The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, C. C. K.
Right arrow Articles by Wu, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, C. C. K.
Right arrow Articles by Wu, G. E.
The Journal of Immunology, 1998, 161: 3444-3454.
Copyright © 1998 by The American Association of Immunologists

Differential Usage of VH Gene Segments Is Mediated by cis Elements1

Calvin C. K. Yu2,*, Mani Larijani2,{dagger},{ddagger}, Ivana N. Miljanic{dagger} and Gillian E. Wu3,{dagger},{ddagger}

* The Hooper Foundation, San Francisco, CA 94143; and {dagger} Ontario Cancer Institute, and {ddagger} Department of Immunology, University of Toronto, Toronto, Ontario, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ig diversity is generated in large part by the combinatorial joining of the Ig gene segments, VH, D, and JH, that together encode the variable domain of Ig. The final Ig repertoire, however, not only reflects the diversity generated through V(D)J recombinatorial joining, but it is also the product of a number of developmental restraints and selections. To avoid such restrictions and assess the recombination potential of individual Ig gene segments, we constructed Ig heavy (H) chain microlocus plasmids, each of which contain germline coding, recombination signal, and flanking sequences of a VH, D, and JH gene segment. These plasmids allow us to assess the recombination potential of the segments in the context of their natural flanking DNA sequences, but in the absence of any higher order chromatin structure or cellular selection. We found that the frequency and extent of deletions and additions at the recombination breakpoints are similar to those observed at rearranged Ig H chain loci in intact animals. The relative frequencies of the types of rearrangements—VD-J, V-DJ, VinvD-J (invD = inverted D), and VDJ—however, differ strongly. Moreover, V81x, the most used VH gene segment in intact mice, also is overused in this plasmid assay, 15 to 30 times that of another VH segment. This result indicates that the overuse of V81x in the early B cell repertoire can be a consequence of its DNA sequence and not of cellular activities.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunoglobulin gene rearrangement is a critical step in B cell differentiation and the generation of diversity. At present, RAG1, RAG2, TdT, the DNA-PK complex, and XRCC4 are known to play a role in V(D)J recombination (reviewed in 1 ; there are likely to be others. The only required cis-acting elements for recombination are the recombination signal sequences (RSSs)4 (2, 3, 4, 5), but the process is also affected by other sequences flanking the rearranging segments (6, 7, 8) and by local chromatin structure (9).

In vivo, the heavy (H) chain is usually rearranged before any light chain (10). In the normal course of events, a D element is first joined to a JH element, and the resulting DJH segment is then joined to a VH element to form the VHDJH segment, which, if in frame, will encode the variable domain of an H chain (11). The germline gene segments are not used randomly (12, 13, 14, 15). At the mouse H chain locus, the most overused VH segment is V81x, the most D-proximal functional VH (13, 16, 17). We and others have demonstrated the overuse of this segment early in B cell development and the decline in its usage at later stages (15, 16, 18).

The rearrangement order may, in part, be a consequence of the rate at which the various segments rearrange. According to this model, the faster recombining segments would usually rearrange before the slower ones. Several studies in vivo and in vitro have investigated what factors affect this rate. The RSSs constitute one factor; the more closely an RSS sequence resembles the consensus (CACAGTG-spacer-ACAAAAACC), the more often it is recombined in extrachromosomal substrates (3, 19, 20, 21). The coding nucleotides adjacent to the RSSs constitute another factor; flanks of C or G are preferred over A or T (7, 22, 23, 24, 25). In addition to the sequences of the elements to be rearranged, their chromosomal location and accessibility affect the order of rearrangement (9, 26, 27, 28). These same factors will also affect the usage of individual V gene segments. In addition, it has been speculated that the extreme overuse of V81x in the primary repertoire is due its D-proximal location (13).

As soon as the primary repertoire has been generated, it begins to be altered as a result of selection and somatic mutation. The decline in usage of V81x seems to result from cellular selection, possibly mediated by interaction of the heavy chain with {lambda}5 surrogate light chain (29, 53).

To understand the mechanisms for the initial overuse of the V81x gene in the absence of the cellular selection processes described above, we have constructed a series of microlocus plasmids, each of which contain germline coding sequences, RSS, and flanking sequences of a VH, D, and JH gene segment. With this plasmid configuration, we can compare, for example, the rearrangement of two VH gene segments to the same D and the same JH at the same distance away. Moreover, the recombination potential of the segments is assessed in the context of their natural flanking DNA sequences, but in the absence of any higher order chromatin structure, as well as in the absence of cellular selection. These plasmids lack VH promoters and, as no constant domain is included, they cannot produce functional µ polypeptide chains. Our aim is to uncouple the process of recombination from other cellular factors to investigate the extent to which that process itself can generate the repertoire in the absence of other cellular factors and processes that also affect it.

Here, we report the results of experiments with microlocus plasmids in which the VH is either V81x or VA1, with the other two elements always being DFL16.1 and JH1. VA1 is a member of the J558 family of VH gene segments, located at the 5' end of the VH locus. We show that when transfected into A-MuLV-transformed cell lines: 1) they give rise to most of the recombination products observed in intact animals, albeit at different relative frequencies; 2) the junctional sequences of these rearrangements closely resemble those that arise in intact animals, and in particular, the presence of Cys92 and the absence of DH reading frame 3—two characteristics that would be enforced by selection in intact animals—seem to be largely determined during the process of V(D)J recombination; and 3) V81x recombines much more frequently than VA1. This is a direct demonstration that many of the properties of VHD and DJH junctions as well as much of the differential usage of Ig gene segments can be attributed to the sequences of VH, D, and JH gene segments themselves in the context of local flanking sequences.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

A-MuLV-transformed cell lines 204-1-8 and A3A-B6, both derived from adult bone marrow, were the kind gift of Naomi Rosenberg, Tufts University (30). Other A-MuLV lines were generated by us (31). Cell lines were grown in RPMI 1640 medium supplemented with 10% FCS (Life Technologies, Gaithersburg, MD), antibiotics (100 U/ml penicillin and 100/ml streptomycin sulfate), 50 µM ß-mercaptoethanol, 2 mM L-glutamine, and 24 mM NaHCO3 at 37°C and in the presence of 5% CO2. Cells are maintained at a density of 5 x 105 to 2 x 106 per ml.

Plasmid construction

Extrachromosomal recombination plasmids were constructed by assembling germline Ig H chain gene sequences into pJC119{Delta}, a 6.2-kb backbone plasmid containing all the sequences needed to replicate in eukaryotic cells as well as to replicate and be selected (ampicillin) in prokaryotic cells (19, 32). Plasmid pJC119{Delta} was derived from pJC119, which we previously used in extrachromosomal V(D)J recombination assays by removing sequences containing the RSSs (19). The H chain gene sequences were fragments isolated from other plasmids, PCR-generated fragments, or double-stranded oligomers.

pV81x-D-J series. These plasmids contain an ~1.4-kb BamHI fragment with V81x, DFL16.1, and JH1 sequences. A 329-bp PvuII-PstI fragment isolated from pV81x (a kind gift of F. Alt, Harvard University) (13) includes V81x sequences from the fourth codon through the third nucleotide downstream of the RSS. An 860-bp BamHI fragment isolated from pN25 (a kind gift of S. Tonegawa, Massachusetts Institute of Technology) includes DFL16.1 sequences from 355 bp upstream of the 5' RSS through 426 bp downstream of the 3' RSS (the D sequence is reported in 33 . A 120-bp XhoI-SalI PCR product includes JH1 sequences from 20 bp upstream of the RSS through 10 bp downstream of the coding sequence. It was generated from pGW3, which contains all JH segments in an ~3 kb BamHI-EcoRI fragment by PCR methodology using primers 5'J1CY and 3'J1CY. The three segments were assembled in pBluescript (Stratagene, La Jolla, CA), and the 1.4-kb BamHI fragment was then inserted into pJC119{Delta} in both orientations. In all constructs, the 1.4-kb DNA sequence was verified by sequencing at this stage.

We constructed two versions of the V81x-DFL16.1-JH1 microlocus differing only at the junction of V81x and DFL16.1. In one version, the V81x and DFL16.1 fragments were juxtaposed; in the other version, an additional 34 bp, containing PstI, HindIII, ClaI, SalI, and XhoI sites were inserted at the junction (pV81x-D-J Xho). The two versions did not differ in recombination frequency. Each version was cloned into the backbone vector in both orientations to give plasmids pV81x-D-J+ and pV81x-D-J-, with the + and - superscripts referring to the two orientations. The constructs are shown schematically in Figure 1Go.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. Schematic structure of the microloci plasmids. The construction of the plasmids and the sources of the gene segments are described in Materials and Methods. Restriction sites are marked. The XhoI sites shown in parentheses are present only in pV81x-D-J(Xho).

 
pEmBed--D-J series. The Invitrogen (San Diego, CA) site-directed mutagenesis system was used to construct these plasmids. Briefly, two oligomers were annealed to denatured pV81x, a V81x germline gene plasmid; the oligomers straddled the embedded heptamer site (GCCTTGTATTCCCGGGCAAGACACAC) and the XhoI site (CACAAGGATCACGTGGCAGGATATG). Upon DNA replication, some strands incorporate both oligomers so that the resultant plasmid is rendered resistant to XhoI, sensitive to Pml1, and sensitive to SmaI. We screened ~20 XhoI-resistant plasmids and identified 3 that were sensitive to SmaI; this means that the embedded heptamer TACTGTG had been replaced with TCCCGGG. The plasmids were sequenced in the relevant areas, and one was subcloned and used to generate pEmBed--D-J series of plasmids, as described above for the pV81x-D-J series.

pVA1-D-J series. These plasmids differ from the pV81x-D-J series only in the VH sequence. A 373-bp BamHI-SspI fragment from pA1 (a kind gift of F. Alt, Harvard University; and described in 11 includes VA1 sequences from the third nucleotide of the first codon through 42 bp downstream of the RSS. It was cloned into pV81x-D-J, where it replaced the V81x fragment. The resultant plasmid, pVA1-D-J, contains a ~1.5-kb VHA1-DFL16.1-JH1 microlocus. The junction of VA1 and DFL16.1 has 18 bp containing ClaI, SalI, and XhoI sites. DFL16.1 and JH1 fragments are directly juxtaposed to each other, exactly as in the V81x-D-J microlocus. The VHA1-DFL16.1-JH1 microlocus was also cloned in the other orientation with respect to the sequences of the backbone plasmid and designated pVA1-D-J+ and pVA1-D-J-, respectively. The constructs are shown schematically in Figure 1Go.

Recombination assay in vitro

The assay was performed essentially as described (34). Briefly, 1 µg of DNA was transfected into 2 x 107 A-MuLV cells in a DEAE-dextran solution. Transfectants were incubated in the presence of 1 mM caffeine (ICN Pharmaceuticals, Costa Mesa, CA). Cells were harvested after 48 h, and DNA plasmids were recovered by alkaline lysis. The recombinant plasmids were isolated by transformation. Typically, 104 to 105 transformants were recovered.

Analysis of recombination products

Colony blotting analysis of individual DNA clones. After electroporation of the DpnI DNA recovered from the cell lines (described above), bacteria were incubated for 1 h in 1 ml SOC broth (SOB plus 20 mM glucose and 10 mM MgCl2 (35)) at 37°C with shaking (250 rpm) before being plated on LB agar supplemented with 100 µg/ml ampicillin. After an overnight incubation, colonies were picked and streaked onto fresh plates overlaid with gridded nitrocellulose filters (~70 colonies per plate). Colony blotting of the bacteria was performed essentially as described (35). From a random sample of recombinant colonies identified by sequential oligomer hybridization (described below), DNA was isolated and analyzed by restriction mapping and sequencing with a T7 sequencing kit and V1CY or polyoma primers. To enrich for certain products to allow sequencing analysis, a selection step was sometimes added; DNA recovered from transfection was treated with MscI (to select for V-DJ recombinants) or XhoI (or BglII, to select for VD-J recombinants). As plasmids containing VDJ rearrangement products have neither restriction site, they are present in both populations. This step was omitted in all experiments used to determine frequencies of recombinants.

Southern blotting analysis of DNA populations. DNA recovered from transfections was treated with DpnI to digest and thus remove nonreplicated plasmid DNA. DpnI-treated DNA was transformed into ElectroMax DH10B-competent bacteria (Life Technologies) by electroporation with a GenePulser (Bio-Rad, Hercules, CA). In a typical experiment, one-half of the recovered DNA was treated with DpnI, and 1 to 10% of this treated DNA was used to transform 25 µl of competent bacteria. Transformants were amplified for 16 h in an additional 4 ml of LB containing 100 µg/ml ampicillin. Plasmids were recovered by alkaline lysis and digested with BamHI to release the insert from the vector. The resultant DNA fragments were fractionated by gel electrophoresis and analyzed on Southern blots with the oligomer probes described below. The microlocus and its various rearrangement products differed sufficiently in size for us to identify all recombinants generated by deletion with a single probe (usually 3'J1CY). Some products generated by inversion are the same size as the unrecombined plasmid, and these were identified with the VinvD and invDJ oligomers. The hybridization and washing conditions were according to the manufacturer’s suggestions (Hybond N; Amersham, Oakville, Ontario, Canada) and are described below. The bands were quantified on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) with ImageQuant 3.3 software.

Standardization of the assay conditions

We used two types of control experiments to ensure the quantitative accuracy of this assay:

1) Bacteria were transformed with 10 ng each of unrearranged pV81x-D-J+ as well as rearranged pV81xD-J+ and pV81x-DJ+ plasmids. Transformants were amplified as described above, and plasmids were recovered, digested with BamHI, electrophoresed, blotted on Hybond-N (Amersham) membrane, and probed with 3'J1CY. As no further rearrangements were detected from any of the three substrates (see Fig. 5GoA), we conclude that these plasmids do not undergo detectable V(D)J recombination-like changes in bacteria.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 5. A, The microlocus substrates do not undergo rearrangement in Escherichia coli. Lanes 1, 2, and 3 contain plasmid DNA harvested from E. coli transformed with pV81x-D-J, pV81xD-J, and pV81x-DJ, respectively. Harvested DNA was BamHI digested, electrophoresed, blotted, and probed with 3'J1CY. B, The ratio of VD to DJ rearrangement products is not changed by amplification in E. coli. Unrearranged substrate pV81x-D-J and the rearrangement products pV81xD-J, pV81x-DJ, and pV81xDJ were mixed at a known ratio (unrearranged: VD:DJ:VDJ = 95:3:1:1). Lane 1 contains 860 ng of the mixture and lanes 2 to 5 contain 5-fold serial dilutions of the mixture. These we refer to as loading and transfer controls. Dilutions of the same mixture ranging from 10 ng to 0.1 pg were transformed into E. coli and harvested after an overnight culture. Lane 6 is blank. Lanes 7 to 12 contain BamHI-digested DNA recovered from these transformations. Lane 7 contains DNA recovered from the 10 ng-transformation, and lanes 8 to 12 contain the DNA recovered from transformations with 10-fold serial dilutions. Band intensities are quantitated using a PhosphorImager. The far right column shows that the 3:1 ratio of the VD to DJ products was preserved after transformation.

 
2) The unrearranged plasmid, pV81x-D-J+, and the rearranged plasmids, pV81xD-J+, pV81x-DJ+, and pVDJ+, were mixed in the ratio of 95:3:1:1 and introduced into bacteria by electroporation. Total amounts of DNA varied from 0.1 pg to 10 ng, a range covering experimentally recovered plasmid amounts. Following transformation, the ratio of V-D-J:VD-J:V-DJ:VDJ was 78:9.4:2.9:9.7 (see Fig. 5GoB). The 1.4-kb unrearranged pV-D-J substrate was underamplified and the small pVDJ product was overamplified, perhaps because of their different sizes. Nevertheless, the ratio of VD-J to V-DJ in the output was very close to the 3:1 ratio in the input. We conclude that our assay is valid for determining the relative frequencies of VD-J and V-DJ recombinants.

Oligodeoxynucleotide probes and PCR primers

Oligomers were purchased from Life Technologies and used as described in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Oligodeoxynucleotide probes and PCR primers

 
Assays for VD and VinvD rearrangements in genomic DNA

Genomic DNA was prepared from 20 A-MuLV day 17 fetal liver lines (31). All lines were RAG-positive with H chain loci in the DJ or VDJ configuration (36). Bone marrow and fetal liver DNA was prepared from C57BL/6 mice using standard methods. To detect VD and VinvD structures, the forward VHall primer or V81x primers were used with the Dgen or the invDgen primer. These primers and their characteristics have been described previously (15, 37, 38).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The construction and relevant characteristics of the extrachromosomal microlocus substrates are described in Materials and Methods and FigureGo 1. The microlocus substrate can undergo V(D)J-mediated recombination by deletion or inversion to give rise to at least seven products. These products are expected to arise, if at all, at very different frequencies. Figure 2Go shows the possible rearrangement products containing coding joints, as well as the sizes of these products after BamHI digestion of the plasmids, which releases the microlocus. Other events giving rise to hybrid junctions and open and shut coding/RSS junctions are also possible. The microloci used in our study differed from those described previously by other laboratories in that they lacked prokaryotic transcription stop sequences and the chloramphenicol resistance gene in the sequences flanking the gene segments. Thus, as there was no way to select recombinants directly by antibiotic resistance, the frequency of recombinants was determined by 1) colony blotting and manual quantification of bacteria harboring plasmids containing the various products classes and 2) PhosphorImager quantification of the relevant bands identified by Southern blot analysis.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Schematic representation of the possible standard rearrangement products generated from the microlocus plasmids.

 
Recombinants generated from pV81x-D-J microlocus plasmids

Figure 3Go shows an example of the colony blot analysis used to calculate the frequencies of the several classes of recombinants. The colonies shown here were probed sequentially with 5'DFL16.1 (Fig. 3GoA), 5'J1CY (Fig. 3GoB), and VinvD-J (Fig. 3GoC). As illustrated, the first of these three oligomers is complementary to a region between V and D, the second to a region between D and J, and the third to a signal joint present only in the VinvD-J product. Thus, the colonies negative for 5'DFL16.1 only or 5'J1CY only represent VD-J and V-DJ recombinants, respectively, while those negative for both are VDJ recombinants. The colony blot method is particularly useful for giving the frequency of recombinants that arise by inversion. As no DNA is lost during inversion, such recombinants can have the same size as unrearranged plasmids and thus be indistinguishable by the Southern blot detection method. In Table IIGo, the data generated in this experiment are tabulated. In the 264 plasmids analyzed from transfections with pV81x-D-J+ plasmids (in the positive orientation), there were 23 (8.7%) pVD-J+, 3 (1.1%) pV-DJ+, and 6 (2.2%) pVinvD-J+ plasmids. In the 312 plasmids analyzed from transfections with pV81x-D-J- plasmids (in the negative orientation), we found 23 (7.4%) pVD-J, 2 (0.64%) pV-DJ, and 21 (6.7%) pVinvD-J plasmids. Pooling the data from both orientations, we found 13% V to D joins, and 0.87% D to J joins. Although in other experiments we have found 0.5 to 1% pVDJ plasmids with two joins, there were none in the experiment shown in Table IIGo. pV-invDJ plasmids were not found in any experiment.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. Representative colony blot of pV81x-D-J recombination products. Shown is a filter hybridized sequentially with three probes. A, Probe is 5'DFL16.1, which hybridizes to all products except pVD-J (indicated by X). B, Probe is 5'J1CY, which hybridizes to all products except pV-DJ (none of which were found on this blot). C, Probe is VinvD-J, which hybridizes to pVinvD-J. Two colonies were found. Four probing controls are present on each to control for specificity of hybridization.

 

View this table:
[in this window]
[in a new window]
 
Table II. Analysis of pV81x-D-J recombinants by colony lifts1

 
These results and those of four other independent experiments have the following notable features. 1) The overall frequency of recombinants is 12 and 15% in the positive (+) and negative (-) orientations, respectively. These percentages are considerably higher than the 5% recombinants that we generally find with our RSS coding substrates under the same conditions (3, 19, 39). 2) Although rarely (24), if ever, found in endogenously generated rearrangements, VD structures are frequent. 3) VinvD structures, which we have never found in vivo, are similarly frequent. 4) The frequency of plasmids with two events (pVDJ) is 0.5 to 1%, which is greater than ~0.1%, the product of the frequencies of plasmids with each single event.

Sequences of the recombinants

The recombinants that arise by inversion and then deletion would not be distinguishable from the single deletional VD-J and V-DJ products by our methods. Thus, to verify and analyze recombinants, DNA from plasmids identified by various methods were prepared and sequenced. Figure 4Go, A–H, shows sequences generated from several experiments. Of 198 sequences, 197 were the type designated by the colony blotting analysis, a result that validates the methodology. Overall, the recombinants do not differ qualitatively from endogenously generated Ig gene structures. Nine had longer deletions at the joints than are generally observed in vivo (<5%); there was one hybrid joint.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 4. A–H, Sequences of the VD, DJ, and VDJ junctions. Number in parentheses is the number of plasmids isolated with this sequence. UP: unprocessed, the plasmids had no processing at the junction Pr.: + means that the sequence would be productive if found in an Ig gene context; - means it would not be. Bold type indicates P nucleotides, plain type, N; underlined nucleotides can be assigned to either gene segment.

 
VinvDJ frequency. Because VDJ containing plasmids are identified by the absence of noncoding, flanking sequences, the VDJ population contains plasmids with both direct D and inverted D configurations. Of the 18 such structures identified and sequenced, two had inverted D configurations (11%). This frequency of VinvDJ is at least an order of magnitude higher than found in VDJ structures in intact animals (29).

Homology joining. The 3' sequence of DFL16.1 (CTAC) is the same as the 5' sequence of JH1, a circumstance that permits joining by homology (8). In 21 of 67 pV-DJ sequences (31%), nucleotides at the joint could be assigned to either D or J, the usual criterion for joining by homology. This is similar to the frequency of DFL16.1 and JH1 joining by homology in intact animals (40, 41), further confirming the parallel between end processing in our system and intact mice.

Deletions at the VH border. Generally, the processing at the VD and DJ borders was similar to that found in vivo, including the almost complete absence of deletions into the embedded heptamer of the VH. The last fact has been taken as evidence of selection in vivo for the protein sequence encoded by the embedded heptamer, which is the site of an invariant Cys (42). Alternatively, we hypothesized that protein binding to, or structural features of, the embedded heptamer may prevent processing through it. We constructed vectors lacking the embedded heptamer to test the viability of this notion; experiments with the modified vector (pEmBed--D-J) are described below.

No reading frame 2 (RF2) in VDJ structures. In the VDJ and DJ structures, it can be calculated what the reading frame of DJ would have been if it were an endogenous gene segment. Although about equal reading frame usage is found in the DJH structures, there is no RF2 in the VDJ structures (Table IIIGo). In one model to account for this omission, DJ structures using RF2 would be inhibited from secondarily rearranging to yield VDJ products. In an alternate model, the VDJ recombinants would be derived mostly from the VD-J intermediate. The latter model is tested below.


View this table:
[in this window]
[in a new window]
 
Table III. Summary of potential DH reading frames

 
Both pVD-J and pV-DJ can undergo second rounds of recombination

Is it possible that VD recombinants are more frequent in the microlocus system because the secondary recombination of VD-J to VDJ joining is disfavored? To investigate this possibility, we transfected a pV81xD-J and pV81x-DJ clone (Figs. 4GoA, UP, and 5D, BX-16, respectively) separately into A-MuLV line 1–8 and assayed the recombinants. As shown in FigureGo 6, both recombinants underwent second rounds of recombination. Thus, there is no sequence on pVD-J plasmids preventing another recombination event, and therefore this cannot be the reason for the accumulation of VD-J structures. Moreover, the finding that pVD-J generates fewer pVDJ than does pV-DJ demonstrates that in the absence of competition from each other for D joining, there remains a preference for V81x over JH in the recombination reaction.

The embedded heptamer does not augment V to D rearrangements

The predominance of VD recombinants and the absence of deletions into the embedded heptamer contained in the V gene segment led us to consider whether the embedded heptamer sequence itself might influence the outcome of recombination. The embedded heptamer resembles an RSS heptamer and is found about seven nucleotides 5' of the VH RSS in the opposite orientation (12, 43, 44). We reasoned that the embedded heptamer on the microlocus substrate might recruit recombinase components to the VH segment causing D to join to the VH RSS more frequently than to J, which lacks an embedded heptamer. Using site-directed mutagenesis, we altered TACTGTG (the embedded heptamer) of the V81x-D-J plasmid to TCCCGGG, transfected it (pEmBed--D-J) into an A-MuLV cell line, and assayed the recombinants by Southern analysis. The construct lacking an embedded heptamer also yielded more VD than DJ structures (3.4 and 0.63%, respectively, in one representative experiment) with VD-J:V-DJ ratios comparable to those generated from the microlocus with an intact embedded heptamer sequence (data not shown). Moreover, the pattern of deletions into V81x is similar to that found in the unmutated V gene segment (Fig. 4GoH). Thus, the embedded heptamer sequence is not a factor in the V81x microlocus constructs yielding more VD than DJ recombinants, nor is it directly responsible for deletions stopping at the location of the embedded heptamer.

Analysis of recombinants from pVA1-D-J

To examine the possibility that V81x is overused because of factors intrinsic to the gene segment itself, we constructed another set of microlocus vectors identical to the first series except that V81x was replaced by VA1, including its RSSs and flanking sequences. To control for the recombinatorial status of the A-MuLV lines, transfections were done in parallel with all test plasmids. As before, we used the colony blot method with probes to look for VD, DJ, or VinvD-J recombinants. Only one VinvD clone was found in 187 colonies recovered after transfection with pVA1-D-JH- plasmids. No recombinants were found in 226 pVA1-D-JH+ colonies screened. These levels of recombination were at least 10-fold below the levels of pV81x-D-J plasmids in parallel transfections.

To better analyze the recombinants for both pV81x-D-JH and pVA1-D-JH, a quantitative Southern blot method was also used. Control quantifications validating this method are shown in Figure 5GoB and Materials and Methods. FigureGo 7 shows a result from an analysis of the recombination products of substrates pV81x-D-J+, pV81x-D-J-, pVA1-D-J+, and pVA1-D-J-. Substrates with V81x yield more recombinants than VA1 plasmids. pV81x-D-J+, and pV81x-D-J- yielded recombinants in which V to D rearrangements were 14- to 17-fold more frequent than D to J rearrangements. pVA1-D-J+ and pVA1-D-J- yielded recombinants in which V to D rearrangements were 2- to 5-fold less frequent than D to J. As the orientation of the microlocus in the plasmids did not change the qualitative differences, there seem to be no contextual effect of the backbone vector on rearrangement of the gene segments (Fig. 7Go). Table IVGo summarizes the data from this experiment. In all experiments, there are less VD than DJ rearrangements on VA1-D-J plasmids and more VD than DJ rearrangements on V81x-D-J plasmids. In four independent transfections, VD:DJ ratios range from 5.8 to 17 for V81x-D-J and from 0.19 to 0.51 for VA1-D-J. Given that the frequency of DFL16.1 to JH1 recombination is the same in both plasmids, we calculate that the rate of V to D recombination is about 30 times higher for V81x than for VA1.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. Variable gene segments, V81x and VA1, are used at different frequencies in the microlocus recombination assay. Loading and transfer controls (lanes 15) are as described in the legend of Figure 5GoB. Lanes 6 through 8 contain DNA recovered from the amplified transformants and digested with BamHI showing pVD-J, pV-DJ, or pVDJ products. The probe is 3'J1CY.

 

View this table:
[in this window]
[in a new window]
 
Table IV. Analysis of recombinants by Southern blot quantitation1

 
To confirm the above VD and DJ frequencies, other probes were also used (Fig. 8). This Southern blot method utilizes the two flanking oligonucleotide probes 5'DFL16.1 and 5'J1CY that were used in the colony blotting method described above. These probes detect VD and DJ products exclusive of each other, and both detect microloci in the germline configuration. By analyzing the intensities of each recombinant band and using the germline band as standard and the DJ band to normalize, we calculated that pV81x-D-J produces 15-fold more VD joints than pVA1-D-J. Thus, all other DNA sequences being the same, the differences in recombinant frequencies in the pV81x-DFL16.1-JH1 and the pVA1-DFL16.1-JH1 microloci are attributable to differences in or near the V gene segments.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
V81x is overused in the microlocus plasmid pV81x-D-J

VH segments are not used randomly in B cell development, and V81x is a particularly crass example of that fact (12, 13, 15, 45, 46, 47, 48, 49, 50). V81x is overutilized in the earliest detectable rearrangements in fetal liver, where >25% of all VDJ rearrangements use V81x; its usage declines during the course of development, being <5% in adult spleen. Several hypotheses have been put forward to explain the decline: 1) other VH regions might become open during development and thereby become favored for rearrangement; 2) cells utilizing V81x might fail to progress past the pre-B stage because they usually fail to associate with {lambda}5 and thereby fail to receive a signal required for differentiation (51, 52, 53); or 3) cells utilizing other VH elements might be selected (15).

Although the rise and decline of V81x containing variable domain genes in fetal and adult mouse B cell development has been studied in great detail and has led to valuable insights into B cell selection, the reasons for its initial overuse and subsequent decline remain elusive. At least two hypotheses have been put forward to explain the initial overutilization. 1) V81x is the most 3' VH functional gene segment so far identified; i.e., the one closest to the stretch of D gene segments (13). The "DNA-tracking" hypothesis postulates that the V(D)J recombinase travels along the double helix from D to V, and so the first V encountered would have the best chance of being used (models discussed in 1 . However, even without tracking, which is diffusion in one dimension, it is not unreasonable that formation of the entire recombinase-RSS complex involves a reaction rate limited by diffusion in three dimensions and thereby dependent on the distance between the gene segments to be recombined. 2) Using simple extrachromosomal recombination substrates, we and others have previously demonstrated the existence of cis-acting elements within or flanking V, D, and J gene segments that might determine their utilization in the primary repertoire (3, 7, 19, 23, 24, 54, 55). Additionally, the finding that the V81x coding and RSS sequence is the same in five strains of mice adds evidence to the importance of the sequences themselves (our unpublished data). The present study is an attempt to critically test whether such cis-acting elements can quantitatively explain the overutilization of V81x.

We have examined VH usage in a unique way, in a microlocus containing entire V, D, and J coding sequences and RSSs embedded in their natural flanking sequences. The latter fact is of particular significance since the same sequences naturally flanking DFL16.1 used in our microloci have been shown previously to influence the choice of VH or JH RSS for recombination to this D segment (24). Thus, our system combines most of the known cis elements recognized to be important in recombination between VH, DH, and JH segments, while still isolating the process of V(D)J recombination to exclude cellular selection at the level of encoded protein and complex chromatin structure. VA1 was chosen as a control VH gene segment because its usage is not out of the ordinary in either fetal or adult tissue, yet it is highly transcribed in the germline configuration, a trait that most likely indicates that it is a target for V(D)J recombination (56, 57, 58, 59, 60). On the other hand, V81x does not have detectable transcription in the germline state.

In the experiments reported here, pV81x-D-J generates up to 15% recombinants in a pre-B cell line, while pVA1-D-J yields <1%. We estimated the relative recombination potential of V81x and VA1 in several ways, which yielded ratios of 15- to 30-fold in favor of V81x. Since the only difference between these plasmids is the V gene segment, we conclude that in the absence of chromosomal context and in the absence of cellular selection, sequences in or around these V elements themselves are sufficient for marked differential usage. If there are 200 VH elements and if V81x is used in 25% of the rearrangements in mouse fetal liver, then V81x would be utilized 67 times as frequently as a "typical" VH segment. Thus, even if VA1 recombines two to four times as frequently as a "typical" VH, we have quantitatively explained the overuse of V81x.

It is implied that the differential usage of V81x and VA1 segments could be due to their RSS sequences or coding flank sequences. The V81x and VA1 coding flanks are CA and GA, respectively. However, it is the latter, the CA of the V81x coding flank, that is more competent in V(D)J recombination (roughly twice as competent) (25). Moreover, the consensus VH7183 family RSS, of which V81x is a member, is severalfold more recombinogenic than the consensus VHJ558 family RSS, of which VA1 is a member (19). Thus, we believe a fruitful focus will be the RSS and such studies are underway in our laboratory.

Other transacting factors not tested with our microlocus system, including those inducing accessibility, doubtlessly play a role in the overuse of V81x in vivo. In the section below on VD joints and ordered rearrangement, we discuss a simple model in which the rate of recombination is determined by the distance between the segments to be rearranged as well as by the local sequences.

Sequences of joints in pV81x-D-J are normal

Sequences of both VD and DJ junctions in the microlocus plasmids seem to be similar to those found in vivo (15, 49, 61). This finding confirms that junctional diversity is established during the actual V(D)J recombination process. Remarkably, deletions into the V gene segment stopped in the same region as found in expressed Ig genes; i.e., deletions rarely extended past Cys92, the amino acid residue required for intrachain disulfide bonding. This result indicates that somatic selection against cells with "bad" H chain proteins is not primarily responsible for enforcing the presence of Cys92. Instead, selection in an evolutionary time frame has resulted in a gene rearrangement process that restricts the length of deletions. Moreover, the presence or absence of the embedded heptamer sequence itself does not affect the length of deletions into V.

In mice, VDJH structures rarely express DH in RF2 (41, 62). There is good evidence that this is because cells with DJH structures in RF2 are selectively deleted. Be that as it may, RF2 was not utilized in VDJH recombinants generated by our microlocus plasmids (Table IIIGo). Many studies have determined that DJH reading frame usage in V81xDJH joints and the productivity of the sequences vary between fetal and adult B cell development, presumably due to the absence and presence, respectively, of an N addition (29, 53, 63, 64). Our system, however, confers N/P addition to the same approximate degree in all classes of recombinants and shows that at least part of the apparent selection against RF2 seems to be built into the recombination process itself. Interestingly, the bias against RF2 was not evident in VDH or DJ H structures in the microlocus plasmids, only in the double recombinant, and may occur in part because of preferred joining by homology. As there are many fewer VDJH than VDH or DJH structures, more work is clearly needed to clarify this issue.

Recently, it has been proposed that V81x encoded H chains with N addition do not pair with surrogate light chain {lambda}5, whereas those without N addition are able to do so (51, 53). Furthermore, it has been proposed that V81x sequences without N addition (such as those arising during fetal B cell development in which TdT is absent) are inherently more productive than other VH regions (64). We did not observe any pattern of joint sequences (deletion/addition) that would indicate an inherent propensity of the V81x segment for a unique pattern of N addition. As, indeed, coding end sequences have been found to affect such joint processing (65), it would be interesting to build a series of other VH microloci plasmids to pursue this puzzle.

VinvD joints are common in microlocus rearrangements

Not only did pV81x-D-J generate more deletional VD joints than DJ, V81x surprisingly joined to DFL16.1 almost as frequently by inversion as by deletion. The 3' RSSs of D segments are considered stronger than the 5' RSSs (4, 38, 54). Indeed, the majority of murine D segments have close to consensus 3' RSS heptamers and nonamers, but nonconsensus 5' RSSs. Using RSS extrachromosomal plasmids, Teale and coworkers found that the 3' was better than the 5' RSS of a D segment RSS for joining to JH as well as to VH (54). This effect would not be seen in intact animals, because D to J joining generally occurs first, and the 3' RSS of the D segment would be deleted in the process. Thus, we effectively demonstrate that there is no inherent bias in the V(D)J recombination process against the generation of VinvD-J structures. One reason that such structures are not found in vivo might be the deletion of the 3' D RSS during the initial DJ H rearrangement. VanDyk et al. have previously shown that in the presence of the natural DH flanking sequences, the 5' RSS of DH is preferred over the 3' RSS for joining to VH (24). One possible explanation for the high frequency of VinvD-J as compared with direct VD-J products in our microlocus system would be the presence of authentic VH sequences and the strength of the VH RSS.

VD joints and ordered rearrangement

Given the well-established order of H chain rearrangements, VD joints have rarely been found in intact animals (66, 67). Although we were unable to find such joints by PCR, others have recently described direct, inversional, and hybrid VD joints in vivo (24). With the commonly accepted notion that locus accessibility is the cause of ordered rearrangement, it was not clear whether VD joints could serve as intermediates in the production of successful coding VDJ joints. In addition, with the whole bone marrow PCR approach to isolating such rare joints, it is possible that these joints are rare mistakes in the recombination process; it is not even clear what cells the VD joints are found in. It was plausible that the sequences that flank D regions on the 5' and 3' sides play a role in inhibiting V to D or VD to VDJ joints. In such a model, a VD joint represents an aberrant event, possibly due to a failure in controlling locus accessibility and the fact that cells harboring such rearrangements are prevented from differentiating further. Our present results demonstrate that both VD-J and V-DJ plasmids are able to recombine again to form full rearranged VDJ segments. In particular, the ~400 bp downstream of DFL16.1, a sequence stretch thought to be important in ordered H chain rearrangement (24), cannot prevent a secondary rearrangement of a VD-J structure.

It was also considered possible that VD joints are not easily detectable in intact animals because they rapidly recombine again. In our plasmids, however, VD-J structures generated fewer VDJs than did V-DJ structures.

Why are VD joints so common in microlocus plasmids and so rare in intact animals?

The present experiments were not designed to address this issue. Indeed, they could not have been, for we were quite surprised to find so many VDH joints. We think, however, that the most likely explanation lies in the closeness of VH to D in the microlocus plasmids as compared with the normal locus in intact animals.

Thus, as often happens in immunology, an argument about the validity of two proposed mechanism to explain the same facts ends up stimulating work suggesting that both mechanisms are at work. Higher order chromatin structure resulting from proximity to recombination enhancers as well as sequence are both likely to contribute to the overuse of V81x. One model is that the ordering of rearrangement at the H chain locus is predominantly due to the relative proximity of the D stretch to the JH stretch and the relative remoteness of the D stretch from the VH stretch. Interestingly, DFL16.1, which is an overutilized DH segment, is located at the 5' end of the DH locus. This usage pattern, in concert with our findings, indicates that although proximity is important in determining gene usage, there are clearly other factors including, as shown here, the intrinsic gene segment sequences. Looking toward clarifying the relative importance of these factors, it would be interesting to knock out a large part of the "inert" DNA between the D stretch and the V stretch. We predict that ordered rearrangement would be disturbed. Furthermore, although our studies did not include T cells, there is no reason to expect that TCR repertoire formation would not be similarly affected by such cis elements, as described in this report.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 6. Both pV81xD-J and pV81x-DJ can yield pVDJ. BamHI-digested plasmid DNA recovered from transfection of either pV81xD-J or pV81x-DJ and subsequent transformation and harvesting are shown. The Southern blots were probed with 3'J1CY. Lane 1 shows pV81xD-J and pV81xDJ recombinants. Lane 2 shows pV81x-DJ and pVDJ recombinants.

 


View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 8. Differential Southern analysis of blots showing recombinants of pV81x-D-J and pVA1-D-J. Duplicate blots of BamHI digested pV81x-D-J and pVA1-D-J transfection-transformation products were probed with 3'J1CY. Lanes 1 and 2 contains pV81xD-J and pV81x-DJ, respectively, to serve as probing controls. Lanes 3 to 6 contain products of transfections done with pV81x-D-J+, pV81x-D-J-, pVA1-D-J+, and pVA1-D-J-, respectively.

 

    Acknowledgments
 
We thank S. Olson, Q. Lam, S. Rawkins, and P. A. Binnie for expert experimental assistance. We thank C. Steinberg for his comments and editorial assistance. We are grateful to Drs. C. Paige, S. Lewis, F. Bertrand, and A. Marshall for discussions.


    Footnotes
 
1 This work was supported by grants from the National Cancer Institute of Canada Terry Fox Marathon of Hope and the Medical Research Council (MRC) of Canada. G.E.W. is an MRC Scientist and M.L. is an MRC Studentship awardee. Back

2 C.C.K.Y. and M.L. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Gillian E. Wu, Ontario Cancer Institute, Room 8-113, 610 University Avenue, Toronto, Ontario, Canada M5G 2M9. Back

4 Abbreviations used in this paper: RSS, recombination signal sequence; H chain, heavy chain; RF2, reading frame 2. Back

Received for publication February 27, 1998. Accepted for publication May 27, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lewis, S.. 1994. The mechanisms of V(D)J joining: lessons from molecular, immunological and comparative analyses. Adv. Immunol. 56:27.[Medline]
  2. Akira, S., K. Okazaki, H. Sakano. 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V-(D)-J joining. Science 238:1134.[Abstract/Free Full Text]
  3. Ramsden, D. A., G. E. Wu. 1991. Mouse {kappa} light-chain recombination signal seguences mediate recombination more frequently than those of {lambda} light chain. Proc. Natl. Acad. Sci. USA 88:10721.[Abstract/Free Full Text]
  4. Lieber, M. R.. 1992. The mechanism of V(D)J recombination: a balance of diversity, specificity, and stability. Cell 70:873.[Medline]
  5. van Gent, D., D. Ramsden, M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85:107.[Medline]
  6. Chukwuocha, R. U., B. Nadel, A. J. Feeney. 1995. Analysis of homology-directed recombination in VDJ junctions from cytoplasmic Ig-pre-B cells of newborn mice. J. Immunol. 154:1246.[Abstract]
  7. Sadofsky, M., J. Hesse, D. van Gent, M. Gellert. 1995. RAG1 mutations that affect the target specificity of V(D)J recombination: a possible direct role of RAG1 in site recognition. Genes Dev. 9:2193.[Abstract/Free Full Text]
  8. Feeney, A. J.. 1992. Predominance of VH-D-JH junctions occurring at sites of short sequence homology results in limited junctional diversity in neonatal antibodies. J. Immunol. 149:222.[Abstract]
  9. Stanhope-Baker, P., K. Hudson, A. Shaffer, A. Constantinescu, M. Schlissel. 1996. Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro. Cell 85:887.[Medline]
  10. Alt, F., G. Yancopoulos, T. K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, D. Baltimore. 1984. Ordered rearrangement of immunoglobulin heavy chain variable region segments. EMBO J. 3:1209.[Medline]
  11. Yancopolous, G., F. Alt. 1985. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40:271.[Medline]
  12. Reth, M., S. Jackson, F. Alt. 1986. VHDJH formation and DJH replacement during pre-B differentiation: nonrandom usage of gene segments. EMBO J. 5:2131.[Medline]
  13. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore, F. W. Alt. 1984. Preferential utilization of the most JH-proximal VH gene segments in pre-B-cell lines. Nature 311:727.[Medline]
  14. Wu, G. E., C. J. Paige. 1986. VH gene family utilzation in colonies from B and pre-B cells detected by the RNA colony blot assay. EMBO J. 5:3475.[Medline]
  15. Marshall, A. J., G. E. Wu, C. J. Paige. 1996. Frequency of VH81x usage during B cell development: initial decline in usage is independent of Ig heavy chain cell surface expression. J. Immunol. 156:2077.[Abstract]
  16. Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, F. W. Alt. 1990. Biased expression of JH-proximal VH genes occurs in the newly generated repertoires of neonatal and adult mice. J. Exp. Med. 171:843.[Abstract/Free Full Text]
  17. Jeong, H., J. Teale. 1989. VH gene family repertoire of resting B cells: Preferential use of D-proximal families early in development may be due to distinct B cell subsets. J. Immunol. 143:2752.[Abstract]
  18. Alt, F. W., T. K. Blackwell, G. D. Yancopoulos. 1987. Development of the primary antibody repertoire. Science 238:1079.[Abstract/Free Full Text]
  19. Connor, A., L. Fanning, J. Celler, L. Hicks, D. Ramsden, G. Wu. 1995. Mouse VH7183 recombination signal sequences mediate recombination more frequently than those of VHJ558. J. Immunol. 155:5268.[Abstract]
  20. Hesse, J., M. Lieber, K. Mizuuchi, M. Gellert. 1989. V(D)J recombination: a functional definition of the joining signals. Genes Dev. 3:1953.
  21. Akamatsu, Y., N. Tsurushita, F. Nagawa, M. Matsuoka, K. Okazaki, M. Imai, H. Sakano. 1994. Essential residues in V(D)J recombination signals. J. Immunol. 153:4520.[Abstract]
  22. Gerstein, R., M. Lieber. 1993. Coding end sequences can markedly affect the initiation of V(D)J recombination. Genes Dev. 7:1459.[Abstract/Free Full Text]
  23. Gerstein, R., M. Lieber. 1993. Extent to which homology can constrain coding exon junctional diversity in V(D)J recombination. Nature 363:625.[Medline]
  24. VanDyk, L. F., T. W. Wise, B. B. Moore, K. Meek. 1996. Immunoglobulin D(H) recombiniation signal sequence targeting: effect of D(H) coding and flanking regions and recombination partner. J. Immunol. 157:4005.[Abstract]
  25. Ezekiel, U., P. Engler, D. Stern, U. Storb. 1995. Asymmetric Processing of coding ends and the effect of coding end nucleotide composition on V(D)J recombination. Immunity 2:381.[Medline]
  26. Yancopoulos, G. D., B. A. Malynn, F. W. Alt. 1988. Developmentally regulated and strain specific expression of VH gene families. J. Exp. Med. 168:417.[Abstract/Free Full Text]
  27. Schlissel, M., D. Baltimore. 1989. Activation of immunoglobulin kappa gene rearrangement correlates with induction of germline kappa gene transcription. Cell 58:1001.[Medline]
  28. Engler, P., P. Roth, J. Y. Kim, U. Storb. 1991. Factors affecting the rearrangement efficiency of an Ig test gene. J. Immunol. 146:2826.[Abstract]
  29. Marshall, A., C. Paige, G. E. Wu. 1997. VH Repertoire maturation during B cell development. J. Immunol. 158:4282.[Abstract]
  30. Alt, F. W., N. Rosenberg, S. Lewis, E. Thomas, D. Baltimore. 1981. Organization and reorganization of immunoglobulin genes in A-MuLV-transformed cells: rearrangement of heavy but not light chain genes. Cell 27:381.[Medline]
  31. Atkinson, M. J., Y. H. Chang, J. Celler, C. Huang, C. J. Paige, G. E. Wu. 1994. Overusage of DFL16.1 is strain dependent and determined by cis-acting elements. Dev. Immunol. 3:283.[Medline]
  32. Hesse, J. E., M. R. Lieber, M. Gellert, K. Mizuuchi. 1987. Extrachromosomal DNA substrates in pre-B cells undergo inversion or deletion at immunoglobulin V-(D)-J joining signals. Cell 49:775.[Medline]
  33. N. F., Landolfi, J. D. Capra, P. W. Tucker.. 1986. Germ-line sequence of the DH segment employed in Ars-A antibodies: implications for the generation of junctional diversity. J. Immunol. 137:362.[Abstract]
  34. Connor, A., L. J. Fanning, L. A. Bentolila, G. E. Wu. 1997. RSS plasmid substrate assays for V(D)J rearrangement. I. Lefkovits, ed. Immunology Methods Manual 259. Harcourt Brace & Company, London.
  35. J. Sambrook, and E. F. Fritsch, and T. Maniatis, eds. Molecular Cloning: A Laboratory Manual 1989 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
  36. Eisen, A., M. Atkinson, J. Celler, G. E. Wu. 1991. Measurement of recombinase activity in a set of related A-MuLV pre-B cell lines. Int. Immunol. 3:477.[Abstract/Free Full Text]
  37. Pennycook, J., A. Marshall, G. Wu. 1997. PCR assays for endogenous Ig gene rearrangement. I. Lefkovits, ed. Immunology Methods Manual 237. Harcourt Brace & Company, London.
  38. Sollbach, A., G. Wu. 1995. Inversions produced during V(D)J rearrangement at IgH, the immunoglobulin heavy chain locus. Mol. Cell. Biol. 15:671.[Abstract]
  39. Fanning, L., A. Connor, K. Baetz, D. Ramsden, G. Wu. 1996. Mouse RSS spacer sequences affect the rate of V(D)J recombination. Immunogenetics 44:146.[Medline]
  40. Chang, Y. H., C. J. Paige, G. E. Wu. 1992. Enumeration and characterization of DJH rearrangements in fetal liver. EMBO J. 11:1891.[Medline]
  41. Gu, H., D. Kitamura, K. Rajewsky. 1991. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dµ protein and selection of DH element reading frames. Cell 65:47.[Medline]
  42. Williams, A., A. N. Barclay. 1988. The immunoglobulin superfamily: domains for cell surface recognition. Annu. Rev. Immunol. 6:381.[Medline]
  43. Kleinfield, R., M. Weigert. 1989. Analysis of VH gene replacement events in a B-cell lymphoma. J. Immunol. 142:4475.[Abstract]
  44. Chen, C., Z. Nagy, E. Prak, M. Weigert. 1995. Immunoglobulin heavy chain gene replacement: a mechanism of receptor editing. Immunity 3:747.[Medline]
  45. Hardy, R.. 1992. Variable gene usage, phthsiology and development of Ly1+ (CD5+) B cells. Curr. Opin. Immunol. 4:181.[Medline]
  46. Freitas, A., L. Andrade, M. P. Lembezat, A. Coutinho. 1990. Selection of VH gene repertoires: differentiating B cells of adult bone marrow mimic fetal development. Int. Immunol. 2:15.[Abstract/Free Full Text]
  47. Viale, A. C., A. Coutinho, A. A. Freitas. 1992. Differential expression of VH gene families in peripheral B-cell repertoires of newborn or adult IgH congenic mice. J. Exp. Med. 175:1449.[Abstract/Free Full Text]
  48. Huetz, F., U. Tornberg, E. Malanchère, J. Roes, L. Carlsson, A. Coutinho, D. Holmberg, K. Rajewsky. 1997. Targeted disruption of the VH81X gene: influence on the B cell repertoire. Eur. J. Immunol. 27:307.[Medline]
  49. Huetz, F., L. Carlsson, U. Tornberg, D. Holmberg. 1993. V-region directed selection in differentiating B lymphocytes. EMBO J. 12:1819.[Medline]
  50. L., Carlsson, C. Övermo, D. Holmberg. 1992. Developmentally controlled selection of antibody genes: characterization of individual VH7183 genes and evidence for stage-specific somatic diversification. Eur. J. Immunol. 22:71.[Medline]
  51. Keyna, U., S. Applequist, J. Jongstra, G. Beck-Engeser, H. Jack. 1995. Ig µ heavy chains with VH81X variable regions do not associate with {lambda} 5. Ann. NY Acad. Sci. 764:39.[Medline]
  52. Keyna, U., G. Beck-Engeser, J. Jongstra, S. Applequist, H.-M. Jack. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155:5536.[Abstract]
  53. ten Boekel, E., F. Melcher, A. Rolink. 1997. Changes in the VH gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B receptor. Immunity 7:357.[Medline]
  54. Pan, P., M. Lieber, J. Teale. 1997. The role of recombination signal sequences in the preferential joining by deletion in DH-JH recombination and in the ordered rearrangement of the IgH locus. Int. Immunol. 9:515.[Abstract/Free Full Text]
  55. Nadel, B., S. Tehranchi, A. J. Feeney. 1995. Coding end processing is similar throughout ontogeny. J. Immunol. 154:6430.[Abstract]
  56. Alessandrini, A., S. V. Desiderio. 1991. Coordination of immunoglobulin DJH transcription and D-to-JH rearrangement by promoter-enhancer approximation. Mol. Cell. Biol. 11:2096.[Abstract/Free Full Text]
  57. Blackwell, T., M. Moore, G. Yancopolous, H. Suh, S. Lutzger, E. Selsing, F. Alt. 1986. Recombination between immunoglobulin variable region gene segments is enhanced by transcription. Nature 324:585.[Medline]
  58. Fondell, J. D., K. B. Marcu. 1992. Transcription of germ line V {alpha} segments correlates with ongoing T-cell receptor {alpha}-chain rearrangement. Mol. Cell. Biol. 12:1480.[Abstract/Free Full Text]
  59. Grawunder, U., A. Rolink, F. Melchers. 1995. Induction of sterile transcription from the {kappa}L chain gene locus in V(D)J recombinase-deficient progenitor B cells. Int. Immunol. 7:1915.[Abstract/Free Full Text]
  60. Martin, D., R. Huang, T. LeBien, B. Van Ness. 1991. Induced rearrangement of {kappa} genes in BLIN-1 human pre-B cell line correlates with germline J-C{kappa} and V{kappa} transcription. J. Exp. Med. 173:639.[Abstract/Free Full Text]
  61. Gu, H., I. Förster, K. Rajewsky. 1990. Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: implications for the joining mechanism and the ontogenic timing of Ly1 B cell and B-CLL progenitor generation. EMBO J. 9:2133.[Medline]
  62. Kitamura, D., K. Rajewsky. 1992. Targeted disruption of µ chain membrane exon causes loss of heavy chain allelic exclusion. Nature 356:154.[Medline]
  63. Decker, D., N. Boyle, N. Klinman. 1991. Predominance of nonproductive rearrangements of VH81X gene segments evidences a dependence of B cell clonal maturation on the structure of nascent H chains. J. Immunol. 147:1406.[Abstract]
  64. Chukwuocha, R., A. Feeney. 1993. Role of homology-directed recombination: predominantly productive rearrangements of VH81x in newborns but not in adults. Mol. Immunol. 30:1473.[Medline]
  65. Nadel, B., A. J. Feeney. 1995. Influence of coding-end sequence on coding-end processing in V(D)J recombination. J. Immunol. 155:4322.[Abstract]
  66. Shin, E. K., F. Natsuda, J. Fujikura, T. Akamizu, H. Sugawa, T. Mori, T. Honjo. 1993. Cloning of a human Ig gene fragment containing both VH-D and D-JH rearrangements. J. Immunol. 23:2365.
  67. Tunyaplin, C., K. Knight. 1997. IgH gene rearrangements on the unexpressed allele in rabbit B cells. J. Immunol. 158:4805.[Abstract]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Larijani, A. Zaheen, D. Frieder, Y. Wang, G. E. Wu, W. Edelmann, and A. Martin
Lack of MSH2 involvement differentiates V(D)J recombination from other non-homologous end joining events
Nucleic Acids Res., November 27, 2005; 33(21): 6733 - 6742.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. S. Williams, A. Martinez, A. Montalbano, A. Tang, A. Mauhar, K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, and A. J. Feeney
Unequal VH Gene Rearrangement Frequency Within the Large VH7183 Gene Family Is Not Due to Recombination Signal Sequence Variation, and Mapping of the Genes Shows a Bias of Rearrangement Based on Chromosomal Location
J. Immunol., July 1, 2001; 167(1): 257 - 263.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Y. Mortuza, I. M. Moreira, M. Papaioannou, P. Gameiro, L. A. Coyle, C. S. Gricks, P. Amlot, H. G. Prentice, A. Madrigal, A. V. Hoffbrand, et al.
Immunoglobulin heavy-chain gene rearrangement in adult acute lymphoblastic leukemia reveals preferential usage of JH-proximal variable gene segments
Blood, May 1, 2001; 97(9): 2716 - 2726.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Li, R. E. Hammer, J. B. George-Raizen, K. C. Meyers, and W. T. Garrard
High-Level Rearrangement and Transcription of Yeast Artificial Chromosome-Based Mouse Ig{kappa} Transgenes Containing Distal Regions of the Contig
J. Immunol., January 15, 2000; 164(2): 812 - 824.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. C. Nicholson, X. Zou, A. V. Popov, G. P. Cook, E. M. Corps, S. Humphries, C. Ayling, B. Goyenechea, J. Xian, M. J. Taussig, et al.
Antibody Repertoires of Four- and Five-Feature Translocus Mice Carrying Human Immunoglobulin Heavy Chain and {kappa} and {lambda} Light Chain Yeast Artificial Chromosomes
J. Immunol., December 15, 1999; 163(12): 6898 - 6906.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, C. C. K.
Right arrow Articles by Wu, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, C. C. K.
Right arrow Articles by Wu, G. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS