The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stenger, S.
Right arrow Articles by Modlin, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenger, S.
Right arrow Articles by Modlin, R. L.
The Journal of Immunology, 1998, 161: 3582-3588.
Copyright © 1998 by The American Association of Immunologists

Down-Regulation of CD1 on Antigen-Presenting Cells by Infection with Mycobacterium tuberculosis1

Steffen Stenger2, Kayvan R. Niazi and Robert L. Modlin3

Division of Dermatology and Department of Microbiology and Immunology, University of California, Los Angeles, School of Medicine, Los Angeles, CA 90095


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intracellular pathogens have developed efficient evasion strategies to survive the defenses of the host immune system. In this study, we describe a new escape mechanism utilized by Mycobacterium tuberculosis that involves the down-regulation of the Ag-presenting molecule CD1 from the cell surface of CD1+ APCs. The loss of CD1 from the cell surface is associated with a complete inhibition of the ability of the infected cells to present Ag to CD1-restricted T cells. The down-regulation of Ag-presenting molecules on CD1+ APC by infection with M. tuberculosis is unique for CD1, since the expression of the classical Ag-presenting molecules MHC class I and MHC class II is not influenced. Our data show that efficient down-regulation of CD1 requires infection of the cells with live mycobacteria, since heat killing of the bacteria completely abrogates the effect. The observed down-regulation is not due to the secretion of cytokines or other host- or pathogen-derived factors. Investigation of upstream events responsible for the down-regulation of CD1 revealed that infection with live M. tuberculosis decreased the steady state CD1-mRNA levels. This study introduces a novel evasion mechanism of M. tuberculosis that could contribute to persistence of intracellular infection by avoiding immune recognition.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Successful elimination of the intracellular pathogen Mycobacterium tuberculosis depends mainly on the efficient interplay of infected macrophages with Ag-specific T cells. In 90 to 95% of persons who are exposed to M. tuberculosis, the interactions of the different components of the cellular immune response prevent clinically overt disease (1). However, even if an inapparent tuberculous infection heals, bacilli may persist in a dormant state (2). Latency of infection can last lifelong or lead to active disease when the efficiency of the immune system is impaired (e.g., old age (3), corticosteroids (4), or AIDS (5, 6)).

Macrophages are critical cells in the pathogenesis of tuberculosis infection. Initially, the macrophage serves as the host cell for the pathogen. However, upon receipt of appropriate activation signals from Ag-specific T cells, the macrophage converts into a powerful effector cell with the ability to kill its invader. A central role for macrophages is the presentation of Ags to T cells. Classically, macrophages present peptides to T cells in the context of MHC class I and II molecules. Recently, a new Ag presentation pathway involving the CD1 proteins has been identified. These polypeptides are expressed constitutively on professional APCs and can be induced on peripheral blood monocytes by treatment with granulocyte-macrophage CSF (GM-CSF)4 and IL-4 (7, 8). A unique feature of CD1-Ag presentation is the presentation of lipid and lipoglycan Ags to T cells. CD1-restricted T cells can contribute to protective immunity by the production of high levels of IFN-{gamma} (9) and lysis of macrophages infected with virulent M. tuberculosis, leading to the killing of intracellular bacteria (10).

We considered the possibility that the CD1-Ag presentation pathway system might be an attractive target for M. tuberculosis in its attempt to escape recognition and destruction by the immune system. We therefore infected CD1+ APC with a virulent strain of M. tuberculosis and investigated the impact of the infection on CD1-Ag presentation. We found that infection with M. tuberculosis leads to the down-regulation of surface CD1 expression at the mRNA level. The resulting inability of infected cells to present Ag to CD1-restricted T cells demonstrates a novel evasion strategy utilized by an intracellular pathogen to circumvent immune recognition.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture reagents

T cells were cultured in RPMI 1640 (Life Technologies, Grand Island, NY) supplemented with 0.1 mM sodium pyruvate, 2 mM glutamine (Sigma, St. Louis, MO), 8% FCS (HyClone Laboratories, Logan, UT), and 2% heat-inactivated human serum. Experiments only involving APCs were performed in 10% FCS.

Cytokines and Abs

The following cytokines and Abs were used: recombinant human (rhu) IL-6 (R&D Systems, Minneapolis, MN), rhuIL-12 (gift of M. Gately, Roche, Nutley, NJ), rhuIL-10 (gift of K. Moore, DNAX, Palo Alto, CA), rhuTNF-{alpha} (Endogen, Woburn, MA), purified TGF-ß (R&D Systems, Minneapolis, MN), anti-IL-6 (Biosource International, Camarillo, CA; clone B-E8), anti-IL-12 (Roche; clone 2-4A1), anti-IL-10 (PharMingen, San Diego, CA; clone JES3-9D7), anti-TGF-ß (Genzyme, Cambridge, MA), anti-TNF-{alpha} (polyclonal), IgG1 FITC (Caltag, Burlingame, CA), IgG1 (Sigma), and IgG2a (Sigma).

Growth of M. tuberculosis

M. tuberculosis (virulent strain H37Rv) was grown in suspension with constant, gentle rotation in roller bottles containing Middlebrook 7H9 broth (Difco, Detroit, MI) supplemented with glycerol, 0.05% Tween-80 (Sigma), and 10% Middlebrook OADC enrichment (Difco). Aliquots from logarithmically growing cultures were frozen in PBS containing 10% glycerol, and representative vials were thawed and enumerated for viable CFU on Middlebrook 7H11 plates. Comparison of microscope counts of mycobacteria and their growth on agar plates revealed a viability of the bacteria above 90%. Since clumping of mycobacteria is a common problem that can influence the validity and reproducibility of the experiments, we undertook several precautions to minimize clumps: 1) Culture conditions were chosen to support the growth of single cell suspensions. 2) Before in vitro infection, M. tuberculosis bacilli were sonicated to disrupt small aggregates of bacteria. 3) The multiplicity of infection (MOI) was selected such that there were only two to three bacilli per APC. 4) At the conclusion of every assay, an aliquot of infected cells was stained with auramine rhodamine to confirm the absence of any clumps.

Infection of CD1+ APC

PBMCs from healthy donors were treated with GM-CSF (200 U/ml) and IL-4 (100 U/ml) for 3 days. Adherent cells were detached by treatment with 1 mM EDTA (Sigma) and replated in six-well plates at a density of 3 x 106 cells/well. Monolayers were infected with single cell suspensions of M. tuberculosis. In some experiments, bacteria were heat killed before infection by incubation at 80°C for 30 min. This treatment killed all mycobacteria, as determined by CFU count. The gross morphology of the heat-killed bacteria was not altered according to auramine-rhodamine and Ziehl-Neelsen staining. After 4-h incubation, extracellular bacteria were removed by extensive washing. The efficiency of infection was quantitated in each experiment by staining of parallel cultures with auramine-rhodamine. In all experiments, the efficiency of infection was 3.47 ± 0.27 bacteria/cell, whereby 81 ± 4% of the cells were infected. No differences were observed in cultures infected with live or heat-killed M. tuberculosis. The microscopic evaluation of infected macrophages under the fluorescence microscope confirmed the absence of any mycobacterial aggregates. Cell viability of infected APC was determined by measuring the enzymatic activity of lactate dehydrogenase in the culture supernatant (CytoTox 96; Promega, Madison, WI).

FACS analysis

CD1+ APCs were pulse infected for 4 h, as described above, and incubated for different time intervals. In some experiments, recombinant cytokines or Abs to cytokines were added during the incubation period. At indicated time points, cells were harvested by treatment with 1 mM EDTA and washed. A total of 3 x 105 cells was resuspended in 100 µl FACS buffer (2% FCS, 1% NaN3, PBS without Mg2+/Ca2+) and incubated with unconjugated (MHC class I, clone W6/32, and MHC class II, clone L243, both obtained from American Type Culture Collection (ATCC), Manassas, MD; IgG1 control, obtained from Sigma, final concentration 2.5 µg/ml) or conjugated Abs (anti-CD1a FITC, clone OKT6 obtained from ATCC; anti-CD1b FITC, clone WM-25, Serotec, Raleigh, NC; IgG1 FITC, IgG2a FITC, HLA-DR FITC, all obtained from Caltag; CD14 PE, B7.1 PE, B7.2 PE, IgG PE, all obtained from Becton Dickinson, Mountain View, CA; 3 µl/sample) for 30 min on ice. Samples were washed twice in FACS buffer, and if necessary, an incubation for additional 30 min on ice with goat anti-mouse FITC Abs (Caltag; 1:250) followed. Cells were then fixed in 2% paraformaldehyde and stored at 4°C until analysis on a FACScan flow cytometer, and data were analyzed using Winmdi software.

Transwell experiment

CD1+ APCs were infected and harvested as described above. A total of 1 x 106 infected cells was plated in the upper chamber of a transfer system (Costar, Cambridge, MA; six-well plates), which is separated from the lower chamber by a membrane permeable only for particles smaller than 0.4 µm. The diameter of the pores allows cytokines and secreted mycobacterial Ags, but not whole bacteria to pass. In the lower chamber, 3 x 106 uninfected CD1+ APC were cultured. After 48 h, the cells in the lower chamber were detached and FACS staining was performed, as described above.

IFN-{gamma} ELISA

CD1+ APC were infected with live or pulsed with dead M. tuberculosis, as described above. Immediately after the end of the 4-h pulse infection or after an additional culture of 48 h, cells were detached by treatment with 1 mM EDTA. To determine their capacity to present Ag of the phagocytosed mycobacteria, 1 x 104 cells were replated in triplicates in 96-well round-bottom plates. T cells (1 x 104) were added (final volume 200 µl), and after a coincubation of 16 h, supernatants were assayed for IFN-{gamma} content in a capture ELISA using two distinct IFN-{gamma} Abs (Endogen). Ninety-six-well plates were coated with capture Abs, blocked, and incubated with IFN-{gamma} standards or the culture supernatants. The captured IFN-{gamma} was detected with a biotinylated anti-IFN-{gamma} detection Ab, followed by incubation with streptavidin-peroxidase (Sigma) and the chromogenic peroxidase substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD). The absorbance at 405 nm was measured with an ELISA plate reader, and the IFN-{gamma} concentrations were determined from the standard curve.

RT-PCR and Southern blot analysis

The synthesis of cDNA from 2 x 106 CD1+ APC was performed as described (11). The cDNA was amplified using the following oligonucleotide pairs: 1) CD1a, ATGCTGTTTTTGCTACTTCCATTGTTA/CGTGGGCAGGTGTCACTGAGAAG; 2) CD1b, ATGCTGCTGCTGCCATTTCAACTGTTA/GGGCAGGTTTCATAGAGGAGAATTC; and 3) CD1c, ATGCTGTTTCTGCAGTTTCTGCTGCTA/CTGTTTCTGTGACGCCTTCATACTG and ß-actin (11). The CD1 cDNA products were amplified using 30 cycles (1' 94°C/2' 55°C/2' 72°C) of time/temperature conditions. The ß-actin cDNA product was amplified using 30 cycles (1 min at 94°C, 2 min at 60°C, and 2 min at 72°C) conditions. PCR products were separated on a 2% agarose gel, blotted, and probed (11) with the respective {gamma}-32P end-labeled oligonucleotides (CD1a, CTGGAAGGCATGTTCACTGT; CD1b, CAGCTCACAGCCTCCTGTCACCTG; CD1c, GCAGCTCACAGCCCGCTTTCACCTG; and ß-actin) (11). Following this procedure, the filters were exposed to autoradiography films for analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Down-regulation of CD1 expression in CD1+ APCs

To investigate whether infection with M. tuberculosis influences the expression of the Ag-presenting molecule CD1, we developed an experimental system to infect adherent CD1+ cells with a virulent strain of M. tuberculosis. Total PBMC, which do not constitutively express CD1, were treated with a combination of GM-CSF and IL-4. After 72 to 96 h, adherent aggregates of large cells with prominent cytoplasmic processes had developed. Adherent cells were isolated by discarding the nonadherent fraction and detaching the remaining cells by Ca2+ chelation. FACS analysis showed expression of high levels of CD1a, CD1b, CD1c, B7.2, and HLA-DR, as well as expression of B7.1 and CD4 (Fig. 1Go). In contrast, staining for the monocyte/macrophage marker CD14 (Fig. 1Go), as well as staining for T cells (CD3), B cells (CD19), and NK cells (CD56) was negative, indicating the purity of the cultures. This argues against the possibility that cytokine production by nonadherent lymphocytes influences our results. This staining pattern in conjunction with the morphologic appearance indicates that the cells used in our experiments are likely to belong to the dendritic cell lineage (7).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. Total PBMC were treated with GM-CSF (200 U/ml) and IL-4 (100 U/ml) for 3 days. The expression of cell surface markers (——) was analyzed on the adherent fraction (CD1+ APC) by FACS using directly conjugated Abs or an isotype control (---). The figure shows one representative experiment of six.

 
CD1+ APC were infected with M. tuberculosis at an MOI of 10:1 for 4 h. This protocol resulted in an infection efficiency of 83% with approximately three bacteria per cell. The level of CD1b expression on the cell surface of infected CD1+ APC was determined at different time points after infection by FACS analysis. After 4 h of infection, no significant differences were observed between the infected cells and the uninfected controls (Fig. 2Go). However, after 24 h, the intensity of the CD1a, CD1b, and CD1c staining on the cell surface started to decline and was not detectable after 48 h. Uninfected CD1+ APC maintained the high level of CD1 expression throughout the duration of the experiment (Fig. 2Go).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. CD1b expression on CD1+ APC infected with live M. tuberculosis. CD1+ APC were infected with live M. tuberculosis at an MOI of 10. At indicated time points, cells were detached and the expression of cell surface markers was analyzed by flow cytometry using FITC-conjugated Abs (——) or an isotype control mAb (---). The figure shows the results from one representative experiment of three.

 
Down-regulation of CD1 could reflect a nonspecific inhibition of Ag presentation molecules on infected APC. We therefore investigated the expression of the classical Ag-presenting molecules MHC class I or class II in the same experiment. Expression of both class I and class II molecules was not affected by infection with live M. tuberculosis at any time point (Fig. 2Go). At 48 h of infection, CD1+ APC harbored approximately seven to eight bacteria and more than 95% of the cells were infected. Despite the high bacterial burden, the viability of the cells was above 80%, as determined by release of lactate dehydrogenase in the supernatant.

We confirmed our initial finding by studying the CD1 expression on infected CD1+ APC of nine different donors in independent experiments. In addition to infecting the cells with viable bacteria, the cells of four donors were pulsed with heat-killed bacteria in parallel wells. All donors tested showed a significant down-regulation of CD1 in response to infection with live M. tuberculosis after 48 h (Fig. 3Go, left panel). In contrast, incubation with dead mycobacteria had no effect on CD1 expression (Fig. 3Go, right panel). Even though phagocytosis of live and dead mycobacteria was equally efficient, the uptake and harboring of the bacteria alone were not sufficient to induce down-regulation of CD1. Down-regulation of the CD1 molecules from the cell surface of cells infected with viable M. tuberculosis was not confined to CD1b and was equally prominent for the two additional isoforms of CD1, CD1a, and CD1c (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. CD1b expression on CD1+ APC infected with live or dead M. tuberculosis. PBMC from different donors were incubated for 3 days in GM-CSF and IL-4, and the adherent cells were infected with live (left panel) or heat-killed (right panel) M. tuberculosis at an MOI of 10. After 48 h, cells were detached and expression of CD1b was analyzed by flow cytometry with anti-CD1b FITC mAb or an isotype control mAb. Results are expressed as percentage of positive cells as compared with the isotype control. The p value was calculated according to the Signed rank test for paired samples.

 
To investigate the biologic implication of this finding, we tested the functional activity of CD1+ APC infected with M. tuberculosis. We evaluated the capacity of infected cells to stimulate IFN-{gamma} secretion from a CD1b-restricted T cell line at different time points after infection. DN.PT is a previously described CD4-CD8- TCR {alpha}ß+ cell line that specifically recognizes mycolic acids of M. tuberculosis and lyses CD1+ APC infected with virulent M. tuberculosis (10). T cells were added to CD1+ APC after 4 or 48 h of infection with live or dead M. tuberculosis. After 16 h of coincubation, the IFN-{gamma} release was measured by ELISA. There was no difference in the IFN-{gamma} secretion by DN.PT, whether mycobacterial Ag was presented by uninfected or 4-h infected CD1+ APC (Fig. 4Go). However, after 48 h of infection with live mycobacteria, the IFN-{gamma} secretion by DN.PT was completely diminished. In strong contrast, CD1+ APC infected with heat-killed M. tuberculosis maintained their capacity to present Ag in a CD1b-restricted manner throughout the course of the infection. These studies indicate that infection with live, but not dead M. tuberculosis results in the functional down-regulation of CD1 from the cell surface of CD1+ APC.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 4. Ag-presenting function of CD1+ APC infected with M. tuberculosis. Adherent CD1+ APC were infected with live or heat-killed M. tuberculosis at an MOI of 10. Uninfected controls were cultured identically. After 4 and 48 h, cells were harvested and replated at a density of 3 x 104/200 µl in a 96-well plate. Infected cells were then coincubated with 1 x 104 DN.PT for 16 h, and the IFN-{gamma} release in the supernatants was determined by ELISA. In indicated wells, cells were incubated in the presence of a blocking Ab to CD1b (10 µg/ml). The figure shows the results from one representative experiment of three.

 
Down-regulation of CD1 is not due to a soluble factor

Infection of macrophages with M. tuberculosis induces the secretion of a variety of cytokines that have been implicated in reducing the capacity to mount an efficient immune response to mycobacteria. IL-10 has been shown to reduce the secretion of IFN-{gamma} as well as the expression of the costimulatory molecule CTLA-4 on T cells (12, 13). In addition, IL-10 inhibits the up-regulation of CD1 on monocytes treated with GM-CSF and IL-4 (14). IL-6 is partly responsible for the inability of mycobacteria-infected cells to present exogenously added Ag to T cells (15). Finally, infection of monocytes with M. tuberculosis induces the secretion of TGF-ß, which inhibits killing of intracellular mycobacteria (16). We were interested in whether down-regulation of CD1 would be an additional feature of these immunosuppressive cytokines. CD1+ APC were infected with M. tuberculosis and incubated in the presence of blocking Abs to these cytokines for 48 h. Abs to IL-10, TGF-ß, or IL-6 were not able to inhibit the M. tuberculosis-induced down-regulation of CD1 (Table IGo). To exclude the possibility that we used an ineffective concentration, we titered the Abs in the range of 1 to 25 µg/ml and obtained similar results (data not shown). Growth of the intracellular mycobacteria was not influenced by the presence of the Abs (data not shown). In addition, Abs to IL-12 and TNF-{alpha}, both secreted by APCs after infection with M. tuberculosis (16, 17, 18, 19), had no effect (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Down-regulation of CD1 is independent of cytokines1

 
To confirm that cytokines induced by M. tuberculosis are not involved in the down-regulation of CD1, we added recombinant cytokines to uninfected CD1+ APC for 48 h and asked whether they would affect expression of CD1. None of the cytokines tested (IL-10, TGF-ß, IL-6, IL-12, TNF-{alpha}) had an effect on CD1 expression (Table IGo). Table IGo presents results using cytokine concentrations of 10 ng/ml; however, when concentrations were varied between 1 and 25 ng/ml, the results were similar (data not shown).

The possibility remained that additional cytokines or soluble factors secreted by infected CD1+ APC or M. tuberculosis itself could contribute to the down-regulation of CD1. We incubated uninfected CD1+ APC in the lower chamber of a transwell system separated from infected CD1+ APC in the upper chamber by a size-restricting membrane (0.4 µm). Thereby, soluble mycobacterial and macrophage-derived components are able to traffic liberally between the chambers, while whole M. tuberculosis is excluded. No down-regulation was observed in the cells incubated in the lower chamber of the transwell system, corroborating that soluble factors are not involved (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Down-regulation of CD1 is independent of secreted factorsa

 
Since down-regulation of CD1 occurs independently of secreted factors, we hypothesized that the immediate interaction of M. tuberculosis with its host cell is a precondition for the down-modulation of CD1. To test this, we infected CD1+ APC at different MOIs to achieve graduated amounts of infected cells. The number of infected cells correlated very well with the extent of down-regulation of CD1 (Fig. 5Go). At an MOI of one, 23% of the cells were infected and the number of CD1+ cells decreased from 64 to 37%. With increasing numbers of bacteria resulting in a higher efficiency of infection, the surface CD1 expression declined gradually until finally dropping to background levels when 93% of the cells were infected. These data confirm our earlier findings and suggest that down-regulation of CD1 requires the active interaction of M. tuberculosis with the host cell machinery.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of different MOIs on the expression of CD1b on CD1+ APC infected with live M. tuberculosis. CD1+ APC were infected with live M. tuberculosis using MOIs, as indicated. After 48 h, cells were detached and expression of CD1b was analyzed by flow cytometry with anti-CD1b FITC. The percentage of cells infected was determined by microscopic evaluation of Ziehl-Neelsen-stained samples. The figure shows the results from one representative experiment of three.

 
Mechanism of the down-regulation of CD1

The lack of expression of CD1 on the cell surface could be a consequence of the inhibition of RNA transcription. To investigate this possibility, we synthesized cDNA from cultures of CD1+ APC infected with live M. tuberculosis for 48 h, and performed reverse-transcription PCR to compare the mRNA expression of CD1a, b, and c between infected cells and uninfected controls. The striking finding was that infection with M. tuberculosis induced an almost complete disappearance of mRNA for the three CD1 isoforms (Fig. 6Go).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 6. Expression of CD1 isoform mRNA in infected cells. CD1+ cells were infected with live M. tuberculosis at an MOI of 10. After 48 h, cells were detached, and the amount of mRNA for CD1a, b, and c was compared between infected and uninfected cells. The ß-actin cDNA product was used for standardization of input cDNA prior to amplification. The template cDNAs were serially diluted prior to PCR in order to eliminate the possibility of PCR amplification artifacts. The figure shows the results from one representative experiment of three.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Understanding the evasion strategies that allow intracellular pathogens to persist within the cell requires knowledge of the mechanisms resulting in the inability of the host immune system to detect infected cells. The present study was designed to investigate whether intracellular pathogens interfere with the expression and function of the recently characterized nonclassical Ag-presenting molecule CD1. Using M. tuberculosis as a prototypic pathogen with the capability to persist within macrophages, we describe and characterize the down-regulation of CD1 on CD1+ APC by live mycobacteria. This resulted in the inability of protective CD1-restricted T cells to recognize mycobacterial lipid Ags on the cell surface of the host monocytes. These data introduce a new mechanism utilized by an intracellular human pathogen to evade the immune response.

Our study is novel in that it characterizes the impact of an infection with M. tuberculosis on CD1+ APC. We infected the adherent fraction of PBMC, which had been treated with GM-CSF and IL-4, with virulent M. tuberculosis. These cells have morphologic features and a cell surface phenotype (Fig. 1Go) that closely resemble immature dendritic cells (7, 8). There are several lines of evidence that cells belonging to the dendritic cell lineage are main players in the immune response to infection with intracellular pathogens. First, dendritic cells previously have been shown to phagocytose not only soluble mycobacterial Ag (20), but also whole parasites (21) and bacteria (22, 23), including Bacille Calmette Guerin (24), and M. tuberculosis (25). Second, immunohistologic studies demonstrated an accumulation of CD1+ cells in the granulomas of patients with the immune-responsive, tuberculoid form of leprosy (P. Sieling et al., submitted for publication) as well as in biopsies of patients with tuberculous lymphadenitis (S. Stenger and P. Barnes, unpublished observation). Third, in vivo studies have implicated cells of the dendritic cell lineage in the lymph nodes of infected mice as a safe target for persisting Leishmania major (26, 27). However, the mechanism of parasite persistence in the APC of chronically infected hosts remained unresolved. Our studies provide first evidence for an evasion strategy that could account for the ability of a live organism to persist within CD1+ cells. In contrast, in dendritic cells cultured for 7 days, CD1 expression is relatively low and is not reduced by infection with M. tuberculosis, as reported by Henderson et al. (25).

These data could be interpreted to suggest that in a subject infected with M. tuberculosis, down-regulation of CD1 expression would prevent CD1-Ag presentation. However, M. tuberculosis-reactive CD1-restricted T cells have been identified in patients with tuberculosis (10, 28). These CD1-restricted T cells have been shown to lyse APC infected with virulent M. tuberculosis rapidly within 4 h after the initial contact (10). The process of lysing the infected target cell can directly or indirectly result in the death of the bacteria (10). We hypothesize that the majority of cells infected with M. tuberculosiswill be eliminated during the initial attack of the immune system initiated by the combined action of {gamma}{delta} T cells (29, 30), as well as MHC class I/II (31, 32) and CD1-restricted T cells. The down-regulation of CD1, as described in this work, will only occur in those cells, which have managed to escape this initial immune response. It is therefore conceivable that CD1-restricted Ag presentation contributes to the protective immune response to M. tuberculosis during the acute stage of infection, whereas the few persisting bacteria will lead to the down-regulation of CD1 during the chronic stage, converting CD1+ APCs into safe compartments for the pathogen.

Our data show that down-regulation of CD1 on CD1+ APC only occurs if the cells are infected with live M. tuberculosis. In contrast, heat-killed mycobacteria did not affect CD1 expression, indicating that down-regulation of CD1 might require specific interactions between live M. tuberculosis and the host cell machinery. Indeed, the intracellular trafficking pathway between virulent and heat-killed M. tuberculosis involves distinct compartments (33). In addition, only live M. tuberculosis have been suggested to form a pore into their endosomal compartment, thereby facilitating MHC class I-restricted presentation of soluble Ags (34). By this mechanism, components of multiplying mycobacteria could escape from the endosome into the cytosol and affect signal-transduction pathways responsible for CD1 expression.

Our study demonstrates that the down-regulation of CD1 is unlikely to be an effect of a soluble mediator. First, the down-regulation of CD1+ APC cannot be achieved by addition of recombinant cytokines nor be reversed by incubation with Abs that block cytokine function. Second, the down-regulation is not observed in a transmembrane system, where infected CD1+ APC are separated from noninfected cells by a membrane that is only permeable for soluble mediators, but not bacteria. Third, the number of infected cells correlates with the number of cells that down-regulate the CD1 molecule, as demonstrated by the bimodal distribution of the fluorescence for CD1b (Fig. 5Go). Our data suggest that the down-regulation of CD1 is not the consequence of nonspecific inhibition of surface molecule expression by infection with live M. tuberculosis. Importantly, the levels of MHC class I and class II did not change significantly in response to infection (Fig. 4Go), confirming previous studies using mycobacteria-infected macrophages (15, 35, 36).

Our data indicate that the down-regulation of surface CD1 expression occurs at the mRNA level, either by the regulation of transcription or increased degradation. Since CD1b expression on stably transfected THP-1 cells (a human monocytic cell line) using a heterologous promoter was not affected by M. tuberculosis infection (data not shown), we propose that the differential regulation of CD1 is occurring during gene transcription and is independent of mRNA stability or processing. M. tuberculosis infection of monocytes has been suggested to affect gene transcription via inhibition of the nuclear translocation of the transcription factor STAT1 in other studies (37). Another example of down-regulation of the expression of mRNA encoding an Ag-presenting molecule by infection with a pathogenic organism has been demonstrated previously, specifically, dendritic cells infected with Rauscher Leukemia virus exhibit decreased MHC class II mRNA levels (38). Analysis of CD1 transcription and mRNA stability should provide insight into the mechanism by which M. tuberculosis decreases CD1 mRNA.

Several evasion strategies of M. tuberculosis have been characterized. In particular, mycobacteria inhibit lysosomal acidification by inhibiting the proton ATPase (39, 40), prevent the fusion of phagosomes with lysosomes (33, 41, 42), circumvent immune recognition by CD4+ cells by sequestering Ag (36), and impair accessory functions of infected monocytes in part by down-regulating HLA-DR (43). In addition to these direct interactions of mycobacteria with intracellular organelles, they also deactivate defense mechanisms of macrophages indirectly by inducing the secretion of immunosuppressive cytokines such as IL-10, TGF-ß, and IL-6 (15, 16). Our study demonstrates that live M. tuberculosis inhibits the functional expression of the Ag-presenting molecule CD1. The characterization of this novel interaction between M. tuberculosis and the host cell extends our understanding of the ability of intracellular pathogens to persist in the host.


    Acknowledgments
 
We thank Drs. R. Mazzaccaro and B. Bloom for insightful discussions and for supplying us with M. tuberculosis, Dr. Marcus Horwitz for allowing us to use his P3 laboratory, and Varianny Hartono for expert technical assistance.


    Footnotes
 
1 S.S. is funded by the AIDS Stipendium, Deutsches Krebsforschungs-zentrum (Heidelberg, Germany). This work was supported by National Institutes of Health Grants AI22553, AR40312, and AI36069; by the United Nations Development Program/World Bank/World Health Organization Special Program for Research and Training in Tropical Diseases (IMMLEP); and by the Dermatology Research Foundation of California; Inc. Back

2 Current address: Institut fuer Klinische Mikrobiologie, Immunologie, und Hygiene, Wasserturmstr. 3, D-91054 Erlangen, Germany. Back

3 Address correspondence and reprint requests to Dr. Robert L. Modlin, Division of Dermatology, 52-121 CHS, University of California, Los Angeles, School of Medicine, 10833 Le Conte Ave., Los Angeles, CA 90095. E-mail address: Back

4 Abbreviations used in this paper: GM-CSF, granulocyte-macrophage CSF; MOI, multiplicity of infection; PE, phycoerythrin; rhu, recombinant human. Back

Received for publication September 9, 1997. Accepted for publication June 1, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Comstock, G. W.. 1982. Epidemiology of tuberculosis. Am. Rev. Respir. Dis. 125:8.[Medline]
  2. Wayne, L. G.. 1994. Dormancy of Mycobacterium tuberculosis and latency of disease. Eur. J. Clin. Microbiol. Infect. Dis. 13:908.[Medline]
  3. Dutt, A. K., W. W. Stead. 1993. Tuberculosis in the elderly. Med. Clin. N. Am. 77:1353.[Medline]
  4. Cisneros, J. R., K. M. Murray. 1996. Corticosteroids in tuberculosis. Ann. Pharmacother. 30:1298.[Abstract]
  5. Daley, C. L., P. M. Small, G. F. Schecter, G. K. Schoolnik, R. A. McAdam, Jr W. R. Jacobs, P. C. Hopewell. 1992. An outbreak of tuberculosis with accelerated progression among persons infected with the human immunodeficiency virus: an analysis using restriction-fragment-length polymorphisms. N. Engl. J. Med. 326:231.[Abstract]
  6. DiPerri, G., M. Cruciani, M. C. Danzi, R. Luzzati, G. DeChecchi, M. Malena, S. Pizzighella, R. Mazzi, M. Solbiati, E. Concia. 1989. Nosocomial epidemic of active tuberculosis among HIV-infected patients. Lancet ii:1502.
  7. Romani, N., S. Gruner, D. Brang, E. Kampgen, A. Lenz, B. Trockenbacher, G. Konwalinka, P. O. Fritsch, R. M. Steinman, G. Schuler. 1994. Proliferating dendritic cell progenitors in human blood. J. Exp. Med. 180:83.[Abstract/Free Full Text]
  8. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and down-regulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  9. Sieling, P. A., D. Chatterjee, S. A. Porcelli, T. I. Prigozy, T. Soriano, M. B. Brenner, M. Kronenberg, P. J. Brennan, R. L. Modlin. 1995. CD1-restricted T cell recognition of microbial lipoglycans. Science 269:227.[Abstract/Free Full Text]
  10. Stenger, S., R. J. Mazzaccaro, K. Uyemura, S. Cho, P. F. Barnes, J. P. Rosat, A. Sette, M. B. Brenner, S. A. Porcelli, B. R. Bloom, R. L. Modlin. 1997. Differential effects of cytolytic T cell subsets on intracellular infection. Science 276:1684.[Abstract/Free Full Text]
  11. Yamamura, M., K. Uyemura, R. J. Deans, K. Weinberg, T. H. Rea, B. R. Bloom, R. L. Modlin. 1991. Defining protective responses to pathogens: cytokine profiles in leprosy lesions. Science 254:277.[Abstract/Free Full Text]
  12. Gong, J. H., M. Zhang, R. L. Modlin, P. S. Linsley, D. Iyer, Y. Lin, P. F. Barnes. 1996. Interleukin-10 down-regulates Mycobacterium tuberculosis-induced Th1 responses and CTLA-4 expression. Infect. Immun. 64:913.[Abstract]
  13. Sieling, P. A., J. S. Abrams, M. Yamamura, P. Salgame, B. R. Bloom, T. H. Rea, R. L. Modlin. 1993. Immunosuppressive roles for interleukin-10 and interleukin-4 in human infection: in vitro modulation of T cell responses in leprosy. J. Immunol. 150:5501.[Abstract]
  14. Thomssen, H., M. Kahan, M. Londei. 1995. Differential effects of interleukin-10 on the expression of HLA class II and CD1 molecules induced by granulocyte/macrophage colony-stimulating factor/interleukin-4. Eur. J. Immunol. 25:2465.[Medline]
  15. VanHeyningen, T. K., H. L. Collins, D. G. Russell. 1997. IL-6 produced by macrophages infected with Mycobacterium species suppresses T cell responses. J. Immunol. 158:330.[Abstract]
  16. Hirsch, C. S., T. Yoneda, L. Averill, J. J. Ellner, Z. Toosi. 1994. Enhancement of intracellular growth of Mycobacterium tuberculosis by transforming growth factor-ß1. J. Infect. Dis. 170:1229.[Medline]
  17. Cooper, A. M., A. D. Roberts, E. R. Rhoades, J. E. Callahan, D. M. Getzy, I. M. Orme. 1995. The role of interleukin-12 in acquired immunity to Mycobacterium tuberculosis infection. Immunology 84:423.[Medline]
  18. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C.-S. Hsieh, J. A. Culpepper, M. Wysoka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154:5071.[Abstract]
  19. Heufler, C., F. Koch, U. Stanzl, G. Topar, M. Wysocka, G. Trinchieri, A. Enk, R. M. Steinman, N. Romani, G. Schuler. 1996. Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-{gamma} production by T helper 1 cells. Eur. J. Immunol. 26:659.[Medline]
  20. Inaba, K., J. P. Metlay, M. T. Crowley, R. M. Steinman. 1990. Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J. Exp. Med. 172:631.[Abstract/Free Full Text]
  21. Blank, C., H. Fuchs, K. Rappersberger, M. Rollinghoff, H. Moll. 1993. Parasitism of epidermal Langerhans cells in experimental cutaneous leishmaniasis with Leishmania major. J. Infect. Dis. 167:418.[Medline]
  22. Filgueira, L., F. O. Nestle, M. Rittig, H. I. Joller, P. Groscurth. 1996. Human dendritic cells phagocytose and process Borrelia burgdorferi. J. Immunol. 157:2998.[Abstract]
  23. Guzman, C. A., M. Rohde, M. Bock, K. N. Timmis. 1994. Invasion and intracellular survival of Bordetella bronchiseptica in mouse dendritic cells. Infect. Immun. 62:5528.[Abstract/Free Full Text]
  24. Inaba, K., M. Inaba, M. Naito, R. M. Steinman. 1993. Dendritic cell progenitors phagocytose particulates, including Bacillus Calmette-Guerin organisms, and sensitize mice to mycobacterial antigens in vivo. J. Exp. Med. 178:479.[Abstract/Free Full Text]
  25. Henderson, R. A., S. C. Watkins, J. L. Flynn. 1997. Activation of human dendritic cells following infection with Mycobacterium tuberculosis. J. Immunol. 159:635.[Abstract]
  26. Moll, H., S. Flohe, M. Rollinghoff. 1995. Dendritic cells in Leishmania major-immune mice harbor persistent parasites and mediate an antigen-specific T cell immune response. Eur. J. Immunol. 25:693.[Medline]
  27. Stenger, S., N. Donhauser, H. Thuring, M. Rollinghoff, C. Bogdan. 1996. Reactivation of latent leishmaniasis by inhibition of inducible nitric oxide synthase. J. Exp. Med. 183:1501.[Abstract/Free Full Text]
  28. Gong, J., S. Stenger, J. A. Zack, B. E. Jones, G. C. Bristol, R. L. Modlin, P. J. Morrissey, P. F. Barnes. 1998. Isolation of Mycobacterium-reactive CD1-restricted T cells from patients with human immunodeficiency virus infection. J. Clin. Invest. 101:383.[Medline]
  29. O’Brien, R. L., M. P. Happ, A. Dallas, E. Palmer, R. Kubo, W. K. Born. 1989. Stimulation of a major subset of lymphocytes expressing T cell receptor {gamma}{delta} by an antigen derived from Mycobacterium tuberculosis. Cell 57:667.[Medline]
  30. Modlin, R. L., C. Pirmez, F. M. Hofman, V. Torigian, K. Uyemura, T. H. Rea, B. R. Bloom, M. B. Brenner. 1989. Lymphocytes bearing antigen-specific {gamma}/{delta} T-cell receptors in human infectious disease lesions. Nature 339:544.[Medline]
  31. Orme, I. M., F. M. Collins. 1984. Adoptive protection of the Mycobacterium tuberculosis-infected lung: dissociation between cells that passively transfer protective immunity and those that transfer delayed-type hypersensitivity. Cell. Immunol. 84:113.[Medline]
  32. Flynn, J. L., M. M. Goldstein, K. J. Triebold, B. Koller, B. R. Bloom. 1992. Major histocompatibility complex class I-restricted T cells are required for resistance to Mycobacterium tuberculosis infection. Proc. Natl. Acad. Sci. USA 89:12013.[Abstract/Free Full Text]
  33. Clemens, D. L., M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J. Exp. Med. 181:257.[Abstract/Free Full Text]
  34. Mazzaccaro, R. J., M. Gedde, E. R. Jensen, H. M. Van Santen, H. L. Ploegh, K. L. Rock, B. R. Bloom. 1996. Major histocompatibility class I presentation of soluble antigen facilitated by Mycobacterium tuberculosis infection. Proc. Natl. Acad. Sci. USA 93:11786.[Abstract/Free Full Text]
  35. Tsuyuguchi, I., H. Kawasumi, T. Takashima, T. Tsuyuguchi, S. Kishimoto. 1990. Mycobacterium avium-Mycobacterium intracellular complex-induced suppression of T-cell proliferation in vitro by regulation of monocyte accessory cell activity. Infect. Immun. 58:1369.[Abstract/Free Full Text]
  36. Pancholi, P., A. Mirza, N. Bhardwaj, R. M. Steinman. 1993. Sequestration from immune CD4+ T cells of mycobacteria growing in human macrophages. Science 260:984.[Abstract/Free Full Text]
  37. Ting, L., T. Edwards, and J. Ernst. Abstract at the Western Conference in Immunology. Berkeley, CA, July 11–13, 1997.
  38. Gabrilovich, D. I., S. Patterson, A. V. Timofeev, J. J. Harvey, S. C. Knight. 1996. Mechanism for dendritic cell dysfunction in retroviral infection of mice. Clin. Immunol. Immunopathol. 80:139.[Medline]
  39. Crowle, A. J., R. Dahl, E. Ross, M. H. May. 1991. Evidence that vesicles containing living, virulent Mycobacterium tuberculosis or Mycobacterium avium in cultured human macrophages are not acidic. Infect. Immun. 59:1823.[Abstract/Free Full Text]
  40. Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakraborty, P. L. Haddix, H. L. Collins, A. K. Fok, R. D. Allen, S. L. Gluck, J. Heuser, D. G. Russell. 1994. Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 263:678.[Abstract/Free Full Text]
  41. Goren, M. B., P. D’Arcy Hart, M. R. Young, J. A. Armstrong. 1976. Prevention of phagosome-lysosome fusion in cultured macrophages by sulfatides of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 73:2510.[Abstract/Free Full Text]
  42. McDonough, K. A., Y. Kress, B. R. Bloom. 1993. Pathogenesis of tuberculosis: interaction of Mycobacterium tuberculosis with macrophages. Infect. Immun. 61:2763.[Abstract/Free Full Text]
  43. Gercken, J., J. Pryjma, M. Ernst, H. D. Flad. 1994. Defective antigen presentation by Mycobacterium tuberculosis-infected monocytes. Infect. Immun. 62:3472.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Mathew, K. L. Bauer, A. Fischoeder, N. Bhardwaj, and S. J. Oliver
The Anergic State in Sarcoidosis Is Associated with Diminished Dendritic Cell Function
J. Immunol., July 1, 2008; 181(1): 746 - 755.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. J. Raftery, M. Hitzler, F. Winau, T. Giese, B. Plachter, S. H. E. Kaufmann, and G. Schonrich
Inhibition of CD1 Antigen Presentation by Human Cytomegalovirus
J. Virol., May 1, 2008; 82(9): 4308 - 4319.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Roura-Mir, L. Wang, T.-Y. Cheng, I. Matsunaga, C. C. Dascher, S. L. Peng, M. J. Fenton, C. Kirschning, and D. B. Moody
Mycobacterium tuberculosis Regulates CD1 Antigen Presentation Pathways through TLR-2
J. Immunol., August 1, 2005; 175(3): 1758 - 1766.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. M. Patton, T. C. McGuire, M. T. Hines, R. H. Mealey, and S. A. Hines
Rhodococcus equi-Specific Cytotoxic T Lymphocytes in Immune Horses and Development in Asymptomatic Foals
Infect. Immun., April 1, 2005; 73(4): 2083 - 2093.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Buettner, C. Meinken, M. Bastian, R. Bhat, E. Stossel, G. Faller, G. Cianciolo, J. Ficker, M. Wagner, M. Rollinghoff, et al.
Inverse Correlation of Maturity and Antibacterial Activity in Human Dendritic Cells
J. Immunol., April 1, 2005; 174(7): 4203 - 4209.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y. Lin, T. J. Roberts, P. M. Spence, and R. R. Brutkiewicz
Reduction in CD1d expression on dendritic cells and macrophages by an acute virus infection
J. Leukoc. Biol., February 1, 2005; 77(2): 151 - 158.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Martino, A. Sacchi, N. Sanarico, F. Spadaro, C. Ramoni, A. Ciaramella, L. P. Pucillo, V. Colizzi, and S. Vendetti
Dendritic cells derived from BCG-infected precursors induce Th2-like immune response
J. Leukoc. Biol., October 1, 2004; 76(4): 827 - 834.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Mariotti, R. Teloni, E. Iona, L. Fattorini, G. Romagnoli, M. C. Gagliardi, G. Orefici, and R. Nisini
Mycobacterium tuberculosis Diverts Alpha Interferon-Induced Monocyte Differentiation from Dendritic Cells into Immunoprivileged Macrophage-Like Host Cells
Infect. Immun., August 1, 2004; 72(8): 4385 - 4392.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. C. Roy, G. Bandyopadhyay, S. Rakshit, M. Ray, and S. Bandyopadhyay
IL-4 alone without the involvement of GM-CSF transforms human peripheral blood monocytes to a CD1adim, CD83+ myeloid dendritic cell subset
J. Cell Sci., July 15, 2004; 117(16): 3435 - 3445.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
D. B. Moody, D. C. Young, T.-Y. Cheng, J.-P. Rosat, C. Roura-mir, P. B. O'Connor, D. M. Zajonc, A. Walz, M. J. Miller, S. B. Levery, et al.
T Cell Activation by Lipopeptide Antigens
Science, January 23, 2004; 303(5657): 527 - 531.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. L. Amprey, G. F. Spath, and S. A. Porcelli
Inhibition of CD1 Expression in Human Dendritic Cells during Intracellular Infection with Leishmania donovani
Infect. Immun., January 1, 2004; 72(1): 589 - 592.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Gansert, V. Kiebler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, S. A. Porcelli, R. L. Modlin, and S. Stenger
Human NKT Cells Express Granulysin and Exhibit Antimycobacterial Activity
J. Immunol., March 15, 2003; 170(6): 3154 - 3161.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Chackerian, J. Alt, V. Perera, and S. M. Behar
Activation of NKT Cells Protects Mice from Tuberculosis
Infect. Immun., November 1, 2002; 70(11): 6302 - 6309.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
L. E. DesJardin, T. M. Kaufman, B. Potts, B. Kutzbach, H. Yi, and L. S. Schlesinger
Mycobacterium tuberculosis-infected human macrophages exhibit enhanced cellular adhesion with increased expression of LFA-1 and ICAM-1 and reduced expression and/or function of complement receptors, Fc{gamma}RII and the mannose receptor
Microbiology, October 1, 2002; 148(10): 3161 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Giuliani, S. P. Prete, G. Graziani, A. Aquino, A. Balduzzi, M. Sugita, M. B. Brenner, E. Iona, L. Fattorini, G. Orefici, et al.
Influence of Mycobacterium bovis Bacillus Calmette Guerin on In Vitro Induction of CD1 Molecules in Human Adherent Mononuclear Cells
Infect. Immun., December 1, 2001; 69(12): 7461 - 7470.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
S.M. Rhind
CD1--The Pathology Perspective
Vet. Pathol., November 1, 2001; 38(6): 611 - 619.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. W. Cutler, R. Jotwani, and B. Pulendran
Dendritic Cells: Immune Saviors or Achilles' Heel?
Infect. Immun., August 1, 2001; 69(8): 4703 - 4708.
[Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Master, T. C. Zahrt, J. Song, and V. Deretic
Mapping of Mycobacterium tuberculosis katG Promoters and Their Differential Expression in Infected Macrophages
J. Bacteriol., July 1, 2001; 183(13): 4033 - 4039.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
G.A.W. Rook, G. Seah, and A. Ustianowski
M. tuberculosis: immunology and vaccination
Eur. Respir. J., March 1, 2001; 17(3): 537 - 557.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. E. Aldwell, B. L. Dicker, F. M. Da Silva Tatley, M. F. Cross, S. Liggett, C. G. Mackintosh, and J. F. T. Griffin
Mycobacterium bovis-Infected Cervine Alveolar Macrophages Secrete Lymphoreactive Lipid Antigens
Infect. Immun., December 1, 2000; 68(12): 7003 - 7009.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-J. Ullrich, W. L. Beatty, and D. G. Russell
Interaction of Mycobacterium avium-Containing Phagosomes with the Antigen Presentation Pathway
J. Immunol., December 1, 2000; 165(11): 6073 - 6080.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Thoma-Uszynski, S. Stenger, and R. L. Modlin
CTL-Mediated Killing of Intracellular Mycobacterium tuberculosis Is Independent of Target Cell Nuclear Apoptosis
J. Immunol., November 15, 2000; 165(10): 5773 - 5779.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. M. Lewinsohn, A. L. Briden, S. G. Reed, K. H. Grabstein, and M. R. Alderson
Mycobacterium tuberculosis-Reactive CD8+ T Lymphocytes: The Relative Contribution of Classical Versus Nonclassical HLA Restriction
J. Immunol., July 15, 2000; 165(2): 925 - 930.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Fortsch, M. Rollinghoff, and S. Stenger
IL-10 Converts Human Dendritic Cells into Macrophage-Like Cells with Increased Antibacterial Activity Against Virulent Mycobacterium tuberculosis
J. Immunol., July 15, 2000; 165(2): 978 - 987.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. E. Schaible, K. Hagens, K. Fischer, H. L. Collins, and S. H. E. Kaufmann
Intersection of Group I CD1 Molecules and Mycobacteria in Different Intracellular Compartments of Dendritic Cells
J. Immunol., May 1, 2000; 164(9): 4843 - 4852.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Sieling, D. Jullien, M. Dahlem, T. F. Tedder, T. H. Rea, R. L. Modlin, and S. A. Porcelli
CD1 Expression by Dendritic Cells in Human Leprosy Lesions: Correlation with Effective Host Immunity
J. Immunol., February 1, 1999; 162(3): 1851 - 1858.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stenger, S.
Right arrow Articles by Modlin, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenger, S.
Right arrow Articles by Modlin, R. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS