|
|
||||||||
Department of Microbiology and Immunology, Kimmel Cancer Center, Jefferson Medical College, Philadelphia, PA 19107
| Abstract |
|---|
|
|
|---|
-chains (i.e., IL-15, IL-4, and IL-7) do
not mediate these effects. In an effort to analyze the mechanisms by
which IL-2, IL-12, and IL-15 differentially regulate gene
transcription, we have isolated a novel gene,
197/15a, the expression of which in NK
and T cells is down-regulated by IL-2 and IL-15, up-regulated by IL-12,
and not affected by IL-4 and IL-7. IL-2 and IL-15 act, at least in
part, repressing 197/15a transcription;
their effect on 197/15a mRNA accumulation
is partially independent of novel protein synthesis, likely not
mediated by JunB, Bcl-2, or Bax, and requires the activity of
rapamycin-sensitive molecule(s). The observation that IL-2 and IL-12
differentially modulate CD161 expression suggests the
existence of cytokine-specific mechanisms of modulation of spontaneous
cytotoxicity based on the regulation of expression of surface molecules
involved in target cell recognition and/or triggering of the cytolytic
machinery. | Introduction |
|---|
|
|
|---|
Several cytokines enhance cytotoxic activity of NK and Ag-specific T
cells. Among these, IFN-
ß, IL-2, IL-15, and IL-12 are
qualitatively similar in their ability to enhance target cell
recognition and killing (10, 11). IL-2, IL-15, and IL-12 exert similar
effects on other NK cell functions (e.g., cytokine production and
proliferation) (10, 11, 12, 13). However, some of the activation events induced
by the different cytokines are distinct. For example, only IL-12
supports the differentiation of CD4+ helper Th0 cells to a
Th1 phenotype (14). Proliferation of resting NK cells is induced only
by IL-2, although both IL-2 and IL-12 induce cytokine production in the
same cells (12), and expression of membrane adhesion molecules (ß
integrins) is differentially regulated by the two cytokines (15). IL-2
and IL-12 receptors activate distinct signaling pathways. The
intermediate affinity IL-2 receptor (IL-2Rß/CD122) on resting NK
cells shares with the IL-15 receptor the ß-chain (16), and the common
(
c)-chain,5
also a component of the IL-4, IL-7, and IL-15 receptors (17); the high
affinity IL-12 receptor is composed of at least two chains, ß1 and
ß2, both related to the common gp130 signal-transducing chain of the
IL-6, granulocyte-CSF, and leukemia inhibitory factor
receptors (18, 19). IL-2 and IL-12 receptors utilize distinct members
of the Janus protein tyrosine kinase (Jak) family and activate
different molecules of the STAT family (Jak 1 and 3 and STAT 1, 3, and
5 for the IL-2R and Jak 2, Tyk 2, and STAT 1, 3, and 4 for the IL-12R)
(20, 21, 22, 23, 24). Different STAT complexes bind selective DNA sequences (25),
and differential gene expression may be mediated by these complexes
after IL-2 and IL-12 stimulation.
We have previously reported that IL-2, but not IL-12, stimulation induces expression of the immediate/early activation genes c-fos, junB, and egr-1, and of bcl-2 (26), expression of which correlates with differential resistance of IL-2- or IL-12-treated NK cells to corticosteroid-induced apoptosis (27, 28, 29). Most of these genes encode transcription factors, and induced AP-1-mediated transcriptional activity has been demonstrated exclusively in IL-2-stimulated cells (26). In addition to transcriptional activation, JunB-containing AP-1 complexes can mediate transcriptional repression (30); moreover, both c-Fos and Jun can inhibit transcription mediated by NF-IL-6 (31), and Bcl-2 can inhibit gene trans-activation mediated by the nuclear factor of activated T cells (NF-AT) by sequestering calcineurin (32, 33). Both transcriptional activation and repression may play a role to modulate expression of NK cell recognition structures and/or other effector cell molecules involved in triggering cytotoxicity on binding/recognition of different target cells.
Here we present evidence that CD161 participates in the triggering of
polyclonal homogeneous human NK cell populations toward selected human
(Daudi) tumor cell lines, as well as the murine P815. Treatment of NK
cells with IL-12, but not IL-2, IL-15 or other cytokines sharing the
c-chain, results in increased transcription and surface
expression of CD161/NKR-P1A. We also describe a novel gene,
197/15a, homologous to the mouse
apoptosis-related MA-3 (34) and the human
H731 (35) genes, the transcription of which is specifically
down-regulated in both NK and T cells by IL-2 and IL-15 via a signaling
pathway(s) involving rapamycin-sensitive molecule(s) and relying, in
part, on factors constitutively expressed in NK cells. Evidence is
presented to indicate that ß-chain-mediated signaling is required,
and
c-chain is not sufficient, to transduce signals
leading to 197/15a down-regulation.
| Materials and Methods |
|---|
|
|
|---|
Human PBL were separated from venous blood obtained from healthy
individuals after density gradient (Histopaque 1077; Sigma, St. Louis,
MO) centrifugation and adherence to plastics. NK cells were purified
from cocultures of PBL with 50-Gy-irradiated RPMI-8866 B-lymphoblastoid
cell line, as described (36), by negative selection with a panel of mAb
(OKT3, anti-CD3; B36.1, anti-CD5; B52.1, anti-CD14) and
goat anti-mouse Ig-coated sheep E. The resulting populations were
>95% CD16+/CD56+/CD3-, as
determined by indirect immunofluorescence (flow cytometry) with a panel
of mAb. T cells were prepared from the same cultures by negative
selection with anti-CD16 (3G8, produced from cells kindly provided
by Dr. J. Unkeless, Mount Sinai Medical School, New York, NY) and
anti-CD56 (B159.5) mAb (36). As previously reported, T and NK cells
purified from these cultures do not express early activation markers
(e.g., IL-2R
and transferrin receptor), respond with fast kinetics
to activating stimuli, and proliferate in response to IL-12, with
maximal effect obtained with 2 ng/ml of the cytokine (Ref. 37; data not
shown).
The different lymphocyte populations were cultured (5 x
106/ml) for the indicated times in RPMI 1640 medium
(BioWhittaker, Walkersville, MD) supplemented with 10%
heat-inactivated FBS (Sigma) with added or not rIL-2 (102
U/ml; sp. act. 1.1 x 106 U/mg; Hoffman-La Roche,
Nutley, NJ, obtained through the Biologic Response Modifiers Program,
National Cancer Institute), rIL-12 (5 ng/ml; sp. act. 4.5 x
106 U/mg of protein in an IFN-
induction assay; kindly
provided by Dr. S. Wolf, Genetics Institute, Andover, MA), rIL-15 (20
ng/ml; sp. act. 2.95 x 108 U/mg of protein; Immunex,
Seattle, WA), rIL-4 (10 ng/ml; sp. act. 107 U/mg of
protein; Genzyme, Cambridge, MA), rIL-7 (5 ng/ml; R&D Systems,
Minneapolis, MN) or IFN-ß (500 U/ml; anti-viral titer, 1.5
x 108 U/mg of protein, provided by Dr. J. S. Price,
Cetus, Emeryville, CA). The concentrations of IL-2, IL-12, and IL-15
used were double those required for maximal proliferation of NK or T
cells prepared as described. Where indicated, cells were pretreated (30
min, 37°C) with 50 µM PD098059 (a gift from Dr. A. Saltiel,
Parke-Davis Pharmaceutical Research/Warner-Lambert, Ann Arbor, MI),
inhibiting IL-2-mediated activation of mitogen-activated protein kinase
(MAPK) kinase (MEKK) (38), or 30 µM emetine (Sigma; inhibiting
protein synthesis by >70% (37)).
CD161 expression was analyzed on NK cells treated with trypsin (1 mg/ml serum-free medium, 107 cells/ml, 20 min, 37°C) in the presence of DNase A (0.1 mg/ml) (both from Sigma).
Indirect immunofluorescence
This was performed as previously described, using the indicated mAb and human Ig-adsorbed, FITC-conjugated goat F(ab')2 anti-mouse Ig (Cappel, Durham, NC). Samples were analyzed on an EPICS Profile flow cytofluorimeter (Coulter, Hialeah, FL). All mAb used, including the anti-CD161 mAb B199.2 (39), have been produced and characterized in our laboratory (36).
Cell-mediated cytotoxicity
This was tested in 4-h 51Cr release assays with the indicated target cell lines (104 target cells/well) and different numbers of effector NK cells, as previously described (40). When indicated, anti-CD161, or anti-CD56 mAb as control, were present (10 µg/ml) throughout the assay. LU45% were calculated as previously described (40).
mRNA extraction, purification, and Northern blot analysis
Total RNA was extracted from the indicated cells with a
guanidinium/phenol/chloroform-based method (Trizol; Life Technologies,
Grand Island, NY), following the manufacturers specifications.
Polyadenylated (poly(A)+) mRNA was purified from a minimum
of 100 µg of RNA with the use of biotin-conjugated oligo(dT) and
avidin-coated paramagnetic particles (Poly(A)Tract; Promega, Madison,
WI). Aliquots of the mRNA were electrophoresed in 16%
formaldehyde-agarose gels, transferred to nylon membranes (Hybond;
Amersham, Arlington Heights, IL), UV-cross-linked, and analyzed by
Northern blotting as described (26). cDNA encoding CD161 was
obtained by RT-PCR (3' primer, CAAGAGTCAAGAGTCAGG; 5' primer,
TCTGCCATGGACCAACAAGC) from NK cells; bax cDNA was a kind
gift of Dr. E. Alnemri (Kimmel Cancer Center, Philadelphia, PA); the
sources of pBAE, ß2-microglobulin, TCR
ß-chain (detecting a nonproductive, truncated 2.0-kb mRNA in NK
cells), and IFN-
cDNA have been previously reported (41). cDNA
probes were labeled with [
-32P]dCTP (sp. act. 3000
Ci/mmol; ICN Pharmaceutical, Costa Mesa, CA) by nick translation
(Boehringer Mannheim, Indianapolis, IN), and hybridized to the
membrane-bound RNA. Hybridization was detected by autoradiography, and
densitometric analysis was performed with a laser scanner (Personal
Densitometer; Molecular Dynamics, Sunnyvale, CA) with proprietary
software (ImageQuant). Levels of ß2-microglobulin mRNA
served to control for equivalent amounts of total RNA loaded in each
lane. Computer-assisted imaging was performed on the scanned
autoradiograms. The backgrounds in the figures shown are typical of
those in the original films.
RT-PCR differential display
The protocol described by Liang and Pardee (42) was used, modified as follows: 1) reverse transcription: poly(A)+ RNA from NK cells stimulated for 2 h with IL-2 or IL-12 were used as templates. Heat-denatured RNA was primed with T12MA, T12MT, T12MC or T12MG oligodeoxyribonucleotide (M = A/C/G) at 37°C, and RT was performed with Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI), 1 h, 35°C; 2) PCR: 40 amplification cycles (94°C, 1 min; 42°C, 30 s; 72°C, 30 s) were performed with T12MA, T12MT, T12MC, or T12MG as 3' primers and arbitrary decamers as 5'-primers. DNA Taq polymerase was from Fisher Scientific (Pittsburgh, PA). PCR products were labeled with [35S]dATP (10 µCi/20-µl reaction; sp. act. >1000 Ci/mmol; Amersham). The resulting cDNA species were size fractionated by electrophoresis in 50% urea, 6% acrylamide-Tris-buffered EDTA gels. These were dried and exposed to autoradiographic film (Biomax; Kodak, Rochester, NY). The bands corresponding to mRNA species differentially expressed on IL-2 or IL-12 stimulation were excised, the corresponding cDNA was eluted in boiling water, and an aliquot of the eluate was reamplified with the same primers used in the first amplification. PCR products were ligated in a T/A bacterial expression vector (pCRII; Invitrogen, San Diego, CA) and introduced in competent Escherichia coli. Several cDNA clones were analyzed following EcoRI digestion. Clones containing cDNA inserts of the appropriate size were sequenced using dideoxy terminator reaction chemistry for sequence analysis on the Applied Biosystems (Foster City, CA) Model 377 DNA sequencing system. The same cDNA clones were used as probes to detect mRNA expression in Northern blot analysis of total and/or poly(A)+ RNA extracted from the indicated cell types.
cDNA library screening
A
ZAPII cDNA library, obtained from the Jurkat lymphoblastoid
T cell line by mixed oligo(dT) and random priming (800-bp average
size), was purchased from Stratagene (La Jolla, CA), titrated, plated,
and screened for positive clones by hybridization of duplicate filter
plaque lifts with the 32P-labeled (NEN-DuPont, Boston, MA)
RT-PCR differential display product 197/15a,
following the manufacturers specifications. Secondary and tertiary
screening were performed on the positive plaques isolated. cDNA from
positive plaques was excised in vivo by coinfection with the helper
phage ExAssist in the nonsuppressive E. coli strain
SOL-R (Stratagene), following the manufacturers specifications. The
double-stranded cDNA clones obtained were sequenced with dideoxy
terminator reaction chemistry as above, or manually with
[35S]dATP (Amersham) incorporation and dideoxy-NTP
termination (Sequenase version 2.0; United States Biochemical/Amersham,
Cleveland, OH), following the manufacturers specifications.
Manual sequences were resolved on denaturing 6% PAGE. Gels were dried
and exposed to autoradiographic film (Biomax). The sequences obtained
were overlapped and analyzed with GCG software (Kimmel Cancer Center)
and compared with sequences in the National Center for Biotechnology
Information databases using the Basic Local Alignment Search Tool
(BLAST) algorithm.
Run-on analysis
Nuclei from cells (50 x 106) stimulated with
IL-2 and IL-12 for the indicated times were isolated on discontinuous
sucrose gradient, and in vitro nuclear RNA transcription was performed
according to the method of Chan et al. (43): [
-32P]UTP
(sp. act. 3000 Ci/mmol; NEN-DuPont)-labeled RNA was extracted from the
nuclei with 1 ml of Trizol reagent (Life Technologies), following the
manufacturers specifications, in the presence of 10 µg of yeast
tRNA as a carrier. After purification on Sephadex G-50 columns
(Boehringer-Mannheim), radiolabeled RNA was hybridized (42°C, 72
h) to nitrocellulose membranes (MSI, Westboro, MA) on which 3 µg of
CD161, 197/15a, pBAE, or
ß2-microglobulin cDNA had been immobilized. The filters
were washed and exposed to Phosphor Screen (Molecular Dynamics);
quantitative image analysis was performed on a Molecular Dynamics
Phosphorimager using ImageQuant software. Permanent record of
hybridization was obtained after exposure of the filters to
autoradiography film (AR; Kodak).
Statistical analysis
The two-tailed t test was used. Values of p < 0.05 are considered significant.
| Results |
|---|
|
|
|---|
The cytotoxic activity of polyclonal homogeneous NK cell
populations obtained from short term cultures was tested against a
panel of human (Daudi, Raji, CEMM, Jurkat, K562, U937, THP-1, HL-60)
and murine (P815) cell lines with or without added anti-CD161 mAb
B199.2. In agreement with a previous report using NK cell clones (7),
the cytotoxic activity of the primary population against the murine
P815 target cells was inhibited by the anti-CD161 mAb.2 (by
77.2 ± 9%; n = 3, based on calculation of
LU45%). Interestingly, cytotoxicity against the human
B-lymphoblastoid cell line Daudi (Fig. 1
), but not that against the other cell
lines tested (Jurkat and K562 reported as example), was significantly
reduced (76.7% and 56.4% in two separate experiments), indicating
that CD161 can be differentially involved in triggering cytotoxicity of
polyclonal human NK cell populations against selected human target
cells.
|
To determine whether IL-2 and IL-12 modulate differentially
expression of surface differentiation antigens, several of these were
analyzed by indirect immunofluorescence on NK cells at the indicated
times in culture with either cytokine. As shown in Figure 2
(left), CD161
expression on cells cultured for 1 day with IL-12 was increased
compared with that on cells cultured for the same time with IL-2 or no
cytokine. Expression of CD16 and other surface antigens (CD56, CD2,
CD94, and p70 killer-inhibitory receptor, not shown) was instead
similar in all culture conditions. After trypsin treatment (Fig. 2
, right, a), NK cells lost reactivity with the anti-CD161
mAb B199.2. To determine whether IL-2 and IL-12 affect CD161 expression
interfering with its de novo synthesis, membrane expression was
analyzed in NK cells cultured with either cytokine for 1 or 4 days
after trypsin treatment, to allow complete resynthesis of the molecule
after cleavage. As shown in Figure 2
(right, b, c, and
d), cells cultured with IL-12 expressed levels of CD161
that, although similar to those detected on cells cultured in
medium alone, were higher than those on cells cultured with IL-2. In
separate experiments, cells cultured with IL-15 expressed levels of
CD161 higher than those on cells cultured in medium alone or IL-2 but
lower than those on IL-12-treated cells (not shown).
|
|
Isolation of 197/15a, a novel gene the expression of which is differentially regulated upon IL-2 and IL-12 stimulation
To determine whether expression of additional genes is regulated
differentially by IL-2 and IL-12, we performed RT-PCR differential
display on mRNA obtained from NK cells treated for 2 h with either
cytokine. This time point was chosen to maximize the chances of
isolating genes the expression of which is regulated directly by
signaling events (immediate/early genes), rather than "second wave"
genes. An mRNA species expressed in IL-12- but not in IL-2-stimulated
cells was isolated. The corresponding cDNA
(197/15a) hybridized to mRNA from NK cells.
197/15a mRNA was also detected in the B (Daudi,
RPMI-8866, CESS), T (Jurkat, MOLT 4), myeloid (HL-60, ML-3, U937,
THP-1), and solid tumor-derived cell lines (A431, MCF7, PC3, LNGAP,
SW48) analyzed (not shown). In primary NK and T cells (Fig. 4
, A and B,
respectively), two mRNA species with different mobility in 1.2%
agarose gels were consistently detected in nonstimulated control cells;
mRNA accumulation was either maintained or increased after 2 h of
IL-12 treatment (131.6 ± 47.9% of unstimulated cells,
n = 12; p < 0.05) but decreased after
IL-2 stimulation at the same time point (47.1 ± 14.7%,
n = 12, p < 0.05) and up to 6 h
(not shown). The two cytokines combined induced marginal decrease of
197/15a expression (76.4 ± 20.6%, n = 7,
p < 0.05).
|
ZAPII
cDNA library obtained from the T cell line Jurkat, in which relatively
high RNA levels are detected, was screened using
197/15a cDNA under high stringency conditions.
Two positive clones of
2500 and
2000 bp, respectively, were
isolated, and their sequence was determined using the dideoxy-NTP
termination method. The sequence (GenBank accession number U96628)
revealed a high degree of homology (88% identity) with a mouse gene
independently isolated by Shibahara et al. (34), and by Onishi and
Kizaki (44). Expression of this gene is increased in thymocytes and RVC
lymphoma cells, respectively, after corticosteroid- or topoisomerase
inhibitor-induced apoptosis. With the exception of an additional 87 bp
at position 126, resulting in a different predicted start codon, and
the lack of the first 15 amino acids (MDVENEQILNVNPAD), the
197/15a sequence is also 98% identical with the
cDNA sequence of the human H731 gene, encoding a protein the
expression of which is modulated during the cell cycle in chick embryo
cells and mouse fibroblasts (35, 45). The accuracy of our sequence was
confirmed sequencing a cDNA product obtained from NK cell-derived mRNA
with the use of RT-PCR with primers encompassing the region of interest
(5' = 87106; 3' = 217234). The differences between
197/15a and H731 in the predicted
protein sequences do not encompass areas previously identified as
putative casein kinase (amino acids 2529 and 3335) or protein
kinase (amino acids 6474; 102109; 211223; 237243; 367393)
phosphorylation site motifs or the location of basic and acidic
domains. Regulation of 197/15a expression
To define the molecular mechanisms of IL-2-mediated
down-modulation of 197/15a mRNA accumulation,
run-on analysis was performed on nuclear RNA extracted from NK cells
stimulated for 2 h with either IL-2 or IL-12. As shown in Figure 4
C (experiment representative of two performed), IL-2
treatment, compared with that with IL-12, resulted in lower levels
(47%) of 197/15a transcription; in separate
experiments, transcription levels of 197/15a in
IL-2-stimulated cells were 56% of those in unstimulated cells. These
data indicate that the IL-2 controls expression of this gene, at least
in part, via negative transcriptional regulation.
To determine whether down-modulation of 197/15a depends on
expression of repressor molecules induced by IL-2, but not by IL-12, we
analyzed the effect of inhibitors of different biochemical pathways
known to lead to expression of these genes. Similar studies on
CD161 expression could not be performed because of poor cell
viability after lengthy treatment with the various inhibitors. IL-2,
but not IL-12, induces expression of AP-1 family genes
(c-fos and junB) and bcl-2 in NK and T
cells (26). JunB has been demonstrated to act as a
transcriptional repressor (30, 31). Treatment of NK cells with the MEKK
inhibitor PD098059 resulted in >65% inhibition of IL-2-induced
junB mRNA accumulation (not shown), indicating that
activation of the MAPK pathway is a required signaling event. However,
as reported in Table I
, the IL-2-mediated
down-modulation of 197/15a mRNA accumulation was
not affected under the same conditions. Bcl-2 acts as a
transcriptional repressor interfering with NF-AT-mediated transcription
(33), and its induced expression in B cells is sensitive to rapamycin
(46). Rapamycin treatment of NK cells inhibited, as expected,
IL-2-induced activation of p70s6 kinase (not shown) and reduced
significantly the down-modulatory effect of IL-2 on
197/15a expression (Table I
) without affecting
IL-2-induced bcl-2 expression (not shown).
|
mRNA accumulation (not shown), suggesting that
Gfi-1 does not participate in the IL-2-mediated repression
of CD161 or 197/15a transcription at the time points
analyzed.
The requirement for de novo protein synthesis in the IL-2-mediated
repression of 197/15a was tested in Northern blot
analysis of total RNA from NK cells cultured for 2 h with or
without IL-2, IL-12, and emetine. As summarized in Table I
, emetine
treatment reduced significantly but did not abolish the IL-2-induced
down-modulation of 197/15a mRNA accumulation,
indicating that the effect is in part independent from de novo protein
synthesis; the effect of IL-12 on 197/15a
expression was not significantly affected under the same conditions.
Modulation of 197/15a and CD161
expression in NK cells by cytokines utilizing receptors that share the
c-chain
The IL-2 but not the IL-12 receptor shares a
c-chain with the IL-4, IL-7, and IL-15 receptors
(reviewed in 17 , all expressed in NK cells, and stimulation of
the latter receptors results in functional effects similar to those
induced by IL-2 (28, 29, 48, 49). Additionally, IL-2 and IL-15
receptors share the IL-2R ß-chain as a signal transducing moiety. To
start analyzing the role of ß- and
c-chains in
transducing events leading to CD161 and
197/15a down-modulation and to define the
cytokine specificity of this effect, CD161 and
197/15a mRNA accumulation were analyzed in NK
cells stimulated with different cytokines, with or without IL-12 added.
IL-15, like IL-2, but unlike IL-4, IL-7 (Table II
), or IFN-ß (not shown), induced
significant decrease in the expression of
197/15a, whereas IL-12, alone or in combination
with IL-4 and with IL-7, increased it significantly. Only IL-2
down-modulated significantly CD161 mRNA accumulation,
whereas IL-12, alone or in combination with IL-4 and IL-15, enhanced it
significantly. These results indicate that
c-chain usage
is insufficient, per se, to transduce signals resulting in
transcriptional repression or activation of the genes studied.
Moreover, the differential sensitivity of CD161 and
197/15a to IL-2 and IL-15 treatment suggests that
different biochemical pathways control the expression of the two genes.
|
| Discussion |
|---|
|
|
|---|
Engagement of the C-type lectin CD161 triggers the cytotoxicity
activity of rodent NK and dendritic cells (6, 51). Here we demonstrate
that blocking this molecule with nonstimulatory anti-CD161 mAb
reduces significantly NK cell cytotoxicity of NK cell populations
toward at least one human target cell line (Daudi, B-lymphoblastoid).
This observation extends to a human target cell and to polyclonal NK
cells previous reports (7) on murine target cells (insensitive
to resting human NK cells) and NK cell clones (i.e., cells stimulated
with large doses of IL-2 in long term cultures) and supports the
hypothesis that CD161 may play a relevant role in NK cell-mediated
cytotoxicity in vivo. Of the human hematopoietic cell lines tested,
only Daudi appears capable to trigger cytotoxic activity in a
CD161-dependent fashion, suggesting that the use of CD161 for
recognition/activation by NK cells is selective for specific target
cells. Alternatively, CD161 may behave like a killer-inhibitory
receptor, and the inhibition of cytotoxicity against the
Fc
RII+ Daudi in the presence of the IgG2b anti-CD161
mAb may depend on induced cross-linking of this molecule at the NK cell
membrane, with consequent triggering of its inhibitory activity. The
observation that the same mAb does not inhibit killing of other
Fc
RII+ cell lines (specifically K562, Raji, U937, THP-1,
and HL-60) that can function as Daudi cells to cross-link CD161 on the
NK cells is against this hypothesis. Studies in murine NK cells (6, 51)
and in human dendritic cells (52) also support an activatory role for
CD161.
Regulation of the surface expression of CD161 may be expected to affect the cytotoxic activity of NK cells, at least against selected (i.e., CD161 ligand expressing) target cells. Our observation that only IL-2, among several cytokines tested, inhibits CD161 expression suggests the possibility that this cytokine alters preferentially cytotoxic responses of NK cells to CD161-engaging target cells, therefore contributing to diversify NK cell responses to the different cytokines and target cells. Although it is possible that increased expression of a cytotoxicity-triggering receptor (like that specifically induced by IL-12) contributes to more efficient killing of distinct target cells, direct proof of this prediction cannot be obtained with primary NK cells. In these cells, cytokine activation induces expression of several molecules involved in cytotoxic activity (e.g., adhesion molecules (15), perforin, granzymes (53), and possibly additional molecules yet to be identified). This makes it impossible to distinguish effects that depend directly on cytokine-induced altered expression of CD161 from those related to the other effects. Studies of the effect of CD161 gene inactivation or overexpression in cytotoxic cell lines, beyond the scope of the present study, are needed to define the functional consequence specifically of the modulation of CD161 expression human NK cell-mediated cytotoxicity.
Although IL-2 and IL-15 bind to receptors that share both ß-
and
c-chains (16), a combination considered
sufficient for complete signaling (46), only IL-2 affects significantly
CD161 expression. Because the cultured NK cells we used do
not express detectable levels of IL-2R
-chain and stimulation of
cytokine receptors utilizing only the
c-chain (IL-4R and
IL-7R) does not affect CD161 mRNA accumulation, our data
suggest that engagement of the IL-15R
-chain transduces signals that
serve to maintain expression of CD161 mRNA and that IL-2R
ß-chain-mediated signaling is required to induce down-regulation of
this gene, whereas the
c-chain is not sufficient.
Requirement for ß-chain signaling may not be restricted to
CD161 modulation, as suggested by the observation that mRNA
accumulation of another gene, 197/15a, in NK and
T cells is specifically down-modulated by IL-2 and IL-15, but not by
IL-12, IL-4, or IL-7. IL-2-mediated down-regulation of
197/15a is, at least in part, transcriptional, as
demonstrated by the reduced transcription rate of this gene in
IL-2-treated cells, compared with untreated or IL-12-stimulated cells.
IL-2 significantly inhibits expression of both 197/15a and CD161 mRNA, but the molecular mechanisms involved likely differ, because: 1) only 197/15a transcription is significantly down-regulated by IL-2 treatment and 2) down-regulation of 197/15a and CD161 mRNA expression occurs with different kinetics (detectable after 2 and 6 h of stimulation, respectively). Although IL-2 markedly reduces CD161 mRNA expression, it only marginally affects its transcription rate (84% of unstimulated control). Therefore, it is likely that posttranscriptional mechanisms, e.g., heterogeneous RNA processing and reduced mRNA stability, are involved in the observed IL-2-induced down-modulation of CD161 mRNA accumulation. On the contrary, only IL-12, of the cytokines tested, induces increased transcription of CD161; this is likely to contribute to the IL-12-specific positive regulation observed at both mRNA and protein level.
The 197/15a cDNA sequence is highly homologous to that of
the murine MA-3 gene, isolated by separate groups
from lymphoid cells induced to undergo apoptosis with a variety of
stimuli, including topoisomerase inhibitors, corticosteroids, and
cytokine deprivation (34, 44). Because 197/15a mRNA is
abundant both in resting primary cells and in proliferating cell lines,
we did not analyze its expression in apoptosis-inducing conditions.
However, it is tempting to speculate that low levels of expression of
this gene may correlate with cell survival and protection from
apoptosis. Such an effect, if proved, is unlikely to depend directly on
expression of this gene, since IL-12, IL-4, and IL-7 protect NK cells
from IL-2 withdrawal-induced apoptosis (28) without inducing
197/15a down-modulation (our data). Also, IL-2,
IL-15, and IL-12 all prime NK cells for activation-induced apoptosis
via the Fc
RIIIA (Ref. 54; our unpublished results) irrespective of
their effect on 197/15a expression,
indicating that protection from apoptosis, if related to expression of
197/15a, may be limited to specific conditions
exclusive of activation-mediated apoptosis. Experiments using antisense
oligodeoxyribonucleotide to down-modulate 197/15a
expression (not shown) did not yield significant results, and the
possible role of this gene in cell division/survival remains to be
determined.
197/15a cDNA sequence is identical, with the
exception of 87 bp in its 5'-region, with the human H731
gene, encoding a protein of
56 kDa, expression of which is modulated
during the cell cycle (35, 45). Abs to an epitope contained within the
first 147 amino acids of this protein did not detect
IL-2-down-modulated products in NK cells, as analyzed in Western
blotting or immunocytochemistry (not shown). It is unlikely that
sequencing errors account for the differences observed between
197/15a and H731 because two identical
197/15a sequences, with high homology to the
5'-region of the murine gene, have been cloned independently from the
Jurkat cell line and from primary NK cells. However, differential
splicing or gene duplication cannot be excluded. Although the protein
encoded by this gene remains to be identified and its function defined,
the observation that IL-2, but not IL-12, negatively regulates its
expression serves to underscore major differences in the biologic
effects of these cytokines.
Negative gene regulation may result either from direct activation of repressor molecules and/or inactivation of transcriptional activators or from de novo expression of "first wave" genes encoding them. A few genes encoding molecules acting as transcriptional repressors in specific circumstances are expressed in NK cells after IL-2 but not IL-12 stimulation. We have started to investigate their possible role in the IL-2-mediated 197/15a down-modulation using an indirect approach. The observation that the MEKK inhibitor PD098059, while inhibiting IL-2-mediated junB induction (data not shown), has no effect on 197/15a regulation indicates that neither the former nor other molecules activated in a MAPK-dependent manner contribute to regulation of its expression. Several lines of evidence make Bcl-2 involvement unlikely: 1) Bcl-2 can exert transcriptional repression by sequestering calcineurin, thereby inhibiting NF-AT activation and nuclear translocation; however, NF-AT activity is not induced in NK cells upon IL-2 stimulation (our unpublished observations); 2) bcl-2 expression is induced late (6 h) in response to IL-2, whereas 197/15a transcription is down-modulated within 2 h and is, at least in part, independent of de novo protein synthesis; 3) the IL-2-induced bcl-2 expression in NK cells, unlike 197/15a down-modulation, is rapamycin resistant; and 4) IL-7 induces bcl-2 (29) without affecting 197/15a expression. Expression of bax, the negative regulation of which may reflect indirectly Gfi-1 repressor activity (47), is not modulated by IL-2 in NK cells. This observation, although it suggests that Gfi-1 does not play a major role in controlling 197/15a expression, does not rule this out completely: bax transcriptional regulation likely depends on a balance between the activity of both trans-activating and repressor molecules, and the effects of each single molecule might be difficult to isolate in intact cells. Taken together, our data support the conclusion that a yet to be defined molecule(s), target of IL-2-activated signaling elements and sensitive to rapamycin, controls 197/15a expression. It is also possible that the inhibitory effect of rapamycin depends, at least in part, on inhibition of p70s6 kinase or other target molecules, with consequent lack of activation of a repressor (55). Protein synthesis inhibition reverts only partially the IL-2-induced 197/15a down-regulation, supporting the hypothesis that the latter effect is, at least in part, independent from de novo expression of repressors or molecules that control transcriptional activators, and relies on activation of preexisting repressor molecules; alternatively, transcriptional activators operating in resting cells may be specifically inactivated upon IL-2 stimulation.
Although IL-2 treatment inhibits both CD161 and 197/15a expression, the experimental evidence reported here (different kinetics of gene modulation, distinct effects of IL-15 on the two genes, and enhanced expression of CD161 exclusively by IL-12) indicates that transcriptional modulation of these two genes involves different molecules. Moreover, our data present the first experimental evidence, to our knowledge, of positive regulation of gene transcription mediated specifically via IL-12R stimulation. This makes CD161 an especially interesting target for studies of the molecular mechanisms involved in its regulation. Definition, via genomic cloning, of the promoter structure of both genes, presently under way in our laboratory, will allow the characterization of IL-12-, IL-2-, and IL-15-responsive element(s) and the identification of DNA-binding complexes specifically induced by each cytokine, involved in transcriptional regulation of 197/15a and CD161, and possibly other genes relevant to NK cell biology.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia. ![]()
3 Current address: R. W. Johnson Pharmaceutical Research Institute, La Jolla, CA. ![]()
4 Address correspondence and reprint requests to Dr. Bice Perussia, Thomas Jefferson University, Kimmel Cancer Center, BLSB 750, 233 S 10th Street, Philadelphia, PA 19107. E-mail ![]()
5 Abbreviations used in this paper:
c, common
-chain; Jak, Janus kinase; MAPK, mitogen-activated protein kinase; MEKK, mitogen-activated protein kinase kinase; NF-AT, nuclear factor of activated T cells; poly(A)+, polyadenylated. ![]()
Received for publication March 11, 1998. Accepted for publication June 2, 1998.
| References |
|---|
|
|
|---|
chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annu. Rev. Immunol. 14:179.[Medline]
-chain signaling cytokines regulate activated T cell apoptosis in response to growth factor withdrawal: selective induction of anti-apoptotic (bcl-2, bcl-xL) but not pro-apoptotic (bax, bcl-xS) gene expression. Eur. J. Immunol. 26:294.[Medline]
RIII induces c-myc-dependent apoptosis. J. Immunol. 154:491.[Abstract]
R-dependent MAP kinase activation in leukocytes: a common signal transduction event necessary for expression of TNF-
and early activation genes. J. Exp. Med. 184:1027.
induction by natural killer cell stimulatory factor (NKSF/IL-12): role of transcription and mRNA stability in the synergistic interaction between NKSF and IL-2. J. Immunol. 148:92.[Abstract]
ß+, TCR-
+ T lymphocytes, and NK cells. J. Immunol. 149:3495.[Abstract]
This article has been cited by other articles:
![]() |
D. B. Rosen, W. Cao, D. T. Avery, S. G. Tangye, Y.-J. Liu, J. P. Houchins, and L. L. Lanier Functional Consequences of Interactions between Human NKR-P1A and Its Ligand LLT1 Expressed on Activated Dendritic Cells and B Cells J. Immunol., May 15, 2008; 180(10): 6508 - 6517. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ravet, D. Scott-Algara, E. Bonnet, H. K. Tran, T. Tran, N. Nguyen, L. X. Truong, I. Theodorou, F. Barre-Sinoussi, G. Pancino, et al. Distinctive NK-cell receptor repertoires sustain high-level constitutive NK-cell activation in HIV-exposed uninfected individuals Blood, May 15, 2007; 109(10): 4296 - 4305. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Roth, M. Mittelbronn, W. Wick, R. Meyermann, M. Tatagiba, and M. Weller Malignant Glioma Cells Counteract Antitumor Immune Responses through Expression of Lectin-Like Transcript-1 Cancer Res., April 15, 2007; 67(8): 3540 - 3544. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hilliard, B. Hilliard, S.-J. Zheng, H. Sun, T. Miwa, W. Song, R. Goke, and Y. H. Chen Translational Regulation of Autoimmune Inflammation and Lymphoma Genesis by Programmed Cell Death 4 J. Immunol., December 1, 2006; 177(11): 8095 - 8102. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Yang, C. P. Matthews, T. Clair, Q. Wang, A. R. Baker, C.-C. H. Li, T.-H. Tan, and N. H. Colburn Tumorigenesis Suppressor Pdcd4 Down-Regulates Mitogen-Activated Protein Kinase Kinase Kinase Kinase 1 Expression To Suppress Colon Carcinoma Cell Inv |