|
|
||||||||
Division of Dermatology and Department of Microbiology and Immunology, University of California, Los Angeles, School of Medicine, Los Angeles, CA 90095
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Macrophages are critical cells in the pathogenesis of tuberculosis
infection. Initially, the macrophage serves as the host cell for the
pathogen. However, upon receipt of appropriate activation signals from
Ag-specific T cells, the macrophage converts into a powerful effector
cell with the ability to kill its invader. A central role for
macrophages is the presentation of Ags to T cells. Classically,
macrophages present peptides to T cells in the context of MHC class I
and II molecules. Recently, a new Ag presentation pathway involving the
CD1 proteins has been identified. These polypeptides are expressed
constitutively on professional APCs and can be induced on peripheral
blood monocytes by treatment with granulocyte-macrophage CSF
(GM-CSF)4 and IL-4 (7, 8). A
unique feature of CD1-Ag presentation is the presentation of lipid and
lipoglycan Ags to T cells. CD1-restricted T cells can contribute to
protective immunity by the production of high levels of IFN-
(9) and
lysis of macrophages infected with virulent M. tuberculosis,
leading to the killing of intracellular bacteria (10).
We considered the possibility that the CD1-Ag presentation pathway system might be an attractive target for M. tuberculosis in its attempt to escape recognition and destruction by the immune system. We therefore infected CD1+ APC with a virulent strain of M. tuberculosis and investigated the impact of the infection on CD1-Ag presentation. We found that infection with M. tuberculosis leads to the down-regulation of surface CD1 expression at the mRNA level. The resulting inability of infected cells to present Ag to CD1-restricted T cells demonstrates a novel evasion strategy utilized by an intracellular pathogen to circumvent immune recognition.
| Materials and Methods |
|---|
|
|
|---|
T cells were cultured in RPMI 1640 (Life Technologies, Grand Island, NY) supplemented with 0.1 mM sodium pyruvate, 2 mM glutamine (Sigma, St. Louis, MO), 8% FCS (HyClone Laboratories, Logan, UT), and 2% heat-inactivated human serum. Experiments only involving APCs were performed in 10% FCS.
Cytokines and Abs
The following cytokines and Abs were used: recombinant human
(rhu) IL-6 (R&D Systems, Minneapolis, MN), rhuIL-12 (gift of M. Gately,
Roche, Nutley, NJ), rhuIL-10 (gift of K. Moore, DNAX, Palo Alto, CA),
rhuTNF-
(Endogen, Woburn, MA), purified TGF-ß (R&D Systems,
Minneapolis, MN), anti-IL-6 (Biosource International, Camarillo,
CA; clone B-E8), anti-IL-12 (Roche; clone 2-4A1), anti-IL-10
(PharMingen, San Diego, CA; clone JES3-9D7), anti-TGF-ß (Genzyme,
Cambridge, MA), anti-TNF-
(polyclonal), IgG1 FITC (Caltag,
Burlingame, CA), IgG1 (Sigma), and IgG2a (Sigma).
Growth of M. tuberculosis
M. tuberculosis (virulent strain H37Rv) was grown in suspension with constant, gentle rotation in roller bottles containing Middlebrook 7H9 broth (Difco, Detroit, MI) supplemented with glycerol, 0.05% Tween-80 (Sigma), and 10% Middlebrook OADC enrichment (Difco). Aliquots from logarithmically growing cultures were frozen in PBS containing 10% glycerol, and representative vials were thawed and enumerated for viable CFU on Middlebrook 7H11 plates. Comparison of microscope counts of mycobacteria and their growth on agar plates revealed a viability of the bacteria above 90%. Since clumping of mycobacteria is a common problem that can influence the validity and reproducibility of the experiments, we undertook several precautions to minimize clumps: 1) Culture conditions were chosen to support the growth of single cell suspensions. 2) Before in vitro infection, M. tuberculosis bacilli were sonicated to disrupt small aggregates of bacteria. 3) The multiplicity of infection (MOI) was selected such that there were only two to three bacilli per APC. 4) At the conclusion of every assay, an aliquot of infected cells was stained with auramine rhodamine to confirm the absence of any clumps.
Infection of CD1+ APC
PBMCs from healthy donors were treated with GM-CSF (200 U/ml) and IL-4 (100 U/ml) for 3 days. Adherent cells were detached by treatment with 1 mM EDTA (Sigma) and replated in six-well plates at a density of 3 x 106 cells/well. Monolayers were infected with single cell suspensions of M. tuberculosis. In some experiments, bacteria were heat killed before infection by incubation at 80°C for 30 min. This treatment killed all mycobacteria, as determined by CFU count. The gross morphology of the heat-killed bacteria was not altered according to auramine-rhodamine and Ziehl-Neelsen staining. After 4-h incubation, extracellular bacteria were removed by extensive washing. The efficiency of infection was quantitated in each experiment by staining of parallel cultures with auramine-rhodamine. In all experiments, the efficiency of infection was 3.47 ± 0.27 bacteria/cell, whereby 81 ± 4% of the cells were infected. No differences were observed in cultures infected with live or heat-killed M. tuberculosis. The microscopic evaluation of infected macrophages under the fluorescence microscope confirmed the absence of any mycobacterial aggregates. Cell viability of infected APC was determined by measuring the enzymatic activity of lactate dehydrogenase in the culture supernatant (CytoTox 96; Promega, Madison, WI).
FACS analysis
CD1+ APCs were pulse infected for 4 h, as described above, and incubated for different time intervals. In some experiments, recombinant cytokines or Abs to cytokines were added during the incubation period. At indicated time points, cells were harvested by treatment with 1 mM EDTA and washed. A total of 3 x 105 cells was resuspended in 100 µl FACS buffer (2% FCS, 1% NaN3, PBS without Mg2+/Ca2+) and incubated with unconjugated (MHC class I, clone W6/32, and MHC class II, clone L243, both obtained from American Type Culture Collection (ATCC), Manassas, MD; IgG1 control, obtained from Sigma, final concentration 2.5 µg/ml) or conjugated Abs (anti-CD1a FITC, clone OKT6 obtained from ATCC; anti-CD1b FITC, clone WM-25, Serotec, Raleigh, NC; IgG1 FITC, IgG2a FITC, HLA-DR FITC, all obtained from Caltag; CD14 PE, B7.1 PE, B7.2 PE, IgG PE, all obtained from Becton Dickinson, Mountain View, CA; 3 µl/sample) for 30 min on ice. Samples were washed twice in FACS buffer, and if necessary, an incubation for additional 30 min on ice with goat anti-mouse FITC Abs (Caltag; 1:250) followed. Cells were then fixed in 2% paraformaldehyde and stored at 4°C until analysis on a FACScan flow cytometer, and data were analyzed using Winmdi software.
Transwell experiment
CD1+ APCs were infected and harvested as described above. A total of 1 x 106 infected cells was plated in the upper chamber of a transfer system (Costar, Cambridge, MA; six-well plates), which is separated from the lower chamber by a membrane permeable only for particles smaller than 0.4 µm. The diameter of the pores allows cytokines and secreted mycobacterial Ags, but not whole bacteria to pass. In the lower chamber, 3 x 106 uninfected CD1+ APC were cultured. After 48 h, the cells in the lower chamber were detached and FACS staining was performed, as described above.
IFN-
ELISA
CD1+ APC were infected with live or pulsed with dead
M. tuberculosis, as described above. Immediately after the
end of the 4-h pulse infection or after an additional culture of
48 h, cells were detached by treatment with 1 mM EDTA. To
determine their capacity to present Ag of the phagocytosed
mycobacteria, 1 x 104 cells were replated in
triplicates in 96-well round-bottom plates. T cells (1 x
104) were added (final volume 200 µl), and after a
coincubation of 16 h, supernatants were assayed for IFN-
content in a capture ELISA using two distinct IFN-
Abs
(Endogen). Ninety-six-well plates were coated with capture Abs,
blocked, and incubated with IFN-
standards or the culture
supernatants. The captured IFN-
was detected with a biotinylated
anti-IFN-
detection Ab, followed by incubation with
streptavidin-peroxidase (Sigma) and the chromogenic peroxidase
substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD). The
absorbance at 405 nm was measured with an ELISA plate reader, and the
IFN-
concentrations were determined from the standard curve.
RT-PCR and Southern blot analysis
The synthesis of cDNA from 2 x 106
CD1+ APC was performed as described (11). The cDNA was
amplified using the following oligonucleotide pairs: 1) CD1a,
ATGCTGTTTTTGCTACTTCCATTGTTA/CGTGGGCAGGTGTCACTGAGAAG; 2) CD1b,
ATGCTGCTGCTGCCATTTCAACTGTTA/GGGCAGGTTTCATAGAGGAGAATTC; and 3) CD1c,
ATGCTGTTTCTGCAGTTTCTGCTGCTA/CTGTTTCTGTGACGCCTTCATACTG and ß-actin
(11). The CD1 cDNA products were amplified using 30 cycles (1'
94°C/2' 55°C/2' 72°C) of time/temperature conditions. The
ß-actin cDNA product was amplified using 30 cycles (1 min at 94°C,
2 min at 60°C, and 2 min at 72°C) conditions. PCR products were
separated on a 2% agarose gel, blotted, and probed (11) with
the respective
-32P end-labeled oligonucleotides (CD1a,
CTGGAAGGCATGTTCACTGT; CD1b, CAGCTCACAGCCTCCTGTCACCTG; CD1c,
GCAGCTCACAGCCCGCTTTCACCTG; and ß-actin) (11). Following this
procedure, the filters were exposed to autoradiography films for
analysis.
| Results |
|---|
|
|
|---|
To investigate whether infection with M. tuberculosis
influences the expression of the Ag-presenting molecule CD1, we
developed an experimental system to infect adherent CD1+
cells with a virulent strain of M. tuberculosis. Total PBMC,
which do not constitutively express CD1, were treated with a
combination of GM-CSF and IL-4. After 72 to 96 h, adherent
aggregates of large cells with prominent cytoplasmic processes had
developed. Adherent cells were isolated by discarding the nonadherent
fraction and detaching the remaining cells by Ca2+
chelation. FACS analysis showed expression of high levels of CD1a,
CD1b, CD1c, B7.2, and HLA-DR, as well as expression of B7.1 and CD4
(Fig. 1
). In contrast, staining for the
monocyte/macrophage marker CD14 (Fig. 1
), as well as staining for T
cells (CD3), B cells (CD19), and NK cells (CD56) was negative,
indicating the purity of the cultures. This argues against the
possibility that cytokine production by nonadherent lymphocytes
influences our results. This staining pattern in conjunction with the
morphologic appearance indicates that the cells used in our experiments
are likely to belong to the dendritic cell lineage (7).
|
|
We confirmed our initial finding by studying the CD1 expression on
infected CD1+ APC of nine different donors in independent
experiments. In addition to infecting the cells with viable bacteria,
the cells of four donors were pulsed with heat-killed bacteria in
parallel wells. All donors tested showed a significant down-regulation
of CD1 in response to infection with live M. tuberculosis
after 48 h (Fig. 3
, left
panel). In contrast, incubation with dead mycobacteria had no
effect on CD1 expression (Fig. 3
, right panel). Even
though phagocytosis of live and dead mycobacteria was equally
efficient, the uptake and harboring of the bacteria alone were not
sufficient to induce down-regulation of CD1. Down-regulation of the CD1
molecules from the cell surface of cells infected with viable M.
tuberculosis was not confined to CD1b and was equally prominent
for the two additional isoforms of CD1, CD1a, and CD1c (data not
shown).
|
secretion from a CD1b-restricted T cell line at
different time points after infection. DN.PT is a previously described
CD4-CD8- TCR
ß+ cell line
that specifically recognizes mycolic acids of M.
tuberculosis and lyses CD1+ APC infected with virulent
M. tuberculosis (10). T cells were added to CD1+
APC after 4 or 48 h of infection with live or dead M.
tuberculosis. After 16 h of coincubation, the IFN-
release
was measured by ELISA. There was no difference in the IFN-
secretion
by DN.PT, whether mycobacterial Ag was presented by uninfected or 4-h
infected CD1+ APC (Fig. 4
secretion by DN.PT was completely diminished. In strong
contrast, CD1+ APC infected with heat-killed M.
tuberculosis maintained their capacity to present Ag in a
CD1b-restricted manner throughout the course of the infection. These
studies indicate that infection with live, but not dead M.
tuberculosis results in the functional down-regulation of CD1 from
the cell surface of CD1+ APC.
|
Infection of macrophages with M. tuberculosis induces
the secretion of a variety of cytokines that have been implicated in
reducing the capacity to mount an efficient immune response to
mycobacteria. IL-10 has been shown to reduce the secretion of IFN-
as well as the expression of the costimulatory molecule CTLA-4 on T
cells (12, 13). In addition, IL-10 inhibits the up-regulation of CD1 on
monocytes treated with GM-CSF and IL-4 (14). IL-6 is partly responsible
for the inability of mycobacteria-infected cells to present exogenously
added Ag to T cells (15). Finally, infection of monocytes with M.
tuberculosis induces the secretion of TGF-ß, which inhibits
killing of intracellular mycobacteria (16). We were interested in
whether down-regulation of CD1 would be an additional feature of these
immunosuppressive cytokines. CD1+ APC were infected with
M. tuberculosis and incubated in the presence of blocking
Abs to these cytokines for 48 h. Abs to IL-10, TGF-ß, or IL-6
were not able to inhibit the M. tuberculosis-induced
down-regulation of CD1 (Table I
).
To exclude the possibility that we used an ineffective concentration,
we titered the Abs in the range of 1 to 25 µg/ml and obtained similar
results (data not shown). Growth of the intracellular mycobacteria was
not influenced by the presence of the Abs (data not shown). In
addition, Abs to IL-12 and TNF-
, both secreted by APCs after
infection with M. tuberculosis (16, 17, 18, 19), had no effect
(Table I
).
|
) had an effect on CD1 expression (Table I
The possibility remained that additional cytokines or soluble factors
secreted by infected CD1+ APC or M. tuberculosis
itself could contribute to the down-regulation of CD1. We incubated
uninfected CD1+ APC in the lower chamber of a transwell
system separated from infected CD1+ APC in the upper
chamber by a size-restricting membrane (0.4 µm). Thereby, soluble
mycobacterial and macrophage-derived components are able to traffic
liberally between the chambers, while whole M. tuberculosis
is excluded. No down-regulation was observed in the cells incubated in
the lower chamber of the transwell system, corroborating that soluble
factors are not involved (Table II
).
|
|
The lack of expression of CD1 on the cell surface could be a
consequence of the inhibition of RNA transcription. To investigate this
possibility, we synthesized cDNA from cultures of CD1+ APC
infected with live M. tuberculosis for 48 h, and
performed reverse-transcription PCR to compare the mRNA expression of
CD1a, b, and c between infected cells and uninfected controls. The
striking finding was that infection with M. tuberculosis
induced an almost complete disappearance of mRNA for the three CD1
isoforms (Fig. 6
).
|
| Discussion |
|---|
|
|
|---|
Our study is novel in that it characterizes the impact of an infection
with M. tuberculosis on CD1+ APC. We infected
the adherent fraction of PBMC, which had been treated with GM-CSF and
IL-4, with virulent M. tuberculosis. These cells have
morphologic features and a cell surface phenotype (Fig. 1
) that closely
resemble immature dendritic cells (7, 8). There are several lines of
evidence that cells belonging to the dendritic cell lineage are main
players in the immune response to infection with intracellular
pathogens. First, dendritic cells previously have been shown to
phagocytose not only soluble mycobacterial Ag (20), but also whole
parasites (21) and bacteria (22, 23), including Bacille Calmette Guerin
(24), and M. tuberculosis (25). Second, immunohistologic
studies demonstrated an accumulation of CD1+ cells in the
granulomas of patients with the immune-responsive, tuberculoid form of
leprosy (P. Sieling et al., submitted for publication) as well as in
biopsies of patients with tuberculous lymphadenitis (S. Stenger and P.
Barnes, unpublished observation). Third, in vivo studies have
implicated cells of the dendritic cell lineage in the lymph nodes of
infected mice as a safe target for persisting Leishmania
major (26, 27). However, the mechanism of parasite persistence in
the APC of chronically infected hosts remained unresolved. Our studies
provide first evidence for an evasion strategy that could account for
the ability of a live organism to persist within CD1+
cells. In contrast, in dendritic cells cultured for 7 days, CD1
expression is relatively low and is not reduced by infection with
M. tuberculosis, as reported by Henderson et al. (25).
These data could be interpreted to suggest that in a subject infected
with M. tuberculosis, down-regulation of CD1 expression
would prevent CD1-Ag presentation. However, M.
tuberculosis-reactive CD1-restricted T cells have been identified
in patients with tuberculosis (10, 28). These CD1-restricted T cells
have been shown to lyse APC infected with virulent M.
tuberculosis rapidly within 4 h after the initial contact
(10). The process of lysing the infected target cell can directly or
indirectly result in the death of the bacteria (10). We hypothesize
that the majority of cells infected with M. tuberculosiswill be eliminated during the initial attack of the immune system
initiated by the combined action of 
T cells (29, 30), as well as
MHC class I/II (31, 32) and CD1-restricted T cells. The down-regulation
of CD1, as described in this work, will only occur in those cells,
which have managed to escape this initial immune response. It is
therefore conceivable that CD1-restricted Ag presentation contributes
to the protective immune response to M. tuberculosis during
the acute stage of infection, whereas the few persisting bacteria will
lead to the down-regulation of CD1 during the chronic stage, converting
CD1+ APCs into safe compartments for the pathogen.
Our data show that down-regulation of CD1 on CD1+ APC only occurs if the cells are infected with live M. tuberculosis. In contrast, heat-killed mycobacteria did not affect CD1 expression, indicating that down-regulation of CD1 might require specific interactions between live M. tuberculosis and the host cell machinery. Indeed, the intracellular trafficking pathway between virulent and heat-killed M. tuberculosis involves distinct compartments (33). In addition, only live M. tuberculosis have been suggested to form a pore into their endosomal compartment, thereby facilitating MHC class I-restricted presentation of soluble Ags (34). By this mechanism, components of multiplying mycobacteria could escape from the endosome into the cytosol and affect signal-transduction pathways responsible for CD1 expression.
Our study demonstrates that the down-regulation of CD1 is
unlikely to be an effect of a soluble mediator. First, the
down-regulation of CD1+ APC cannot be achieved by addition
of recombinant cytokines nor be reversed by incubation with Abs that
block cytokine function. Second, the down-regulation is not observed in
a transmembrane system, where infected CD1+ APC are
separated from noninfected cells by a membrane that is only
permeable for soluble mediators, but not bacteria. Third, the number of
infected cells correlates with the number of cells that down-regulate
the CD1 molecule, as demonstrated by the bimodal distribution of the
fluorescence for CD1b (Fig. 5
). Our data suggest that the
down-regulation of CD1 is not the consequence of nonspecific inhibition
of surface molecule expression by infection with live M.
tuberculosis. Importantly, the levels of MHC class I and class II
did not change significantly in response to infection (Fig. 4
),
confirming previous studies using mycobacteria-infected
macrophages (15, 35, 36).
Our data indicate that the down-regulation of surface CD1 expression occurs at the mRNA level, either by the regulation of transcription or increased degradation. Since CD1b expression on stably transfected THP-1 cells (a human monocytic cell line) using a heterologous promoter was not affected by M. tuberculosis infection (data not shown), we propose that the differential regulation of CD1 is occurring during gene transcription and is independent of mRNA stability or processing. M. tuberculosis infection of monocytes has been suggested to affect gene transcription via inhibition of the nuclear translocation of the transcription factor STAT1 in other studies (37). Another example of down-regulation of the expression of mRNA encoding an Ag-presenting molecule by infection with a pathogenic organism has been demonstrated previously, specifically, dendritic cells infected with Rauscher Leukemia virus exhibit decreased MHC class II mRNA levels (38). Analysis of CD1 transcription and mRNA stability should provide insight into the mechanism by which M. tuberculosis decreases CD1 mRNA.
Several evasion strategies of M. tuberculosis have been characterized. In particular, mycobacteria inhibit lysosomal acidification by inhibiting the proton ATPase (39, 40), prevent the fusion of phagosomes with lysosomes (33, 41, 42), circumvent immune recognition by CD4+ cells by sequestering Ag (36), and impair accessory functions of infected monocytes in part by down-regulating HLA-DR (43). In addition to these direct interactions of mycobacteria with intracellular organelles, they also deactivate defense mechanisms of macrophages indirectly by inducing the secretion of immunosuppressive cytokines such as IL-10, TGF-ß, and IL-6 (15, 16). Our study demonstrates that live M. tuberculosis inhibits the functional expression of the Ag-presenting molecule CD1. The characterization of this novel interaction between M. tuberculosis and the host cell extends our understanding of the ability of intracellular pathogens to persist in the host.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Institut fuer Klinische Mikrobiologie, Immunologie, und Hygiene, Wasserturmstr. 3, D-91054 Erlangen, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Robert L. Modlin, Division of Dermatology, 52-121 CHS, University of California, Los Angeles, School of Medicine, 10833 Le Conte Ave., Los Angeles, CA 90095. E-mail address: ![]()
4 Abbreviations used in this paper: GM-CSF, granulocyte-macrophage CSF; MOI, multiplicity of infection; PE, phycoerythrin; rhu, recombinant human. ![]()
Received for publication September 9, 1997. Accepted for publication June 1, 1998.
| References |
|---|
|
|
|---|
. J. Exp. Med. 179:1109.
production by T helper 1 cells. Eur. J. Immunol. 26:659.[Medline]

by an antigen derived from Mycobacterium tuberculosis. Cell 57:667.[Medline]
/
T-cell receptors in human infectious disease lesions. Nature 339:544.[Medline]
This article has been cited by other articles:
![]() |
S. Mathew, K. L. Bauer, A. Fischoeder, N. Bhardwaj, and S. J. Oliver The Anergic State in Sarcoidosis Is Associated with Diminished Dendritic Cell Function J. Immunol., July 1, 2008; 181(1): 746 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Raftery, M. Hitzler, F. Winau, T. Giese, B. Plachter, S. H. E. Kaufmann, and G. Schonrich Inhibition of CD1 Antigen Presentation by Human Cytomegalovirus J. Virol., May 1, 2008; 82(9): 4308 - 4319. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roura-Mir, L. Wang, T.-Y. Cheng, I. Matsunaga, C. C. Dascher, S. L. Peng, M. J. Fenton, C. Kirschning, and D. B. Moody Mycobacterium tuberculosis Regulates CD1 Antigen Presentation Pathways through TLR-2 J. Immunol., August 1, 2005; 175(3): 1758 - 1766. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Patton, T. C. McGuire, M. T. Hines, R. H. Mealey, and S. A. Hines Rhodococcus equi-Specific Cytotoxic T Lymphocytes in Immune Horses and Development in Asymptomatic Foals Infect. Immun., April 1, 2005; 73(4): 2083 - 2093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Buettner, C. Meinken, M. Bastian, R. Bhat, E. Stossel, G. Faller, G. Cianciolo, J. Ficker, M. Wagner, M. Rollinghoff, et al. Inverse Correlation of Maturity and Antibacterial Activity in Human Dendritic Cells J. Immunol., April 1, 2005; 174(7): 4203 - 4209. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lin, T. J. Roberts, P. M. Spence, and R. R. Brutkiewicz Reduction in CD1d expression on dendritic cells and macrophages by an acute virus infection J. Leukoc. Biol., February 1, 2005; 77(2): 151 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martino, A. Sacchi, N. Sanarico, F. Spadaro, C. Ramoni, A. Ciaramella, L. P. Pucillo, V. Colizzi, and S. Vendetti Dendritic cells derived from BCG-infected precursors induce Th2-like immune response J. Leukoc. Biol., October 1, 2004; 76(4): 827 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mariotti, R. Teloni, E. Iona, L. Fattorini, G. Romagnoli, M. C. Gagliardi, G. Orefici, and R. Nisini Mycobacterium tuberculosis Diverts Alpha Interferon-Induced Monocyte Differentiation from Dendritic Cells into Immunoprivileged Macrophage-Like Host Cells Infect. Immun., August 1, 2004; 72(8): 4385 - 4392. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Roy, G. Bandyopadhyay, S. Rakshit, M. Ray, and S. Bandyopadhyay IL-4 alone without the involvement of GM-CSF transforms human peripheral blood monocytes to a CD1adim, CD83+ myeloid dendritic cell subset J. Cell Sci., July 15, 2004; 117(16): 3435 - 3445. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Moody, D. C. Young, T.-Y. Cheng, J.-P. Rosat, C. Roura-mir, P. B. O'Connor, D. M. Zajonc, A. Walz, M. J. Miller, S. B. Levery, et al. T Cell Activation by Lipopeptide Antigens Science, January 23, 2004; 303(5657): 527 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Amprey, G. F. Spath, and S. A. Porcelli Inhibition of CD1 Expression in Human Dendritic Cells during Intracellular Infection with Leishmania donovani Infect. Immun., January 1, 2004; 72(1): 589 - 592. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Gansert, V. Kiebler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, S. A. Porcelli, R. L. Modlin, and S. Stenger Human NKT Cells Express Granulysin and Exhibit Antimycobacterial Activity J. Immunol., March 15, 2003; 170(6): 3154 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chackerian, J. Alt, V. Perera, and S. M. Behar Activation of NKT Cells Protects Mice from Tuberculosis Infect. Immun., November 1, 2002; 70(11): 6302 - 6309. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. DesJardin, T. M. Kaufman, B. Potts, B. Kutzbach, H. Yi, and L. S. Schlesinger Mycobacterium tuberculosis-infected human macrophages exhibit enhanced cellular adhesion with increased expression of LFA-1 and ICAM-1 and reduced expression and/or function of complement receptors, Fc{gamma}RII and the mannose receptor Microbiology, October 1, 2002; 148(10): 3161 - 3171. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Giuliani, S. P. Prete, G. Graziani, A. Aquino, A. Balduzzi, M. Sugita, M. B. Brenner, E. Iona, L. Fattorini, G. Orefici, et al. Influence of Mycobacterium bovis Bacillus Calmette Guerin on In Vitro Induction of CD1 Molecules in Human Adherent Mononuclear Cells Infect. Immun., December 1, 2001; 69(12): 7461 - 7470. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.M. Rhind CD1--The Pathology Perspective Vet. Pathol., November 1, 2001; 38(6): 611 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Cutler, R. Jotwani, and B. Pulendran Dendritic Cells: Immune Saviors or Achilles' Heel? Infect. Immun., August 1, 2001; 69(8): 4703 - 4708. [Full Text] [PDF] |
||||
![]() |
S. Master, T. C. Zahrt, J. Song, and V. Deretic Mapping of Mycobacterium tuberculosis katG Promoters and Their Differential Expression in Infected Macrophages J. Bacteriol., July 1, 2001; 183(13): 4033 - 4039. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.A.W. Rook, G. Seah, and A. Ustianowski M. tuberculosis: immunology and vaccination Eur. Respir. J., March 1, 2001; 17(3): 537 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. E. Aldwell, B. L. Dicker, F. M. Da Silva Tatley, M. F. Cross, S. Liggett, C. G. Mackintosh, and J. F. T. Griffin Mycobacterium bovis-Infected Cervine Alveolar Macrophages Secrete Lymphoreactive Lipid Antigens Infect. Immun., December 1, 2000; 68(12): 7003 - 7009. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Ullrich, W. L. Beatty, and D. G. Russell Interaction of Mycobacterium avium-Containing Phagosomes with the Antigen Presentation Pathway J. Immunol., December 1, 2000; 165(11): 6073 - 6080. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thoma-Uszynski, S. Stenger, and R. L. Modlin CTL-Mediated Killing of Intracellular Mycobacterium tuberculosis Is Independent of Target Cell Nuclear Apoptosis J. Immunol., November 15, 2000; 165(10): 5773 - 5779. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Lewinsohn, A. L. Briden, S. G. Reed, K. H. Grabstein, and M. R. Alderson Mycobacterium tuberculosis-Reactive CD8+ T Lymphocytes: The Relative Contribution of Classical Versus Nonclassical HLA Restriction J. Immunol., July 15, 2000; 165(2): 925 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fortsch, M. Rollinghoff, and S. Stenger IL-10 Converts Human Dendritic Cells into Macrophage-Like Cells with Increased Antibacterial Activity Against Virulent Mycobacterium tuberculosis J. Immunol., July 15, 2000; 165(2): 978 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. E. Schaible, K. Hagens, K. Fischer, H. L. Collins, and S. H. E. Kaufmann Intersection of Group I CD1 Molecules and Mycobacteria in Different Intracellular Compartments of Dendritic Cells J. Immunol., May 1, 2000; 164(9): 4843 - 4852. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Sieling, D. Jullien, M. Dahlem, T. F. Tedder, T. H. Rea, R. L. Modlin, and S. A. Porcelli CD1 Expression by Dendritic Cells in Human Leprosy Lesions: Correlation with Effective Host Immunity J. Immunol., February 1, 1999; 162(3): 1851 - 1858. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |