Insel, A. Quinn, P. M. Wilson, W. L. Carroll. 1992. Immunoglobulin light chain variable region gene sequences for human antibodies to Haemophilus influenzae type b polysaccharide are dominated by a limited number of V{kappa} and V{lambda} segments and VJ recombinations. J. Clin. Invest. 89:729.
  14. Lucas, A. H.. 1996. Genetic basis and somatic evolution of a human polysaccharide-specific antibody repertoire, p. 121–143. M. Zouali, ed. Human B Cell Superantigens R. G. Landes Co., Austin, TX.
  15. Carroll, W. L., E. E. Adderson, A. H. Lucas, G. J. Silverman, R. A. Insel, M. G. Scott, M. H. Nahm, P. G. Shackelford. 1994. Molecular basis of antibody diversity. R. W. Ellis, and D. M. Granoff, eds. Development and Clinical Uses of Haemophilus b Conjugate Vaccines 207.-209. Marcel Dekker, New York.
  16. Pinchuk, G. V., C. Nottenburg, E. C. B. Milner. 1995. Predominant V-region gene configurations in the human antibody response to Haemophilus influenzae capsule polysaccharide. Scand. J. Immunol. 41:324.[Medline]
  17. Reason, D. C., T. C. Wagner, A. H. Lucas. 1997. Human Fab fragments specific for the Haemophilus influenzae b polysaccharide isolated from a bacteriophage combinatorial library use variable region gene combinations and express idiotype that mirror in vivo expression. Infect. Immun. 65:261.[Abstract]
  18. Insel, R. A., W. S. Varade, Y-W. Chu, E. Marin, R. Fuleihan, R. S. Geha. 1995. Somatic mutation of human immunoglobulin genes: bias, rate and regulation. Ann. N. Y. Acad. Sci. 764:158.[Medline]
  19. Jeske, D. J., J. Jarvis, C. Milstein, J. D. Capra. 1984. Junctional diversity is essential to antibody activity. J. Immunol. 133:1090.[Abstract]
  20. Hasemann, C. A., J. D. Capra. 1991. Mutational analysis of arsonate binding by a CRIA+ antibody: VH and VL junctional diversity are essential for binding activity. J. Biol. Chem. 266:7626.[Abstract/Free Full Text]
  21. Hudson, N. W., R. E. Bruccoleri, L. K. Steinrauf, J. A. Hamilton, M. Mudgett-Hunter, M. M. Margolies. 1990. A V{kappa}-J{kappa} junctional change in an anti-digoxin recombinant antibody destroys digoxin-binding activity. J. Immunol. 145:2718.[Abstract]
  22. Tillman, D. M., N. T. Jou, R. J. Hill, T. N. Marion. 1992. Both IgM and IgG anti-DNA antibodies are the products of clonally selective B cell stimulation in (NZB x NZW)F1 mice. J. Exp. Med. 176:761.[Abstract/Free Full Text]
  23. Ibrahim, S. M., M. Weigert, C. Basu, J. Erikson, M. Z. Radic. 1995. Light chain contribution to specificity in anti-DNA antibodies. J. Immunol. 155:3223.[Abstract]
  24. Bedzyk, W. D., Jr E. W. Voss. 1991. Active site contributions to fluorescein binding determined by in vitro heavy and light chain reassociations. Mol. Immunol. 28:27.[Medline]
  25. Deng, W. P., J. A. Nickoloff. 1992. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem. 200:81.[Medline]
  26. Barbas, C. F., A. S. Kang, R. A. Lerner, S. J. Benkovic. 1991. Assembly of combinatorial libraries on phage surfaces: the gene III site. Proc. Natl. Acad. Sci. USA 88:7978.[Abstract/Free Full Text]
  27. Lucas, A. H., J. W. Larrick, D. C. Reason. 1994. Variable region sequences of a protective human monoclonal antibody specific for the Haemophilus influenzae type b capsular polysaccharide. Infect. Immun. 62:3873.[Abstract/Free Full Text]
  28. Alzari, P. M., M.-B. Lascombe, R. J. Poljak. 1988. Three-dimensional structure of antibodies. Annu. Rev. Immunol. 6:555.[Medline]
  29. Davies, D. R., E. A. Padlan. 1990. Antibody-antigen complexes. Annu. Rev. Biochem. 59:439.[Medline]
  30. Strong, R. K., G. A. Petsko, J. Sharon, M. N. Margolies. 1991. Three-dimensional structure of murine anti-p-azophenylarsonate Fab 36-71. II. Structural basis of hapten binding and idiotypy. Biochemistry 30:3749.[Medline]
  31. Strong, R. K., R. Campbell, D. R. Rose, G. A. Petsko, J. Sharon, M. N. Margolies. 1991. Three-dimensional structure of murine anti-p-azophenylarsonate Fab 36-71. I. X-ray crystallography, site-directed mutagenesis, and modeling of the complex with hapten. Biochemistry 30:3739.[Medline]
  32. Foote, J., C. Milstein. 1991. Kinetic maturation of an immune response. Nature 352:530.[Medline]
  33. Victor, K. D., J. D. Capra. 1994. An apparently common mechanism of generating antibody diversity: length variation of the VL-JL junction. Mol. Immunol. 31:39.[Medline]
  34. Wallick, S. C., E. A. Kabat, S. L. Morrison. 1989. The effect of isotype and J{kappa} region on antigen binding and idiotype expression by antibodies binding {alpha}(1-6) dextran. J. Immunol. 142:1235.[Abstract]
  35. Wang, D., J. M. Hubbard, E. A. Kabat. 1993. Modeling study of antibody combining sites to ({alpha}1-6) dextrans. J. Biol. Chem. 268:20584.[Abstract/Free Full Text]
  36. Lucas, A. H., D. M. Granoff. 1995. Functional differences in idiotypically defined IgG1 anti-polysaccharide antibodies elicited by vaccination with Haemophilus influenzae type b polysaccharide-protein conjugates. J. Immunol. 154:4195.[Abstract]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
H. E. Baxendale and D. Goldblatt
Correlation of Molecular Characteristics, Isotype, and In Vitro Functional Activity of Human Antipneumococcal Monoclonal Antibodies
Infect. Immun., February 1, 2006; 74(2): 1025 - 1031.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. L. Smithson, K. Kolibab, A. K. Shriner, N. Srivastava, S. Khuder, and M. A. J. Westerink
Immune Response to Pneumococcal Polysaccharides 4 and 14 in Elderly and Young Adults: Analysis of the Variable Light Chain Repertoire
Infect. Immun., November 1, 2005; 73(11): 7477 - 7484.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Ghosh, A. C. Steere, B. D. Stollar, and B. T. Huber
In Situ Diversification of the Antibody Repertoire in Chronic Lyme Arthritis Synovium
J. Immunol., March 1, 2005; 174(5): 2860 - 2869.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Zhou, K. R. Lottenbach, S. J. Barenkamp, and D. C. Reason
Somatic Hypermutation and Diverse Immunoglobulin Gene Usage in the Human Antibody Response to the Capsular Polysaccharide of Streptococcus pneumoniae Type 6B
Infect. Immun., June 1, 2004; 72(6): 3505 - 3514.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. H. Lucas, K. D. Moulton, V. R. Tang, and D. C. Reason
Combinatorial Library Cloning of Human Antibodies to Streptococcus pneumoniae Capsular Polysaccharides: Variable Region Primary Structures and Evidence for Somatic Mutation of Fab Fragments Specific for Capsular Serotypes 6B, 14, and 23F
Infect. Immun., February 1, 2001; 69(2): 853 - 864.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. C. Reason, T. C. Wagner, V. R. Tang, K. D. Moulton, and A. H. Lucas
Polysaccharide Binding Potential of the Human A2 or A18 Kappa Light Chain Homologues
Infect. Immun., February 1, 1999; 67(2): 994 - 997.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lucas, A. H.
Right arrow Articles by Reason, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucas, A. H.
Right arrow Articles by Reason, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS