The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Azzoni, L.
Right arrow Articles by Perussia, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Azzoni, L.
Right arrow Articles by Perussia, B.
The Journal of Immunology, 1998, 161: 3493-3500.
Copyright © 1998 by The American Association of Immunologists

Differential Transcriptional Regulation of CD161 and a Novel Gene, 197/15a, by IL-2, IL-15, and IL-12 in NK and T Cells1

Livio Azzoni, Olga Zatsepina2, Bekele Abebe, Ian M. Bennett, Palanisamy Kanakaraj3 and Bice Perussia4

Department of Microbiology and Immunology, Kimmel Cancer Center, Jefferson Medical College, Philadelphia, PA 19107


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokine-mediated enhancement of spontaneous cytotoxicity depends, at least in part, on modulation of the expression of surface molecules responsible for recognition of target cell structures and triggering or inhibition of the cytotoxic machinery. We previously demonstrated that expression of transcription factors (e.g., Egr-1, JunB, and c-Fos) is differentially regulated by IL-2 and IL-12. Here we show that expression of CD161/NKR-P1A, a molecule involved in triggering cytotoxicity, is specifically up-regulated by IL-12. CD161 transcription, mRNA accumulation, and surface expression are increased by IL-12. Other cytokines sharing the IL-2R ß- and/or common {gamma}-chains (i.e., IL-15, IL-4, and IL-7) do not mediate these effects. In an effort to analyze the mechanisms by which IL-2, IL-12, and IL-15 differentially regulate gene transcription, we have isolated a novel gene, 197/15a, the expression of which in NK and T cells is down-regulated by IL-2 and IL-15, up-regulated by IL-12, and not affected by IL-4 and IL-7. IL-2 and IL-15 act, at least in part, repressing 197/15a transcription; their effect on 197/15a mRNA accumulation is partially independent of novel protein synthesis, likely not mediated by JunB, Bcl-2, or Bax, and requires the activity of rapamycin-sensitive molecule(s). The observation that IL-2 and IL-12 differentially modulate CD161 expression suggests the existence of cytokine-specific mechanisms of modulation of spontaneous cytotoxicity based on the regulation of expression of surface molecules involved in target cell recognition and/or triggering of the cytolytic machinery.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Spontaneous, MHC-nonrestricted cytotoxicity of NK cells against NK-sensitive (e.g., tumor or virus-infected cells) and resistant target cells is enhanced by cytokines in vitro and in vivo (1). The ability of NK/lymphokine-activated killer cells to interact with target cells depends on the expression of cell surface receptors and adhesion molecules capable of binding to yet to be defined ligands on the target cells (2, 3). Although a bona fide NK cell receptor has not been discovered yet, several activatory receptors have been identified (3, 4). Among these, the type II C-type lectins of the NKR-P1 family have been shown, in rodents, to trigger NK and dendritic cell-dependent cytotoxicity and cytokine production via a mechanism involving protein tyrosine kinase activation and intracellular Ca2+ mobilization (reviewed in Refs. 5 and 6). Although the available mAb to human CD161/NKR-P1A have no stimulatory effects on NK cells, CD161 has been shown to participate in triggering cytotoxic activity of certain human NK cell clones (7) and human macrophages (8) toward the murine cell line P815, suggesting that also in humans it may play a role in NK cell-mediated cytotoxicity. This role, as well as the identification of the ligand for CD161, reportedly a complex carbohydrate expressed at the target cell surface (9), awaits confirmation.

Several cytokines enhance cytotoxic activity of NK and Ag-specific T cells. Among these, IFN-{alpha}ß, IL-2, IL-15, and IL-12 are qualitatively similar in their ability to enhance target cell recognition and killing (10, 11). IL-2, IL-15, and IL-12 exert similar effects on other NK cell functions (e.g., cytokine production and proliferation) (10, 11, 12, 13). However, some of the activation events induced by the different cytokines are distinct. For example, only IL-12 supports the differentiation of CD4+ helper Th0 cells to a Th1 phenotype (14). Proliferation of resting NK cells is induced only by IL-2, although both IL-2 and IL-12 induce cytokine production in the same cells (12), and expression of membrane adhesion molecules (ß integrins) is differentially regulated by the two cytokines (15). IL-2 and IL-12 receptors activate distinct signaling pathways. The intermediate affinity IL-2 receptor (IL-2Rß/CD122) on resting NK cells shares with the IL-15 receptor the ß-chain (16), and the common {gamma} ({gamma}c)-chain,5 also a component of the IL-4, IL-7, and IL-15 receptors (17); the high affinity IL-12 receptor is composed of at least two chains, ß1 and ß2, both related to the common gp130 signal-transducing chain of the IL-6, granulocyte-CSF, and leukemia inhibitory factor receptors (18, 19). IL-2 and IL-12 receptors utilize distinct members of the Janus protein tyrosine kinase (Jak) family and activate different molecules of the STAT family (Jak 1 and 3 and STAT 1, 3, and 5 for the IL-2R and Jak 2, Tyk 2, and STAT 1, 3, and 4 for the IL-12R) (20, 21, 22, 23, 24). Different STAT complexes bind selective DNA sequences (25), and differential gene expression may be mediated by these complexes after IL-2 and IL-12 stimulation.

We have previously reported that IL-2, but not IL-12, stimulation induces expression of the immediate/early activation genes c-fos, junB, and egr-1, and of bcl-2 (26), expression of which correlates with differential resistance of IL-2- or IL-12-treated NK cells to corticosteroid-induced apoptosis (27, 28, 29). Most of these genes encode transcription factors, and induced AP-1-mediated transcriptional activity has been demonstrated exclusively in IL-2-stimulated cells (26). In addition to transcriptional activation, JunB-containing AP-1 complexes can mediate transcriptional repression (30); moreover, both c-Fos and Jun can inhibit transcription mediated by NF-IL-6 (31), and Bcl-2 can inhibit gene trans-activation mediated by the nuclear factor of activated T cells (NF-AT) by sequestering calcineurin (32, 33). Both transcriptional activation and repression may play a role to modulate expression of NK cell recognition structures and/or other effector cell molecules involved in triggering cytotoxicity on binding/recognition of different target cells.

Here we present evidence that CD161 participates in the triggering of polyclonal homogeneous human NK cell populations toward selected human (Daudi) tumor cell lines, as well as the murine P815. Treatment of NK cells with IL-12, but not IL-2, IL-15 or other cytokines sharing the {gamma}c-chain, results in increased transcription and surface expression of CD161/NKR-P1A. We also describe a novel gene, 197/15a, homologous to the mouse apoptosis-related MA-3 (34) and the human H731 (35) genes, the transcription of which is specifically down-regulated in both NK and T cells by IL-2 and IL-15 via a signaling pathway(s) involving rapamycin-sensitive molecule(s) and relying, in part, on factors constitutively expressed in NK cells. Evidence is presented to indicate that ß-chain-mediated signaling is required, and {gamma}c-chain is not sufficient, to transduce signals leading to 197/15a down-regulation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lymphocyte preparations and treatment

Human PBL were separated from venous blood obtained from healthy individuals after density gradient (Histopaque 1077; Sigma, St. Louis, MO) centrifugation and adherence to plastics. NK cells were purified from cocultures of PBL with 50-Gy-irradiated RPMI-8866 B-lymphoblastoid cell line, as described (36), by negative selection with a panel of mAb (OKT3, anti-CD3; B36.1, anti-CD5; B52.1, anti-CD14) and goat anti-mouse Ig-coated sheep E. The resulting populations were >95% CD16+/CD56+/CD3-, as determined by indirect immunofluorescence (flow cytometry) with a panel of mAb. T cells were prepared from the same cultures by negative selection with anti-CD16 (3G8, produced from cells kindly provided by Dr. J. Unkeless, Mount Sinai Medical School, New York, NY) and anti-CD56 (B159.5) mAb (36). As previously reported, T and NK cells purified from these cultures do not express early activation markers (e.g., IL-2R{alpha} and transferrin receptor), respond with fast kinetics to activating stimuli, and proliferate in response to IL-12, with maximal effect obtained with 2 ng/ml of the cytokine (Ref. 37; data not shown).

The different lymphocyte populations were cultured (5 x 106/ml) for the indicated times in RPMI 1640 medium (BioWhittaker, Walkersville, MD) supplemented with 10% heat-inactivated FBS (Sigma) with added or not rIL-2 (102 U/ml; sp. act. 1.1 x 106 U/mg; Hoffman-La Roche, Nutley, NJ, obtained through the Biologic Response Modifiers Program, National Cancer Institute), rIL-12 (5 ng/ml; sp. act. 4.5 x 106 U/mg of protein in an IFN-{gamma} induction assay; kindly provided by Dr. S. Wolf, Genetics Institute, Andover, MA), rIL-15 (20 ng/ml; sp. act. 2.95 x 108 U/mg of protein; Immunex, Seattle, WA), rIL-4 (10 ng/ml; sp. act. 107 U/mg of protein; Genzyme, Cambridge, MA), rIL-7 (5 ng/ml; R&D Systems, Minneapolis, MN) or IFN-ß (500 U/ml; anti-viral titer, 1.5 x 108 U/mg of protein, provided by Dr. J. S. Price, Cetus, Emeryville, CA). The concentrations of IL-2, IL-12, and IL-15 used were double those required for maximal proliferation of NK or T cells prepared as described. Where indicated, cells were pretreated (30 min, 37°C) with 50 µM PD098059 (a gift from Dr. A. Saltiel, Parke-Davis Pharmaceutical Research/Warner-Lambert, Ann Arbor, MI), inhibiting IL-2-mediated activation of mitogen-activated protein kinase (MAPK) kinase (MEKK) (38), or 30 µM emetine (Sigma; inhibiting protein synthesis by >70% (37)).

CD161 expression was analyzed on NK cells treated with trypsin (1 mg/ml serum-free medium, 107 cells/ml, 20 min, 37°C) in the presence of DNase A (0.1 mg/ml) (both from Sigma).

Indirect immunofluorescence

This was performed as previously described, using the indicated mAb and human Ig-adsorbed, FITC-conjugated goat F(ab')2 anti-mouse Ig (Cappel, Durham, NC). Samples were analyzed on an EPICS Profile flow cytofluorimeter (Coulter, Hialeah, FL). All mAb used, including the anti-CD161 mAb B199.2 (39), have been produced and characterized in our laboratory (36).

Cell-mediated cytotoxicity

This was tested in 4-h 51Cr release assays with the indicated target cell lines (104 target cells/well) and different numbers of effector NK cells, as previously described (40). When indicated, anti-CD161, or anti-CD56 mAb as control, were present (10 µg/ml) throughout the assay. LU45% were calculated as previously described (40).

mRNA extraction, purification, and Northern blot analysis

Total RNA was extracted from the indicated cells with a guanidinium/phenol/chloroform-based method (Trizol; Life Technologies, Grand Island, NY), following the manufacturer’s specifications. Polyadenylated (poly(A)+) mRNA was purified from a minimum of 100 µg of RNA with the use of biotin-conjugated oligo(dT) and avidin-coated paramagnetic particles (Poly(A)Tract; Promega, Madison, WI). Aliquots of the mRNA were electrophoresed in 16% formaldehyde-agarose gels, transferred to nylon membranes (Hybond; Amersham, Arlington Heights, IL), UV-cross-linked, and analyzed by Northern blotting as described (26). cDNA encoding CD161 was obtained by RT-PCR (3' primer, CAAGAGTCAAGAGTCAGG; 5' primer, TCTGCCATGGACCAACAAGC) from NK cells; bax cDNA was a kind gift of Dr. E. Alnemri (Kimmel Cancer Center, Philadelphia, PA); the sources of pBAE, ß2-microglobulin, TCR ß-chain (detecting a nonproductive, truncated 2.0-kb mRNA in NK cells), and IFN-{gamma} cDNA have been previously reported (41). cDNA probes were labeled with [{alpha}-32P]dCTP (sp. act. 3000 Ci/mmol; ICN Pharmaceutical, Costa Mesa, CA) by nick translation (Boehringer Mannheim, Indianapolis, IN), and hybridized to the membrane-bound RNA. Hybridization was detected by autoradiography, and densitometric analysis was performed with a laser scanner (Personal Densitometer; Molecular Dynamics, Sunnyvale, CA) with proprietary software (ImageQuant). Levels of ß2-microglobulin mRNA served to control for equivalent amounts of total RNA loaded in each lane. Computer-assisted imaging was performed on the scanned autoradiograms. The backgrounds in the figures shown are typical of those in the original films.

RT-PCR differential display

The protocol described by Liang and Pardee (42) was used, modified as follows: 1) reverse transcription: poly(A)+ RNA from NK cells stimulated for 2 h with IL-2 or IL-12 were used as templates. Heat-denatured RNA was primed with T12MA, T12MT, T12MC or T12MG oligodeoxyribonucleotide (M = A/C/G) at 37°C, and RT was performed with Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI), 1 h, 35°C; 2) PCR: 40 amplification cycles (94°C, 1 min; 42°C, 30 s; 72°C, 30 s) were performed with T12MA, T12MT, T12MC, or T12MG as 3' primers and arbitrary decamers as 5'-primers. DNA Taq polymerase was from Fisher Scientific (Pittsburgh, PA). PCR products were labeled with [35S]dATP (10 µCi/20-µl reaction; sp. act. >1000 Ci/mmol; Amersham). The resulting cDNA species were size fractionated by electrophoresis in 50% urea, 6% acrylamide-Tris-buffered EDTA gels. These were dried and exposed to autoradiographic film (Biomax; Kodak, Rochester, NY). The bands corresponding to mRNA species differentially expressed on IL-2 or IL-12 stimulation were excised, the corresponding cDNA was eluted in boiling water, and an aliquot of the eluate was reamplified with the same primers used in the first amplification. PCR products were ligated in a T/A bacterial expression vector (pCRII; Invitrogen, San Diego, CA) and introduced in competent Escherichia coli. Several cDNA clones were analyzed following EcoRI digestion. Clones containing cDNA inserts of the appropriate size were sequenced using dideoxy terminator reaction chemistry for sequence analysis on the Applied Biosystems (Foster City, CA) Model 377 DNA sequencing system. The same cDNA clones were used as probes to detect mRNA expression in Northern blot analysis of total and/or poly(A)+ RNA extracted from the indicated cell types.

cDNA library screening

A {lambda}ZAPII cDNA library, obtained from the Jurkat lymphoblastoid T cell line by mixed oligo(dT) and random priming (800-bp average size), was purchased from Stratagene (La Jolla, CA), titrated, plated, and screened for positive clones by hybridization of duplicate filter plaque lifts with the 32P-labeled (NEN-DuPont, Boston, MA) RT-PCR differential display product 197/15a, following the manufacturer’s specifications. Secondary and tertiary screening were performed on the positive plaques isolated. cDNA from positive plaques was excised in vivo by coinfection with the helper phage ExAssist in the nonsuppressive E. coli strain SOL-R (Stratagene), following the manufacturer’s specifications. The double-stranded cDNA clones obtained were sequenced with dideoxy terminator reaction chemistry as above, or manually with [35S]dATP (Amersham) incorporation and dideoxy-NTP termination (Sequenase version 2.0; United States Biochemical/Amersham, Cleveland, OH), following the manufacturer’s specifications. Manual sequences were resolved on denaturing 6% PAGE. Gels were dried and exposed to autoradiographic film (Biomax). The sequences obtained were overlapped and analyzed with GCG software (Kimmel Cancer Center) and compared with sequences in the National Center for Biotechnology Information databases using the Basic Local Alignment Search Tool (BLAST) algorithm.

Run-on analysis

Nuclei from cells (50 x 106) stimulated with IL-2 and IL-12 for the indicated times were isolated on discontinuous sucrose gradient, and in vitro nuclear RNA transcription was performed according to the method of Chan et al. (43): [{alpha}-32P]UTP (sp. act. 3000 Ci/mmol; NEN-DuPont)-labeled RNA was extracted from the nuclei with 1 ml of Trizol reagent (Life Technologies), following the manufacturer’s specifications, in the presence of 10 µg of yeast tRNA as a carrier. After purification on Sephadex G-50 columns (Boehringer-Mannheim), radiolabeled RNA was hybridized (42°C, 72 h) to nitrocellulose membranes (MSI, Westboro, MA) on which 3 µg of CD161, 197/15a, pBAE, or ß2-microglobulin cDNA had been immobilized. The filters were washed and exposed to Phosphor Screen (Molecular Dynamics); quantitative image analysis was performed on a Molecular Dynamics Phosphorimager using ImageQuant software. Permanent record of hybridization was obtained after exposure of the filters to autoradiography film (AR; Kodak).

Statistical analysis

The two-tailed t test was used. Values of p < 0.05 are considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Role of CD161 in cytotoxicity of human polyclonal NK cells

The cytotoxic activity of polyclonal homogeneous NK cell populations obtained from short term cultures was tested against a panel of human (Daudi, Raji, CEMM, Jurkat, K562, U937, THP-1, HL-60) and murine (P815) cell lines with or without added anti-CD161 mAb B199.2. In agreement with a previous report using NK cell clones (7), the cytotoxic activity of the primary population against the murine P815 target cells was inhibited by the anti-CD161 mAb.2 (by 77.2 ± 9%; n = 3, based on calculation of LU45%). Interestingly, cytotoxicity against the human B-lymphoblastoid cell line Daudi (Fig. 1Go), but not that against the other cell lines tested (Jurkat and K562 reported as example), was significantly reduced (76.7% and 56.4% in two separate experiments), indicating that CD161 can be differentially involved in triggering cytotoxicity of polyclonal human NK cell populations against selected human target cells.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Involvement of CD161 in spontaneous cytotoxicity. Cytotoxicity of short term culture homogeneous polyclonal NK cell populations was measured in 4-h 51Cr release assays using the indicated E:T ratios. Medium ({diamondsuit}), anti-CD56 mAb B159.5 (), or anti-CD161 mAb B199.2 (+) (10 µg/ml) were added throughout the assay.

 
Modulation of CD161 expression by IL-2 or IL-12

To determine whether IL-2 and IL-12 modulate differentially expression of surface differentiation antigens, several of these were analyzed by indirect immunofluorescence on NK cells at the indicated times in culture with either cytokine. As shown in Figure 2Go (left), CD161 expression on cells cultured for 1 day with IL-12 was increased compared with that on cells cultured for the same time with IL-2 or no cytokine. Expression of CD16 and other surface antigens (CD56, CD2, CD94, and p70 killer-inhibitory receptor, not shown) was instead similar in all culture conditions. After trypsin treatment (Fig. 2Go, right, a), NK cells lost reactivity with the anti-CD161 mAb B199.2. To determine whether IL-2 and IL-12 affect CD161 expression interfering with its de novo synthesis, membrane expression was analyzed in NK cells cultured with either cytokine for 1 or 4 days after trypsin treatment, to allow complete resynthesis of the molecule after cleavage. As shown in Figure 2Go (right, b, c, and d), cells cultured with IL-12 expressed levels of CD161 that, although similar to those detected on cells cultured in medium alone, were higher than those on cells cultured with IL-2. In separate experiments, cells cultured with IL-15 expressed levels of CD161 higher than those on cells cultured in medium alone or IL-2 but lower than those on IL-12-treated cells (not shown).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Surface expression of CD161 on NK cells cultured with IL-2 or IL-12. Left, NK cells were cultured for 1 (a, b, c) or 5 days (d, e) in medium without (a) or with rIL-2 (100 U/ml, b, d) or IL-12 (5 ng/ml, c, e). Indirect immunofluorescence (flow cytometry) was performed with irrelevant Ig (·····), anti-CD161 mAb B199.2 (); anti-CD16 mAb 3G8 (– – – –), and FITC-conjugated goat anti-mouse IgG. Mean fluorescence channel values are indicated above the corresponding peak. Right panels: a, Indirect immunofluorescence was performed on NK cells using anti-CD161 mAb B199.2 before () or after (– – – –) treatment with trypsin as described in Materials and Methods (·····, irrelevant mAb). b to d, Trypsin-treated NK cells were cultured for 4 days with medium alone (b), rIL-2 (100 U/ml, c) or rIL-12 (5 ng/ml, d). Immunofluorescence analysis was performed with irrelevant mAb (·····), anti-CD161 mAb B199.2 (1-day culture) (– – – –), or anti-CD161 mAb B199.2 (4-day culture) ().

 
To test the hypothesis, from the above data, that IL-12 allows synthesis and reexpression of the molecule after cleavage, whereas IL-2 inhibits it, we analyzed CD161 mRNA accumulation in NK cells after cytokine treatment. As shown in Figure 3GoA (experiment representative of six performed), IL-12 induced a significant increase (177.0 ± 45.7% of unstimulated cells, n = 6, p <0.05), and IL-2 induced a significant decrease (42.1 ± 28.7% of unstimulated cells, n = 6, p < 0.05) of CD161 mRNA accumulation. Both effects were maximal at 6 h and persisted up to 18 h of stimulation. The two cytokines combined had only a marginal effect (84.8 ± 46.6% of unstimulated cells, n = 6, p > 0.05).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. Modulation of CD161 expression in NK cells by IL-2 and IL-12. A, Northern blot analysis was performed on total RNA from NK cells incubated for the indicated times in medium without (none) or with rIL-2, 100 U/ml, or rIL-12, 5 ng/ml. The same filter was sequentially hybridized to 32P-labeled CD161 (top) and human ß2-microglobulin cDNA for normalization (bottom). The relative mobility of 18S ribosomal RNA is indicated. B, Nuclear run-on analysis was performed on NK cells stimulated for 6 h as in A. Hybridization of 32P-labeled nuclear RNA to CD161 and to TCR ß-chain cDNAs was detected by autoradiography (left).

 
To determine whether the observed effects depend on cytokine-induced modulation of CD161 transcription rate, run-on analysis was performed on nuclei isolated from 6-h IL-2- or IL-12-stimulated NK cells (Fig. 3GoB). CD161 transcription in nonstimulated cells, normalized to ß2-microglobulin, was 100 arbitrary units (average, n = 2). IL-2 and IL-15 had little effect on it (mean 85.4 and 116 arbitrary units, n = 3 and 2, respectively), whereas IL-12 induced a marked increase of its transcription rate (174 arbitrary units, n = 3). Taken together, these findings indicate that whereas the IL-12-mediated increase in CD161 mRNA accumulation depends, at least in part, on its increased transcription, other mechanisms (e.g., increased mRNA degradation) may participate in the IL-2-mediated down-modulation of the same gene.

Isolation of 197/15a, a novel gene the expression of which is differentially regulated upon IL-2 and IL-12 stimulation

To determine whether expression of additional genes is regulated differentially by IL-2 and IL-12, we performed RT-PCR differential display on mRNA obtained from NK cells treated for 2 h with either cytokine. This time point was chosen to maximize the chances of isolating genes the expression of which is regulated directly by signaling events (immediate/early genes), rather than "second wave" genes. An mRNA species expressed in IL-12- but not in IL-2-stimulated cells was isolated. The corresponding cDNA (197/15a) hybridized to mRNA from NK cells. 197/15a mRNA was also detected in the B (Daudi, RPMI-8866, CESS), T (Jurkat, MOLT 4), myeloid (HL-60, ML-3, U937, THP-1), and solid tumor-derived cell lines (A431, MCF7, PC3, LNGAP, SW48) analyzed (not shown). In primary NK and T cells (Fig. 4Go, A and B, respectively), two mRNA species with different mobility in 1.2% agarose gels were consistently detected in nonstimulated control cells; mRNA accumulation was either maintained or increased after 2 h of IL-12 treatment (131.6 ± 47.9% of unstimulated cells, n = 12; p < 0.05) but decreased after IL-2 stimulation at the same time point (47.1 ± 14.7%, n = 12, p < 0.05) and up to 6 h (not shown). The two cytokines combined induced marginal decrease of 197/15a expression (76.4 ± 20.6%, n = 7, p < 0.05).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. 197/15a expression in IL-2- and IL-12-stimulated lymphocytes. Northern blot analysis was performed on total RNA from NK (A) and T cells (B), obtained as described in Materials and Methods and incubated for the indicated times in medium without (none) or with rIL-2, 100 U/ml, or rIL-12, 5 ng/ml. The filters were hybridized sequentially to 197/15a, IFN-{gamma}, and ß2-microglobulin 32P-labeled cDNA, as indicated. The relative mobility of 18 and 28S ribosomal RNA are indicated. C, Nuclear run-on analysis was performed on NK cells incubated for 2 h under the conditions indicated. 32P-labeled nuclear RNA was hybridized to 197/15a and to TCR ß-chain cDNA and detected as in Figure 3Go.

 
To isolate the full length cDNA sequence of this gene, a {lambda}ZAPII cDNA library obtained from the T cell line Jurkat, in which relatively high RNA levels are detected, was screened using 197/15a cDNA under high stringency conditions. Two positive clones of ~2500 and ~2000 bp, respectively, were isolated, and their sequence was determined using the dideoxy-NTP termination method. The sequence (GenBank accession number U96628) revealed a high degree of homology (88% identity) with a mouse gene independently isolated by Shibahara et al. (34), and by Onishi and Kizaki (44). Expression of this gene is increased in thymocytes and RVC lymphoma cells, respectively, after corticosteroid- or topoisomerase inhibitor-induced apoptosis. With the exception of an additional 87 bp at position 126, resulting in a different predicted start codon, and the lack of the first 15 amino acids (MDVENEQILNVNPAD), the 197/15a sequence is also 98% identical with the cDNA sequence of the human H731 gene, encoding a protein the expression of which is modulated during the cell cycle in chick embryo cells and mouse fibroblasts (35, 45). The accuracy of our sequence was confirmed sequencing a cDNA product obtained from NK cell-derived mRNA with the use of RT-PCR with primers encompassing the region of interest (5' = 87–106; 3' = 217–234). The differences between 197/15a and H731 in the predicted protein sequences do not encompass areas previously identified as putative casein kinase (amino acids 25–29 and 33–35) or protein kinase (amino acids 64–74; 102–109; 211–223; 237–243; 367–393) phosphorylation site motifs or the location of basic and acidic domains.

Regulation of 197/15a expression

To define the molecular mechanisms of IL-2-mediated down-modulation of 197/15a mRNA accumulation, run-on analysis was performed on nuclear RNA extracted from NK cells stimulated for 2 h with either IL-2 or IL-12. As shown in Figure 4GoC (experiment representative of two performed), IL-2 treatment, compared with that with IL-12, resulted in lower levels (47%) of 197/15a transcription; in separate experiments, transcription levels of 197/15a in IL-2-stimulated cells were 56% of those in unstimulated cells. These data indicate that the IL-2 controls expression of this gene, at least in part, via negative transcriptional regulation.

To determine whether down-modulation of 197/15a depends on expression of repressor molecules induced by IL-2, but not by IL-12, we analyzed the effect of inhibitors of different biochemical pathways known to lead to expression of these genes. Similar studies on CD161 expression could not be performed because of poor cell viability after lengthy treatment with the various inhibitors. IL-2, but not IL-12, induces expression of AP-1 family genes (c-fos and junB) and bcl-2 in NK and T cells (26). JunB has been demonstrated to act as a transcriptional repressor (30, 31). Treatment of NK cells with the MEKK inhibitor PD098059 resulted in >65% inhibition of IL-2-induced junB mRNA accumulation (not shown), indicating that activation of the MAPK pathway is a required signaling event. However, as reported in Table IGo, the IL-2-mediated down-modulation of 197/15a mRNA accumulation was not affected under the same conditions. Bcl-2 acts as a transcriptional repressor interfering with NF-AT-mediated transcription (33), and its induced expression in B cells is sensitive to rapamycin (46). Rapamycin treatment of NK cells inhibited, as expected, IL-2-induced activation of p70s6 kinase (not shown) and reduced significantly the down-modulatory effect of IL-2 on 197/15a expression (Table IGo) without affecting IL-2-induced bcl-2 expression (not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Effect of rapamycin, MEKK, and protein synthesis inhibitors on IL-2 and IL-12-mediated modulation of 197/15a

 
In the IL-2-dependent T lymphoma cell line 2780a, overexpression of Gfi-1 results in repression of bax and bak transcription, and protection from IL-2 withdrawal-induced apoptosis, suggesting that this transcriptional repressor may mediate the inhibitory effects of IL-2 (47). NK cells were stimulated for 2 or 6 h with IL-2, IL-15, or IL-12, alone or in combination, and bax mRNA accumulation was detected in Northern blotting. In two separate experiments, cytokine treatment did not affect significantly bax expression, although inducing, as expected, IFN-{gamma} mRNA accumulation (not shown), suggesting that Gfi-1 does not participate in the IL-2-mediated repression of CD161 or 197/15a transcription at the time points analyzed.

The requirement for de novo protein synthesis in the IL-2-mediated repression of 197/15a was tested in Northern blot analysis of total RNA from NK cells cultured for 2 h with or without IL-2, IL-12, and emetine. As summarized in Table IGo, emetine treatment reduced significantly but did not abolish the IL-2-induced down-modulation of 197/15a mRNA accumulation, indicating that the effect is in part independent from de novo protein synthesis; the effect of IL-12 on 197/15a expression was not significantly affected under the same conditions.

Modulation of 197/15a and CD161 expression in NK cells by cytokines utilizing receptors that share the {gamma}c-chain

The IL-2 but not the IL-12 receptor shares a {gamma}c-chain with the IL-4, IL-7, and IL-15 receptors (reviewed in 17 , all expressed in NK cells, and stimulation of the latter receptors results in functional effects similar to those induced by IL-2 (28, 29, 48, 49). Additionally, IL-2 and IL-15 receptors share the IL-2R ß-chain as a signal transducing moiety. To start analyzing the role of ß- and {gamma}c-chains in transducing events leading to CD161 and 197/15a down-modulation and to define the cytokine specificity of this effect, CD161 and 197/15a mRNA accumulation were analyzed in NK cells stimulated with different cytokines, with or without IL-12 added. IL-15, like IL-2, but unlike IL-4, IL-7 (Table IIGo), or IFN-ß (not shown), induced significant decrease in the expression of 197/15a, whereas IL-12, alone or in combination with IL-4 and with IL-7, increased it significantly. Only IL-2 down-modulated significantly CD161 mRNA accumulation, whereas IL-12, alone or in combination with IL-4 and IL-15, enhanced it significantly. These results indicate that {gamma}c-chain usage is insufficient, per se, to transduce signals resulting in transcriptional repression or activation of the genes studied. Moreover, the differential sensitivity of CD161 and 197/15a to IL-2 and IL-15 treatment suggests that different biochemical pathways control the expression of the two genes.


View this table:
[in this window]
[in a new window]
 
Table II. Effect of cytokines utilizing receptors sharing {gamma}c-chain on expression of 197/15a and CD161 in NK cells

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokine stimulation of NK cells, inducing expression of genes encoding cytokines, transcription factors, cytotoxic mediators, and surface molecules responsible for their biologic functions, represents an important mechanism for the regulation of immune responses. IL-2, IL-12, and IL-15 induce similar, yet distinct, functional effects on NK cells (50). Here we report evidence that the three cytokines differentially regulate expression of at least two genes, CD161 (NKR-P1A) and 197/15a, and that this differential regulation occurs, at least in part, at the transcriptional level. This, together with the novel observation that CD161 is indeed involved in cytotoxicity of human polyclonal NK cell populations against selected human target cells, supports the possibility that cytotoxic activity of human NK cells against some target cells may be preferentially regulated by different cytokines.

Engagement of the C-type lectin CD161 triggers the cytotoxicity activity of rodent NK and dendritic cells (6, 51). Here we demonstrate that blocking this molecule with nonstimulatory anti-CD161 mAb reduces significantly NK cell cytotoxicity of NK cell populations toward at least one human target cell line (Daudi, B-lymphoblastoid). This observation extends to a human target cell and to polyclonal NK cells previous reports (7) on murine target cells (insensitive to resting human NK cells) and NK cell clones (i.e., cells stimulated with large doses of IL-2 in long term cultures) and supports the hypothesis that CD161 may play a relevant role in NK cell-mediated cytotoxicity in vivo. Of the human hematopoietic cell lines tested, only Daudi appears capable to trigger cytotoxic activity in a CD161-dependent fashion, suggesting that the use of CD161 for recognition/activation by NK cells is selective for specific target cells. Alternatively, CD161 may behave like a killer-inhibitory receptor, and the inhibition of cytotoxicity against the Fc{gamma}RII+ Daudi in the presence of the IgG2b anti-CD161 mAb may depend on induced cross-linking of this molecule at the NK cell membrane, with consequent triggering of its inhibitory activity. The observation that the same mAb does not inhibit killing of other Fc{gamma}RII+ cell lines (specifically K562, Raji, U937, THP-1, and HL-60) that can function as Daudi cells to cross-link CD161 on the NK cells is against this hypothesis. Studies in murine NK cells (6, 51) and in human dendritic cells (52) also support an activatory role for CD161.

Regulation of the surface expression of CD161 may be expected to affect the cytotoxic activity of NK cells, at least against selected (i.e., CD161 ligand expressing) target cells. Our observation that only IL-2, among several cytokines tested, inhibits CD161 expression suggests the possibility that this cytokine alters preferentially cytotoxic responses of NK cells to CD161-engaging target cells, therefore contributing to diversify NK cell responses to the different cytokines and target cells. Although it is possible that increased expression of a cytotoxicity-triggering receptor (like that specifically induced by IL-12) contributes to more efficient killing of distinct target cells, direct proof of this prediction cannot be obtained with primary NK cells. In these cells, cytokine activation induces expression of several molecules involved in cytotoxic activity (e.g., adhesion molecules (15), perforin, granzymes (53), and possibly additional molecules yet to be identified). This makes it impossible to distinguish effects that depend directly on cytokine-induced altered expression of CD161 from those related to the other effects. Studies of the effect of CD161 gene inactivation or overexpression in cytotoxic cell lines, beyond the scope of the present study, are needed to define the functional consequence specifically of the modulation of CD161 expression human NK cell-mediated cytotoxicity.

Although IL-2 and IL-15 bind to receptors that share both ß- and {gamma}c-chains (16), a combination considered sufficient for complete signaling (46), only IL-2 affects significantly CD161 expression. Because the cultured NK cells we used do not express detectable levels of IL-2R {alpha}-chain and stimulation of cytokine receptors utilizing only the {gamma}c-chain (IL-4R and IL-7R) does not affect CD161 mRNA accumulation, our data suggest that engagement of the IL-15R {alpha}-chain transduces signals that serve to maintain expression of CD161 mRNA and that IL-2R ß-chain-mediated signaling is required to induce down-regulation of this gene, whereas the {gamma}c-chain is not sufficient. Requirement for ß-chain signaling may not be restricted to CD161 modulation, as suggested by the observation that mRNA accumulation of another gene, 197/15a, in NK and T cells is specifically down-modulated by IL-2 and IL-15, but not by IL-12, IL-4, or IL-7. IL-2-mediated down-regulation of 197/15a is, at least in part, transcriptional, as demonstrated by the reduced transcription rate of this gene in IL-2-treated cells, compared with untreated or IL-12-stimulated cells.

IL-2 significantly inhibits expression of both 197/15a and CD161 mRNA, but the molecular mechanisms involved likely differ, because: 1) only 197/15a transcription is significantly down-regulated by IL-2 treatment and 2) down-regulation of 197/15a and CD161 mRNA expression occurs with different kinetics (detectable after 2 and 6 h of stimulation, respectively). Although IL-2 markedly reduces CD161 mRNA expression, it only marginally affects its transcription rate (84% of unstimulated control). Therefore, it is likely that posttranscriptional mechanisms, e.g., heterogeneous RNA processing and reduced mRNA stability, are involved in the observed IL-2-induced down-modulation of CD161 mRNA accumulation. On the contrary, only IL-12, of the cytokines tested, induces increased transcription of CD161; this is likely to contribute to the IL-12-specific positive regulation observed at both mRNA and protein level.

The 197/15a cDNA sequence is highly homologous to that of the murine MA-3 gene, isolated by separate groups from lymphoid cells induced to undergo apoptosis with a variety of stimuli, including topoisomerase inhibitors, corticosteroids, and cytokine deprivation (34, 44). Because 197/15a mRNA is abundant both in resting primary cells and in proliferating cell lines, we did not analyze its expression in apoptosis-inducing conditions. However, it is tempting to speculate that low levels of expression of this gene may correlate with cell survival and protection from apoptosis. Such an effect, if proved, is unlikely to depend directly on expression of this gene, since IL-12, IL-4, and IL-7 protect NK cells from IL-2 withdrawal-induced apoptosis (28) without inducing 197/15a down-modulation (our data). Also, IL-2, IL-15, and IL-12 all prime NK cells for activation-induced apoptosis via the Fc{gamma}RIIIA (Ref. 54; our unpublished results) irrespective of their effect on 197/15a expression, indicating that protection from apoptosis, if related to expression of 197/15a, may be limited to specific conditions exclusive of activation-mediated apoptosis. Experiments using antisense oligodeoxyribonucleotide to down-modulate 197/15a expression (not shown) did not yield significant results, and the possible role of this gene in cell division/survival remains to be determined.

197/15a cDNA sequence is identical, with the exception of 87 bp in its 5'-region, with the human H731 gene, encoding a protein of ~56 kDa, expression of which is modulated during the cell cycle (35, 45). Abs to an epitope contained within the first 147 amino acids of this protein did not detect IL-2-down-modulated products in NK cells, as analyzed in Western blotting or immunocytochemistry (not shown). It is unlikely that sequencing errors account for the differences observed between 197/15a and H731 because two identical 197/15a sequences, with high homology to the 5'-region of the murine gene, have been cloned independently from the Jurkat cell line and from primary NK cells. However, differential splicing or gene duplication cannot be excluded. Although the protein encoded by this gene remains to be identified and its function defined, the observation that IL-2, but not IL-12, negatively regulates its expression serves to underscore major differences in the biologic effects of these cytokines.

Negative gene regulation may result either from direct activation of repressor molecules and/or inactivation of transcriptional activators or from de novo expression of "first wave" genes encoding them. A few genes encoding molecules acting as transcriptional repressors in specific circumstances are expressed in NK cells after IL-2 but not IL-12 stimulation. We have started to investigate their possible role in the IL-2-mediated 197/15a down-modulation using an indirect approach. The observation that the MEKK inhibitor PD098059, while inhibiting IL-2-mediated junB induction (data not shown), has no effect on 197/15a regulation indicates that neither the former nor other molecules activated in a MAPK-dependent manner contribute to regulation of its expression. Several lines of evidence make Bcl-2 involvement unlikely: 1) Bcl-2 can exert transcriptional repression by sequestering calcineurin, thereby inhibiting NF-AT activation and nuclear translocation; however, NF-AT activity is not induced in NK cells upon IL-2 stimulation (our unpublished observations); 2) bcl-2 expression is induced late (6 h) in response to IL-2, whereas 197/15a transcription is down-modulated within 2 h and is, at least in part, independent of de novo protein synthesis; 3) the IL-2-induced bcl-2 expression in NK cells, unlike 197/15a down-modulation, is rapamycin resistant; and 4) IL-7 induces bcl-2 (29) without affecting 197/15a expression. Expression of bax, the negative regulation of which may reflect indirectly Gfi-1 repressor activity (47), is not modulated by IL-2 in NK cells. This observation, although it suggests that Gfi-1 does not play a major role in controlling 197/15a expression, does not rule this out completely: bax transcriptional regulation likely depends on a balance between the activity of both trans-activating and repressor molecules, and the effects of each single molecule might be difficult to isolate in intact cells. Taken together, our data support the conclusion that a yet to be defined molecule(s), target of IL-2-activated signaling elements and sensitive to rapamycin, controls 197/15a expression. It is also possible that the inhibitory effect of rapamycin depends, at least in part, on inhibition of p70s6 kinase or other target molecules, with consequent lack of activation of a repressor (55). Protein synthesis inhibition reverts only partially the IL-2-induced 197/15a down-regulation, supporting the hypothesis that the latter effect is, at least in part, independent from de novo expression of repressors or molecules that control transcriptional activators, and relies on activation of preexisting repressor molecules; alternatively, transcriptional activators operating in resting cells may be specifically inactivated upon IL-2 stimulation.

Although IL-2 treatment inhibits both CD161 and 197/15a expression, the experimental evidence reported here (different kinetics of gene modulation, distinct effects of IL-15 on the two genes, and enhanced expression of CD161 exclusively by IL-12) indicates that transcriptional modulation of these two genes involves different molecules. Moreover, our data present the first experimental evidence, to our knowledge, of positive regulation of gene transcription mediated specifically via IL-12R stimulation. This makes CD161 an especially interesting target for studies of the molecular mechanisms involved in its regulation. Definition, via genomic cloning, of the promoter structure of both genes, presently under way in our laboratory, will allow the characterization of IL-12-, IL-2-, and IL-15-responsive element(s) and the identification of DNA-binding complexes specifically induced by each cytokine, involved in transcriptional regulation of 197/15a and CD161, and possibly other genes relevant to NK cell biology.


    Acknowledgments
 
We thank Mr. D. Dicker and Dr. L. Zamai for assistance with flow cytometry and Dr. H. Alder for his expert assistance with sequencing and primer design.


    Footnotes
 
1 Supported in part by U.S. Public Health Service Grants CA37155, CA45284 (B.P.), T32-CA09683 (I.M.B.), and T32-CA09678 (P.K.). Back

2 Current address: Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia. Back

3 Current address: R. W. Johnson Pharmaceutical Research Institute, La Jolla, CA. Back

4 Address correspondence and reprint requests to Dr. Bice Perussia, Thomas Jefferson University, Kimmel Cancer Center, BLSB 750, 233 S 10th Street, Philadelphia, PA 19107. E-mail Back

5 Abbreviations used in this paper: {gamma}c, common {gamma}-chain; Jak, Janus kinase; MAPK, mitogen-activated protein kinase; MEKK, mitogen-activated protein kinase kinase; NF-AT, nuclear factor of activated T cells; poly(A)+, polyadenylated. Back

Received for publication March 11, 1998. Accepted for publication June 2, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Phillips, J. H., L. L. Lanier. 1986. Dissection of the lymphokine-activated killer phenomenon: relative contribution of peripheral blood natural killer cells and T lymphocytes to cytolysis. J. Exp. Med. 164:814.[Abstract/Free Full Text]
  2. Renard, V., A. Cambiaggi, F. Vely, M. Blery, L. Olcese, S. Olivero, M. Bouchet, E. Vivier. 1997. Transduction of cytotoxic signals in natural killer cells: a general model of fine tuning between activatory and inhibitory pathways in lymphocytes. Immunol. Rev. 155:205.[Medline]
  3. Leibson, P. J.. 1997. Signal transduction during natural killer cell activation: inside the mind of a killer. Immunity 6:655.[Medline]
  4. Olcese, L., A. Cambiaggi, G. Semenzato, C. Bottino, A. Moretta, E. Vivier. 1997. Human killer cell activatory receptors for MHC class I molecules are included in a multimeric complex expressed by natural killer cells. J. Immunol. 158:5083.[Abstract]
  5. Ryan, J. C., W. E. Seaman. 1997. Divergent functions of lectin-like receptors on NK cells. Immunol. Rev. 155:79.[Medline]
  6. Josien, R., M. Heslan, J.-P. Soulillou, M. C. Cuturi. 1997. Rat spleen dendritic cells express natural killer receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca++-dependent mechanism. J. Exp. Med. 186:467.[Abstract/Free Full Text]
  7. Lanier, L. L., C. Chang, J. H. Phillips. 1994. Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J. Immunol. 153:2417.[Abstract]
  8. Poggi, A., A. Rubartelli, L. Moretta, M. R. Zocchi. 1997. Expression and function of NKRP1A molecule on human monocytes and dendritic cells. Eur. J. Immunol. 27:2965.[Medline]
  9. Bezouska, K., C. T. Yuen, J. O’Brien, R. A. Childs, W. Chai, A. M. Lawson, K. Drbal, A. Fiserova, M. Pospisil, T. Feizi. 1994. Oligosaccharide ligands for NKR-P1 protein activate NK cells and cytotoxicity. Nature 372:150.[Medline]
  10. Perussia, B.. 1991. Lymphokine activated killer cells, NK cells, and cytokines. Curr. Opin. Immunol. 3:49.[Medline]
  11. Carson, W. E., J. G. Giri, M. J. Lindemann, M. L. Linett, M. Ahdieh, R. Paxton, D. Anderson, J. Eisenmann, K. Grabstein, M. A. Caligiuri. 1994. Interleukin (IL) 15 is a novel cytokine that activates human Natural Killer cells via components of the IL-2 receptor. J. Exp. Med. 180:1395.[Abstract/Free Full Text]
  12. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.[Abstract/Free Full Text]
  13. S. F., Wolf, P. A. Temple, M. Kobayashi, D. Young, M. Dicig, L. Lowe, R. Dzialo, L. Fitz, C. Ferenz, R. M. Hewick, et al 1991. Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J. Immunol. 146:3074.[Abstract]
  14. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, A. O’Garra, K. M. Murphy. 1996. Development of Th1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.
  15. Rabinowich, H., R. B. Herberman, T. L. Whiteside. 1993. Differential effects of IL12 and IL2 on expression and function of cellular adhesion molecules on purified human natural killer cells. Cell. Immunol. 152:481.[Medline]
  16. K. H., Grabstein, J. Eisenman, K. Shanebeck, C. Rauch, S. Srinivasan, V. Fung, C. Beers, J. Richardson, M. A. Schoenborn, M. Ahdieh, et al 1994. Cloning of a T cell growth factor that interacts with the ß chain of the interleukin-2 receptor. Science 264:965.[Abstract/Free Full Text]
  17. Sugamura, K., H. Asao, M. Kondo, N. Tanaka, N. Ishii, K. Ohbo, M. Nakamura, T. Takeshita. 1996. The interleukin-2 receptor {gamma} chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annu. Rev. Immunol. 14:179.[Medline]
  18. Chua, A. O., R. Chizzonite, B. B. Desa, T. P. Truitt, P. Nunes, L. J. Minetti, R. R. Warrier, D. H. Presky, H. Levine, M. K. Gately, U. Gubler. 1994. Expression cloning of a human IL-12 receptor component: a new member of the cytokine receptor superfamily with a strong homology to gp130. J. Immunol. 153:128.[Abstract]
  19. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C.-Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  20. Johnston, J. A., M. Kawamura, R. A. Kirken, Y. Q. Chen, T. B. Blake, K. Shibuya, J. R. Ortaldo, D. W. McVicar, J. J. O’Shea. 1994. Phosphorylation and activation of the JAK3 Janus kinase in response to IL-2. Nature 370:151.[Medline]
  21. Jacobson, N. J., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, Jr J. E. Darnell, K. M. Murphy. 1995. Interleukin 12 signalling in T helper type (Th1) cells involves tyrosin phosphorylation of signal transducer and activator of transcription (Stat) 3 and Stat 4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  22. Hou, J., U. Schindler, W. J. Henzel, S. C. Wong, S. L. McKnight. 1995. Identification and purification of human Stat proteins activated in response to interleukin-2. Immunity 2:321.[Medline]
  23. Witthuhn, B. A., O. Silvennoinen, O. Miura, K. S. Lai, C. Cwik, E. T. Liu, J. N. Ilhe. 1994. Involvement of the Jak-3 Janus kinase in signaling by interleukins 2 and in lymphoid and myeloid cells. Nature 370:153.[Medline]
  24. Zou, J., D. H. Presky, C.-Y. Wu, U. Gubler. 1996. Differential association between the cytoplasmic regions of the interleukin-12 receptor subunits ß1 and ß2 and JAK kinases. J. Biol. Chem. 272:6073.[Abstract/Free Full Text]
  25. Schindler, U., P. Wu, M. Rothe, M. Brasseur, S. L. McKnight. 1995. Components of a Stat recognition code: evidence for two layers of molecular selectivity. Immunity 2:995.
  26. Azzoni, L., P. Kanakaraj, O. Zatsepina, B. Perussia. 1996. IL-12-induced activation of NK and T cells occurs in the absence of immediate/early gene expression. J. Immunol. 157:3235.[Abstract]
  27. Broome, H. E., C. M. Dargan, S. Krajewski, J. C. Reed. 1995. Expression of Bcl-2, Bcl-x and Bax after T cell activation and IL-2 withdrawal. J. Immunol. 155:2311.[Abstract]
  28. Akbar, A. N., N. J. Borthwick, R. G. Wickremasinghe, P. Panayotidis, D. Pilling, M. Bofill, S. Krajewski, J. C. Reed, M. Salmon. 1996. Interleukin-2 receptor common {gamma}-chain signaling cytokines regulate activated T cell apoptosis in response to growth factor withdrawal: selective induction of anti-apoptotic (bcl-2, bcl-xL) but not pro-apoptotic (bax, bcl-xS) gene expression. Eur. J. Immunol. 26:294.[Medline]
  29. Armant, M., G. Delespesse, M. Safrati. 1995. IL-2 and IL-7, but not IL-12 protect natural killer cells from death by apoptosis and up-regulate bcl-2 expression. Immunology 85:331.[Medline]
  30. Hsu, J. C., D. E. Cressman, R. Taub. 1993. Promoter-specific trans-activation and inhibition mediated by JunB. Cancer Res. 53:3789.[Abstract/Free Full Text]
  31. Hsu, W., T. K. Kerppola, P. L. Chen, T. Curran, S. Cheng-Kiang. 1994. Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region. Mol. Cell. Biol. 14:268.[Abstract/Free Full Text]
  32. Linette, G. P., Y. Li, K. Roth, S. J. Korsmeyer. 1996. Cross talk between cell death and cell cycle progression: Bcl-2 regulates NFAT-mediated activation. Proc. Natl. Acad. Sci. USA 93:9545.[Abstract/Free Full Text]
  33. Shibasaki, F., E. Kondo, T. Akagi, F. McKeon. 1997. Suppression of signalling through transcription factor NF-AT by interactions between calcineurin and Bcl-2. Nature 386:728.[Medline]
  34. Shibahara, K., M. Asano, Y. Ishida, T. Aoki, T. Koike, T. Honjo. 1995. Isolation of a novel mouse gene MA-3 that is induced upon programmed cell death. Gene 166:297.[Medline]
  35. Matsuhashi, S., H. Yoshinaga, H. Yatsuki, A. Tsugita, K. Hori. 1997. Isolation of a novel gene from a human cell line with Pr-28 mAb which recognizes a nuclear antigen involved in the cel cycle. Res. Commun. Biochem. Cell Mol. Biol. 1:109.
  36. Perussia, B., C. Ramoni, I. Anegon, M. C. Cuturi, J. Faust, G. Trinchieri. 1987. Preferential proliferation of natural killer cells among peripheral blood mononuclear cells co-cultured with B lymphoblastoid cell lines. Nat. Immun. Cell. Growth Regul. 6:171.[Medline]
  37. Azzoni, L., I. Anegon, B. Calabretta, B. Perussia. 1995. Stimulation of IL-2 activated NK cells via Fc{gamma}RIII induces c-myc-dependent apoptosis. J. Immunol. 154:491.[Abstract]
  38. Trotta, R., P. Kanakaraj, B. Perussia. 1996. Fc{gamma}R-dependent MAP kinase activation in leukocytes: a common signal transduction event necessary for expression of TNF-{alpha} and early activation genes. J. Exp. Med. 184:1027.[Abstract/Free Full Text]
  39. Bennett, I. M., O. Zatsepina, L. Zamai, L. Azzoni, T. Mikeeva, B. Perussia. 1996. Definition of an NKR-P1A+/CD56-/CD16- functionally immature human NK cell subset that differentiates in vitro in the presence of IL-12. J. Exp. Med. 184:1845.[Abstract/Free Full Text]
  40. Perussia, B., S. Starr, S. Abraham, V. Fanning, G. Trinchieri. 1983. Human natural killer cells analyzed by B73.1, a monoclonal antibody blocking Fc receptor functions. I. Characterization of the lymphocyte subset reactive with B73.1. J. Immunol. 130:2133.[Abstract]
  41. Anegon, I., M. C. Cuturi, G. Trinchieri, B. Perussia. 1988. Interaction of Fc receptor (CD16) with ligands induces transcription of interleukin 2 receptor (CD25) and lymphokine genes and expression of their products in human natural killer cells. J. Exp. Med. 167:452.[Abstract/Free Full Text]
  42. Liang, P., A. Pardee. 1996. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967.
  43. Chan, S. H., M. Kobayashi, D. Santoli, B. Perussia, G. Trinchieri. 1992. Mechanisms of IFN-{gamma} induction by natural killer cell stimulatory factor (NKSF/IL-12): role of transcription and mRNA stability in the synergistic interaction between NKSF and IL-2. J. Immunol. 148:92.[Abstract]
  44. Onishi, Y., H. Kizaki. 1996. Molecular cloning of the genes suppressed in RVC lymphoma cells by topoisomerase inhibitors. Biochem. Biophys. Res. Commun. 228:7.[Medline]
  45. Matsuhashi, S., T. Watanabe, K. Hori. 1987. An antigen expressed in proliferating cells at late G1-S phase. Exp. Cell Res. 170:351.[Medline]
  46. Miyazaki, T., Z.-J. Liu, A. Kawahara, Y. Minami, K. Yamada, Y. Tsujimoto, E. L. Barsoumian, R. M. Perlmutter, T. Taniguchi. 1995. Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc and lck cooperate in hematopoietic cell proliferation. Cell 81:223.[Medline]
  47. Grimes, H. L., C. B. Gilks, T. O. Chang, S. Porter, P. N. Tsichlis. 1996. The Gfi-1 protooncoprotein represses Bax expression and inhibits T-cell death. Proc. Natl. Acad. Sci. USA 83:14569.
  48. Lorenz, H. M., T. Hieronymus, M. Grunke, B. Manger, J. R. Kalden. 1997. Differential role for IL-2 and IL-15 in the inhibition of apoptosis in short term activated human lymphocytes. Scand. J. Immunol. 45:660.[Medline]
  49. Alderson, M. R., H. M. Sassenfeld, M. B. Widmer. 1990. Interleukin 7 enhances cytolytic T lymphocyte generation and induces lymphokine-activated killer cells from human peripheral blood. J. Exp. Med. 172:577.[Abstract/Free Full Text]
  50. Perussia, B., S. H. Chan, A. D’Andrea, K. Tsuji, D. Santoli, M. Pospisil, D. Young, S. F. Wolf, G. Trinchieri. 1992. Natural killer (NK) cell stimulatory factor or IL-12 has differential effects on the proliferation of TCR-{alpha}ß+, TCR-{gamma}{delta}+ T lymphocytes, and NK cells. J. Immunol. 149:3495.[Abstract]
  51. Ryan, J. C., E. C. Niemi, M. C. Nakamura, W. E. Seaman. 1995. NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J. Exp. Med. 181:1911.[Abstract/Free Full Text]
  52. Lanier, L. L., J. H. Phillips. 1995. NK cell recognition of major histocompatibility complex class I molecules. Semin. Immunol. 7:75.[Medline]
  53. Salcedo, T. W., L. Azzoni, S. F. Wolf, B. Perussia. 1993. Modulation of perforin and granzyme messenger RNA expression in human natural killer cells. J. Immunol. 151:2511.[Abstract]
  54. Ortaldo, J. R., A. T. Mason, J. J. O’Shea. 1995. Receptor-induced death in human natural killer cells: involvement of CD16. J. Exp. Med. 181:339.[Abstract/Free Full Text]
  55. Dumont, F. J., Q. Su. 1996. Mechanism of action of the immunosuppressant rapamycin. Life Sci. 58:373.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
D. B. Rosen, W. Cao, D. T. Avery, S. G. Tangye, Y.-J. Liu, J. P. Houchins, and L. L. Lanier
Functional Consequences of Interactions between Human NKR-P1A and Its Ligand LLT1 Expressed on Activated Dendritic Cells and B Cells
J. Immunol., May 15, 2008; 180(10): 6508 - 6517.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Ravet, D. Scott-Algara, E. Bonnet, H. K. Tran, T. Tran, N. Nguyen, L. X. Truong, I. Theodorou, F. Barre-Sinoussi, G. Pancino, et al.
Distinctive NK-cell receptor repertoires sustain high-level constitutive NK-cell activation in HIV-exposed uninfected individuals
Blood, May 15, 2007; 109(10): 4296 - 4305.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Roth, M. Mittelbronn, W. Wick, R. Meyermann, M. Tatagiba, and M. Weller
Malignant Glioma Cells Counteract Antitumor Immune Responses through Expression of Lectin-Like Transcript-1
Cancer Res., April 15, 2007; 67(8): 3540 - 3544.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Hilliard, B. Hilliard, S.-J. Zheng, H. Sun, T. Miwa, W. Song, R. Goke, and Y. H. Chen
Translational Regulation of Autoimmune Inflammation and Lymphoma Genesis by Programmed Cell Death 4
J. Immunol., December 1, 2006; 177(11): 8095 - 8102.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H.-S. Yang, C. P. Matthews, T. Clair, Q. Wang, A. R. Baker, C.-C. H. Li, T.-H. Tan, and N. H. Colburn
Tumorigenesis Suppressor Pdcd4 Down-Regulates Mitogen-Activated Protein Kinase Kinase Kinase Kinase 1 Expression To Suppress Colon Carcinoma Cell Invasion
Mol. Cell. Biol., February 15, 2006; 26(4): 1297 - 1306.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. B. Rosen, J. Bettadapura, M. Alsharifi, P. A. Mathew, H. S. Warren, and L. L. Lanier
Cutting Edge: Lectin-Like Transcript-1 Is a Ligand for the Inhibitory Human NKR-P1A Receptor
J. Immunol., December 15, 2005; 175(12): 7796 - 7799.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Goke, P. Barth, A. Schmidt, B. Samans, and B. Lankat-Buttgereit
Programmed cell death protein 4 suppresses CDK1/cdc2 via induction of p21Waf1/Cip1
Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1541 - C1546.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H.-S. Yang, M.-H. Cho, H. Zakowicz, G. Hegamyer, N. Sonenberg, and N. H. Colburn
A Novel Function of the MA-3 Domains in Transformation and Translation Suppressor Pdcd4 Is Essential for Its Binding to Eukaryotic Translation Initiation Factor 4A
Mol. Cell. Biol., May 1, 2004; 24(9): 3894 - 3906.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. P. Jansen, C. E. Camalier, C. Stark, and N. H. Colburn
Characterization of programmed cell death 4 in multiple human cancers reveals a novel enhancer of drug sensitivity
Mol. Cancer Ther., February 1, 2004; 3(2): 103 - 110.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. J. Loza and B. Perussia
The IL-12 Signature: NK Cell Terminal CD56+high Stage and Effector Functions
J. Immunol., January 1, 2004; 172(1): 88 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Derre, M. Corvaisier, M.-C. Pandolfino, E. Diez, F. Jotereau, and N. Gervois
Expression of CD94/NKG2-A on Human T Lymphocytes Is Induced by IL-12: Implications for Adoptive Immunotherapy
J. Immunol., May 15, 2002; 168(10): 4864 - 4870.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Assarsson, T. Kambayashi, J. K. Sandberg, S. Hong, M. Taniguchi, L. Van Kaer, H.-G. Ljunggren, and B. J. Chambers
CD8+ T Cells Rapidly Acquire NK1.1 and NK Cell-Associated Molecules Upon Stimulation In Vitro and In Vivo
J. Immunol., October 1, 2000; 165(7): 3673 - 3679.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Cmarik, H. Min, G. Hegamyer, S. Zhan, M. Kulesz-Martin, H. Yoshinaga, S. Matsuhashi, and N. H. Colburn
Differentially expressed protein Pdcd4 inhibits tumor promoter-induced neoplastic transformation
PNAS, November 23, 1999; 96(24): 14037 - 14042.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Azzoni, L.
Right arrow Articles by Perussia, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Azzoni, L.
Right arrow Articles by Perussia, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS